AJP - Heart Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 291: H2403-H2408, 2006. First published June 30, 2006; doi:10.1152/ajpheart.01066.2005
0363-6135/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
291/5/H2403    most recent
01066.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Duling, L. C.
Right arrow Articles by Kanagy, N. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Duling, L. C.
Right arrow Articles by Kanagy, N. L.

Loss of {alpha}2B-adrenoceptors increases magnitude of hypertension following nitric oxide synthase inhibition

Laura C. Duling, Tom W. Cherng, Jason R. Griego, Michael F. Perrine, and Nancy L. Kanagy

Vascular Physiology Group, Department of Cell Biology and Physiology, University of New Mexico, Health Sciences Center, Albuquerque, New Mexico

Submitted 7 October 2005 ; accepted in final form 7 June 2006


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Vascular {alpha}2B-adrenoceptors ({alpha}2B-AR) may mediate vasoconstriction and contribute to the development of hypertension. Therefore, we hypothesized that blood pressure would not increase as much in mice with mutated {alpha}2B-AR as in wild-type (WT) mice following nitric oxide (NO) synthase (NOS) inhibition with N{omega}-nitro-L-arginine (L-NNA, 250 mg/l in drinking water). Mean arterial pressure (MAP) was recorded in heterozygous (HET) {alpha}2B-AR knockout mice and WT littermates using telemetry devices for 7 control and 14 L-NNA treatment days. MAP in HET mice was increased significantly on treatment days 1 and 4 to 14, whereas MAP did not change in WT mice (days 0 and 14 = 113 ± 3 and 114 ± 4 mmHg in WT, 108 ± 0.3 and 135 ± 13 mmHg in HET, P < 0.05). MAP was significantly higher in HET than in WT mice days 10 through 14 (P < 0.05). Thus blood pressure increased more rather than less in mice with decreased {alpha}2B-AR expression. We therefore examined constrictor responses to phenylephrine (PE, 10–9 to 10–4 M) with and without NOS inhibition to determine basal NO contributions to arterial tone. In small pressurized mesenteric arteries (inner diameter = 177 ± 5 µm), PE constriction was decreased in untreated HET arteries compared with WT (P < 0.05). L-NNA (100 µM) augmented PE constriction more in HET arteries than in WT arteries, and responses were not different between groups in the presence of L-NNA. Acetylcholine dilated preconstricted arteries from HET mice more than arteries from WT mice. Endothelial NOS expression was increased in HET compared with WT mesenteric arteries by Western analysis. Griess assay showed increased NOx concentrations in HET plasma compared with those in WT plasma. These data demonstrate that diminished {alpha}2B-AR expression increases the dependence of arterial pressure and vascular tone on NO production and that vascular {alpha}2B-AR either directly or indirectly regulates vascular endothelial NOS function.

N{omega}-nitro-L-arginine; mesenteric arteries; vasoconstriction


{alpha}2B-ADRENERGIC RECEPTORS ({alpha}2B-ARs) have been postulated to play an important role in the regulation of blood pressure and vascular tone (19, 27). For example, {alpha}2B-AR antisense delivered into the lateral cerebral ventricle lowers blood pressure in hypertensive rats (17), whereas intravenous administration of {alpha}2-ARs agonists causes vasoconstriction (24) and salt retention (2). Thus activation of {alpha}2B-ARs may contribute to the development of some forms of hypertension (17). However, activation of postganglionic {alpha}2B-ARs can inhibit sympathetic nerve activity (35) and cause vasodilation (38), indicating that activation of {alpha}2B-ARs may either limit or promote the development of hypertension.

Recent studies suggest vascular {alpha}2-ARs contribute to vasoconstriction under some conditions (14, 15). For example, our previous work demonstrates that nitric oxide (NO) synthase (NOS) inhibition hypertension increases vasoconstrictor sensitivity to {alpha}2-AR activation, whereas studies by Flavahan et al. (1) suggest {alpha}2-ARs contribute to cold-induced constriction. However, not all studies observe vasoconstriction in response to {alpha}2-AR agonist activation (1, 13, 25) so that environmental and genetic influences may modulate the role of {alpha}2-ARs in regulating vascular tone.

One such influence appears to be NO synthesis. In coronary arteries, {alpha}2-AR-mediated vasoconstriction was only observed when NOS was inhibited (13). Our studies demonstrate significant {alpha}2-AR-mediated constriction only in arteries with the endothelium removed (5), a response most likely mediated by the 2B subtype (21). Thus we hypothesized that NOS inhibition in vivo would uncover endogenous {alpha}2B-AR-mediated vasoconstriction that would be diminished in mice heterozygous for a mutated, nonfunctional {alpha}2B-AR. In addition, previous studies demonstrated that blood pressure does not increase in heterozygous {alpha}2B-AR knockout (HET) mice following salt loading but does increase in wild-type (WT) mice with full {alpha}2B-AR expression (22). These studies suggest salt intake influences the contribution of {alpha}2B-AR to blood pressure regulation. However, it is unclear whether the protection from developing hypertension in the HET mice is mediated by loss of salt-dependent central nervous system activation of the sympathetic nervous system or by loss of {alpha}2B-AR-mediated vasoconstriction following salt-mediated sympathetic activation. To determine whether there was a vascular component to the protective effect of the HET genotype, we made mice hypertensive by inhibiting NOS, a model independent of the central "salt-sensing" pathway. We hypothesized that because {alpha}2B-AR-mediated vasoconstriction is augmented following NOS inhibition, {alpha}2B-AR-deficient HET mice would not have as great of an increase in arterial pressure as WT mice following NOS inhibition. To test this hypothesis, blood pressure was recorded in HET and WT mice at baseline and after NOS inhibition. Contractile responses to phenylephrine (PE) in the presence and absence of NOS inhibition and acetylcholine-induced dilation were used to assess the effect of {alpha}2B-AR ablation on vascular function. Western analysis of endothelial NOS (eNOS) protein and plasma NOx concentrations were used to determine whether altered {alpha}2B-AR expression levels affect in vivo NOS expression and NO production, respectively.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animals. Mice with a mutated, nonfunctional {alpha}2B-AR originally developed in Kobilka's laboratory (21) used in these studies were derived from a 129Sv/J times C57BL/6J cross. The deletion mutation produces a receptor that does not bind ligand or couple to G proteins (21). Heterozygous crosses maintain the colony of mice in the University of New Mexico animal resources facility. Although other laboratories have found that homozygous knock-out mice (–/–) from this cross are viable (12, 21), no knock-out pups have ever been born in our facility and studies were conducted comparing heterozygous HET mice and their WT littermates. Mice were genotyped by PCR using three primers: WTB+ (CTCTTCTGTACCTCCTCCAT), WTB– (CATAGATTCGCAGGTAGACG) and KO– (TGGATGTGGAATGTGTGCGA). Breeding produced viable, healthy HET and WT mice in a 2:1 ratio. There is a slight decrease in adult body weight and blood pressure in the HET mice (Table 1).


View this table:
[in this window]
[in a new window]
 
Table 1. Baseline values in two genotypes

 
Surgical procedures. Telemeters were implanted using a modification of the procedure described by Butz and Davisson (7). Mice (20–28 g) were given buprenex (0.5 mg/kg sc) 20 min before surgery and anesthetized using ketamine-acepromazine (100·1 mg–1·kg–1 im). The catheter tip was inserted and secured in the carotid artery, and the transmitter (PA-C20, Data Sciences International) was secured subcutaneously above the right flank. Tobramycin (3 mg/kg im) and warmed sterile 0.9% NaCl solution (0.5 ml sc) were given postsurgery, and mice recovered 5–7 days before recording was started. Mean arterial pressure (MAP) and heart rate (HR) were recorded daily for 7 control days and for 14 NOS inhibition days. During the NOS inhibition period, mice were given N{omega}-nitro-L-arginine (L-NNA, 250 mg/l) in their drinking water.

Hemodynamic and activity recordings. MAP, HR, and activity values were recorded continuously each day from 0700 to 1900 and averaged for each mouse using Telemetry Analyzer (JCL Consultants). Each animal was used as a single n value. Data are reported as means ± SE. Two-way repeated measures ANOVA was performed using SigmaStat (SyStat Software) to determine significant differences between groups and between L-NNA and control periods within group.

Contractile studies. Small mesenteric arteries were isolated from untreated WT and HET mice, and the two ends were tied onto small glass cannula in a tissue chamber (Living Systems) on the stage of an inverted microscope. Pressure transducers were placed at either end of the tissue chamber, and the average intraluminal pressure was maintained at 60 mmHg with constant flow (40 µl/min). The average pressure was maintained with a peristaltic pump at the upstream end controlled by a servocontrol system (Living Systems). Inner diameter was recorded using edge detection software (Living Systems) in arteries exposed to increasing concentrations of PE (10–9 to 10–4 M) in the superfusate physiological saline solution. Data were collected and analyzed with data acquisition software (Dataq). In some arteries, L-NNA (100 µM) was added to the superfusate and the lumen after determination of the resting diameter. These arteries were exposed to the NOS inhibitor 15 min before and then throughout exposure to PE. Vasoconstriction to L-NNA and PE is expressed as percent constriction (i.e., diameter in Ca2+ free buffer used as 0% constriction).

Acetylcholine-induced dilation was recorded in arteries pressurized to 60 mmHg without flow through the lumen to remove the influence of flow-induced dilation. Arteries were constricted with PE (10–6 M) and then exposed to increasing concentrations of acetylcholine (10–9 to 10–4 M) in the continued presence of PE (all drugs administered in superfusate). Dilation was recorded as percent reversal of the PE constriction (i.e., 100% = baseline diameter) as measured with IonWizard edge-detection software (IonOptix).

Animal activity. Daily activity was recorded from 0700 to 1900 and averaged using Telemetry Analyzer (JCL Consultants). Data are reported as means ± SE.

Western analysis. Mesenteric arteries (200 to 50 µM diameter) were cleaned and frozen in liquid nitrogen. Frozen tissues were homogenized in cold Tris·HCl homogenization buffer containing dithiothreitol (1.5 mg/ml), EDTA (3.7 mg/ml), benzamidine (1.57 mg/ml), Complete (Roche protease inhibitor cocktail, 30 µl/ml), and phenylmethylsulfonyl fluoride (25 µl/ml) using a ground glass homogenizer. Homogenates were sonicated then spun at 4,000 g for 4 min at 4°C. The supernatant was analyzed for protein concentration using the bicinchoninic acid method (Pierce). Samples were separated in a 4–20% Tris·HCl polyacrylamide gradient gel (Bio-Rad) containing samples (50 µg protein/lane) and molecular weight markers. After transfer to Immun-Blot membrane (Bio-Rad), blots were blocked overnight in Tris-buffered saline (TBS, with 0.5% Triton X-100, 3% BSA, and 5% milk) and then washed with TBS and incubated with monoclonal antibodies specific for eNOS (1:2,500, Transduction Labs). Developed blots were exposed to X-OMAT film and analyzed using SigmaGel software (SyStat).

Griess assay. Plasma samples collected from untreated HET and WT mice were analyzed for NOx using a microplate Greiss assay as described previously (32). Samples and NaNO3 standards were loaded into a 96-well plate in duplicate. Samples were reduced with nitrate reductase and NADPH at room temperature for 3 h. After reduction, Greiss reagent (1% sulfanilamide, 0.1% naphthylethelenediamine dihydrochloride, and 2.5% phosphoric acid) was added to each sample. After 10 min of incubation, absorption was read at 595 {lambda}, and concentration was determined using the standard curve.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Hemodynamic studies. MAP and HR were not different between groups at baseline, although body weight was lower in the HET mice (Table 1). MAP increased significantly in the HET mice compared with that of the control period on days 1 and 4–14 of L-NNA treatment (Fig. 1). MAP in WT mice did not change from baseline pressure (Fig. 1). MAP was significantly higher in HET mice compared with MAP in WT mice on days 12–14 (Fig. 1).


Figure 1
View larger version (20K):
[in this window]
[in a new window]
 
Fig. 1. Daily mean arterial pressures (MAP) (A) and heart rate (HR) (B) in mice during the control period (untreated drinking water) and during the treatment period [drinking water containing N{omega}-nitro-L-arginine (L-NNA), 250 mg/l]. Arterial pressure increased significantly in heterozygous mice (HET, +/–, open symbols) by day 1 of treatment (#P < 0.05) but did not change from control in the wild-type (WT, +/+, solid symbols) mice. Arterial pressure was significantly greater in HET mice compared with the WT mice (*P < 0.05). HR did not change during treatment and was not different between groups.

 
Contractile studies. Vasoconstriction in response to increasing concentrations of PE demonstrate that HET arteries constrict less to PE than WT arteries (Fig. 2). However, PE constriction was not different between groups treated with L-NNA (Fig. 2). Starting diameters were not different between groups (174 ± 4 and 172 ± 4 µm in WT and HET, respectively; Table 2) but in the presence of L-NNA, diameter was less in HET arteries than in WT arteries (166 ± 12 and 163 ± 15 µm, respectively, P < 0.05), and L-NNA treatment caused a greater shift in the PE concentration response curve from the HET than from the WT mice (Fig. 3). In summary, although L-NNA constricted all arteries, the constriction was greater in the HET arteries than in the WT arteries.


Figure 2
View larger version (13K):
[in this window]
[in a new window]
 
Fig. 2. Percent vasoconstriction to increasing concentrations of phenylephrine in the absence (A) and presence (B) of L-NNA (100 µM). In untreated arteries, arteries from WT mice had significantly more vasoconstriction than arteries from HET (*P < 0.05). Phenylephrine constriction was not different between groups when treated with L-NNA.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Vascular parameters in two genotypes

 

Figure 3
View larger version (14K):
[in this window]
[in a new window]
 
Fig. 3. Percent vasoconstriction to phenylephrine with and without L-NNA within groups. L-NNA had a greater effect in arteries from HET mice (B) than in arteries from WT mice (A).

 
Dilation study. In arteries constricted with PE (10–6 M), acetylcholine caused a concentration-dependent dilation that was greater in the HET compared with WT arteries (Fig. 4). The dilation was reversed to a constriction at concentrations greater than 10–5 M. Diameters in Ca2+-free physiological saline solution were not different between groups (WT = 163 ± 9 and HET = 174 ± 6 µm).


Figure 4
View larger version (13K):
[in this window]
[in a new window]
 
Fig. 4. Percent vasodilation to acetylcholine in arteries constricted with phenylephrine (10–6 M). Acetylcholine caused greater dilation in arteries from HET mice than in arteries from WT mice (*different from WT for P < 0.05).

 
Animal activity. Although activity appears to be greater in HET mice compared with WT mice (Fig. 5), there were no significant differences either between groups (P = 0.165) or between control and treatment periods (P = 0.987).


Figure 5
View larger version (20K):
[in this window]
[in a new window]
 
Fig. 5. Daily activity of mice recorded as events per minute. HET mice appear to be more active in both the control and treatment period than WT mice. There is, however, not a significant difference between groups (P = 0.165).

 
Western analysis. Mesenteric artery homogenates were probed for eNOS using a monoclonal antibody (1:2,500, Transduction Labs), and the membranes were stained for total protein loading using Coomassie blue dye. The immunostained bands detected with X-OMAT film were scanned and densitized (Sigma Gel, SyStat Softeware) and then normalized for Coomassie staining intensity. The normalized values for the small mesenteric arteries from HET mice were significantly greater than those from the WT tissues (Fig. 6).


Figure 6
View larger version (18K):
[in this window]
[in a new window]
 
Fig. 6. Immunostaining of endothelial nitric oxide synthase (eNOS) in mesenteric artery homogenates from HET and WT mice. Densitized values of the immunoblot were normalized to the density of corresponding lanes in Coomassie blue-stained membrane (bottom) and are expressed as a ratio. *Significantly different from WT for P < 0.05.

 
Griess assay. Plasma NOx concentrations were significantly elevated in samples from HET mice compared with samples from WT mice (Fig. 7).


Figure 7
View larger version (9K):
[in this window]
[in a new window]
 
Fig. 7. NOx levels in plasma from untreated WT and HET mice. There was significantly more NOx detected in the plasma from the HET mice compared with the plasma from the WT mice (P < 0.05).

 

    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Conflicting reports on the role of {alpha}2B-ARs in cardiovascular control have left its involvement in blood pressure regulation unclear. Activation of central {alpha}2B-ARs has been reported to increase blood pressure (10), and ablation of {alpha}2B-ARs prevents both the initial pressor response to the {alpha}2-AR agonist clonidine (21) and the hypertensive response to salt loading (22). Studies have also shown that a deletion polymorphism in the human {alpha}2B-AR gene, which prevents receptor desensitization, is associated with hypertension in some populations (37). Thus activation of {alpha}2B-ARs may increase blood pressure under certain conditions. One condition that is thought to increase arterial pressure by activating {alpha}2B-ARs is salt loading. This is supported by observations that uninephrectomized WT mice become hypertensive to salt loading but {alpha}2B-AR HET knockout mice do not (22). Furthermore, intracerebroventricular administration of {alpha}2B-AR antisense decreases blood pressure in hypertensive rats (16, 17) suggesting central {alpha}2B-ARs are at least partially responsible for this effect. Therefore, most studies suggest central {alpha}2B-ARs actively participate in the development and/or maintenance of salt-sensitive increases in blood pressure and are necessary for the development of some forms of hypertension.

However, our observation that HET mice became hypertensive following chronic NOS inhibition, whereas WT mice did not become hypertensive, suggests that very different mechanisms mediate the increases in arterial pressure between this model and salt-induced hypertension. In salt-induced hypertension, there is at least an initial volume expansion that contributes to the sustained increase in blood pressure (11). Salt loading is also thought to increase sympathetic activity to mediate the sustained increase in arterial pressure by a "salt sensor" system in the brain stem (4) so that the hypertension is maintained by elevated vasoconstriction. In contrast, NOS inhibition induces hypertension primarily through loss of a vasodilator (33). Because previous studies have observed that increased eNOS expression protects against vasoconstriction-dependent hypertension (26, 36), elevated eNOS expression in arteries of HET mice might have contributed to the resistance of these mice to developing hypertension in previous studies (3). Indeed, the greater increase in blood pressure following NOS inhibition in HET mice appears to have uncovered a unique role for {alpha}2B-ARs in regulating vascular tone through controlling eNOS expression and function.

The mechanism whereby {alpha}2B-ARs might regulate eNOS expression is unknown. It has been demonstrated that {alpha}2-ARs stimulate eNOS activity in endothelial cells (9, 18). Therefore, loss of endogenous {alpha}2-AR activation of eNOS could potentially remove NO feedback inhibition to increase eNOS expression. However, endothelium-dependent dilation appears to be mediated through activation of {alpha}2A-ARs (28) and is unaltered in {alpha}2B-AR HET mice. Thus decreased NO feedback inhibition of eNOS expression is unlikely to explain the elevated eNOS expression in the HET mice.

Other receptor-dependent regulators of eNOS expression include PPAR activators that increase eNOS expression through a mitogen-activated protein kinase, cSrc pathway (6), and TNF-{alpha}, which activates Rho kinase (ROK)-dependent mRNA destabilization (34). Because we have previously demonstrated that {alpha}2B-ARs also activate ROK (5), it will be interesting to determine whether {alpha}2B-ARs directly control eNOS expression through this pathway in endothelial cells.

Alternatively, there may be increased blood flow in arteries of the {alpha}2B-AR HET mice caused by diminished {alpha}2B-AR constriction (21). It been demonstrated that flow is a potent regulator of eNOS expression (20), and thus this may be an indirect mechanism leading to the upregulation of eNOS in the mesenteric circulation.

Several common genetic variants in the human {alpha}2B-ARs have been identified that are associated with cardiovascular pathology. One of the best characterized is a nine-base pair in-frame deletion that leads to the loss of three glutamine residues [Del(301–303)]. One recent study reported that the Del(301–303) polymorphism does not affect resting arterial pressure or the pressor response to yohimbine (8), but most previous studies have found an association between the Del(301–303) polymorphism and the incidence of hypertension (37), coronary disease (30, 31), and risk for cardiovascular mortality (23, 29). Therefore, if {alpha}2B-ARs regulate NOS expression in humans, altered {alpha}2B-AR function in the Del(301–303) population may exacerbate vascular disease by reducing eNOS expression. One speculative conclusion would be that decreased {alpha}2B-AR expression protects from the development of cardiovascular diseases by upregulating eNOS, suggesting that {alpha}2B-AR selective antagonists should be cardioprotective.

Even though the mechanism underlying the upregulation of eNOS vasodilation is not defined, this study does demonstrate that diminished {alpha}2B-AR expression increases the dependence of blood pressure on NO synthesis. Thus {alpha}2B-ARs appear to regulate eNOS expression either directly or indirectly and to decrease the contribution of NO production to the control of arterial pressure and vascular tone. Determining the mechanisms underlying this regulation should increase our understanding of the interaction between the sympathetic nervous system and endothelial function in blood pressure control.


    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This study was supported by Evironmental Protection Agency Grant RD-83186001, American Heart Association (AHA) Desert Mountain Affiliate Grant-in-Aid, and a Research Allocations Committee grant from University of New Mexico. N. L. Kanagy is an Established Investigator of the AHA.


    ACKNOWLEDGMENTS
 
We give special thanks to Pam Allgood for expert technical assistance.


    FOOTNOTES
 

Address for reprint requests and other correspondence: N. L. Kanagy, Vascular Physiology Group, Dept. of Cell Biology and Physiology, MSC 08-4750, 1 Univ. of New Mexico, Albuquerque, NM 87131 (e-mail: nkanagy{at}salud.unm.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Bailey SR, Eid AH, Mitra S, Flavahan S, and Flavahan NA. Rho kinase mediates cold-induced constriction of cutaneous arteries: role of alpha2C-adrenoceptor translocation. Circ Res 94: 1367–1374, 2004.[Abstract/Free Full Text]
  2. Bertuzzi ML, Bensi N, Mayer N, Niebylski A, Armario A, and Gauna HF. Renal mechanisms involved in stress-induced antinatriuresis and antidiuresis in rats. Arch Physiol Biochem 111: 259–264, 2003.[CrossRef][Medline]
  3. Bragulat E and de la Sierra A. Salt intake, endothelial dysfunction, and salt-sensitive hypertension. J Clin Hypertens (Greenwich) 4: 41–46, 2002.[Medline]
  4. Camara AK and Osborn JL. Alpha-adrenergic systems mediate chronic central AII hypertension in rats fed high sodium chloride diet from weaning. J Auton Nerv Syst 76: 28–34, 1999.[CrossRef][Web of Science][Medline]
  5. Carter RW, Begaye M, and Kanagy NL. Acute and chronic NOS inhibition enhances {alpha}2-adrenoreceptor-stimulated RhoA and Rho kinase in rat aorta. Am J Physiol Heart Circ Physiol 283: H1361–H1369, 2002.[Abstract/Free Full Text]
  6. Davis ME, Grumbach IM, Fukai T, Cutchins A, and Harrison DG. Shear stress regulates endothelial nitric-oxide synthase promoter activity through nuclear factor kappaB binding. J Biol Chem 279: 163–168, 2004.[Abstract/Free Full Text]
  7. Dogrul A and Uzbay IT. Topical clonidine antinociception. Pain 111: 385–391, 2004.[CrossRef][Web of Science][Medline]
  8. Etzel JP, Rana BK, Wen G, Parmer RJ, Schork NJ, O'Connor DT, and Insel PA. Genetic variation at the human alpha2B-adrenergic receptor locus: role in blood pressure variation and yohimbine response. Hypertension 45: 1207–1213, 2005.[Abstract/Free Full Text]
  9. Feres T, Borges AC, Silva EG, Paiva AC, and Paiva TB. Impaired function of alpha-2 adrenoceptors in smooth muscle of mesenteric arteries from spontaneously hypertensive rats. Br J Pharmacol 125: 1144–1149, 1998.[CrossRef][Web of Science][Medline]
  10. Gavras I, Manolis AJ, and Gavras H. The alpha2 -adrenergic receptors in hypertension and heart failure: experimental and clinical studies. J Hypertens 19: 2115–2124, 2001.[CrossRef][Web of Science][Medline]
  11. Gonzalez-Albarran O, Ruilope LM, Villa E, and Garcia RR. Salt sensitivity: concept and pathogenesis. Diabetes Res Clin Pract 39, Suppl: S15–S26, 1998.[Medline]
  12. Hein L, Altman JD, and Kobilka BK. Two functionally distinct alpha2-adrenergic receptors regulate sympathetic neurotransmission. Nature 402: 181–184, 1999.[CrossRef][Medline]
  13. Ishibashi Y, Duncker DJ, and Bache RJ. Endogenous nitric oxide masks alpha 2-adrenergic coronary vasoconstriction during exercise in the ischemic heart. Circ Res 80: 196–207, 1997.[Abstract/Free Full Text]
  14. Kanagy NL. Alpha(2)-adrenergic receptor signalling in hypertension. Clin Sci (Lond) 109: 431–437, 2005.[Medline]
  15. King D, Etzel JP, Chopra S, Smith J, Cadman PE, Rao F, Funk SD, Rana BK, Schork NJ, Insel PA, and O'Connor DT. Human response to alpha2-adrenergic agonist stimulation studied in an isolated vascular bed in vivo: biphasic influence of dose, age, gender, and receptor genotype. Clin Pharmacol Ther 77: 388–403, 2005.[CrossRef][Web of Science][Medline]
  16. Kintsurashvili E, Gavras I, Johns C, and Gavras H. Effects of antisense oligodeoxynucleotide targeting of the alpha(2B)-adrenergic receptor messenger RNA in the central nervous system. Hypertension 38: 1075–1080, 2001.[Abstract/Free Full Text]
  17. Kintsurashvili E, Johns C, Ignjacev I, Gavras I, and Gavras H. Central alpha2B-adrenergic receptor antisense in plasmid vector prolongs reversal of salt-dependent hypertension. J Hypertens 21: 961–967, 2003.[CrossRef][Web of Science][Medline]
  18. Koletsky RJ, Velliquette RA, and Ernsberger P. The role of I(1)-imidazoline receptors and alpha(2)-adrenergic receptors in the modulation of glucose and lipid metabolism in the SHROB model of metabolic syndrome X. Ann NY Acad Sci 1009: 251–261, 2003.[CrossRef][Web of Science][Medline]
  19. Kwan DC. Heterogeneity of vascular smooth muscle alpha-adrenoceptors in canine blood vessels. Clin Exp Pharmacol Physiol 26: 822–823, 1999.[CrossRef][Web of Science][Medline]
  20. Li Y, Zheng J, Bird IM, and Magness RR. Effects of pulsatile shear stress on signaling mechanisms controlling nitric oxide production, endothelial nitric oxide synthase phosphorylation, and expression in ovine fetoplacental artery endothelial cells. Endothelium 12: 21–39, 2005.[Web of Science][Medline]
  21. Link RE, Desai K, Hein L, Stevens ME, Chruscinski A, Bernstein D, Barsh GS, and Kobilka BK. Cardiovascular regulation in mice lacking alpha2-adrenergic receptor subtypes b and c. Science 273: 803–805, 1996.[Abstract]
  22. Makaritsis KP, Handy DE, Johns C, Kobilka B, Gavras I, and Gavras H. Role of the alpha2B-adrenergic receptor in the development of salt-induced hypertension. Hypertension 33: 14–17, 1999.[Abstract/Free Full Text]
  23. Muszkat M, Kurnik D, Solus J, Sofowora GG, Xie HG, Jiang L, McMunn C, Ihrie P, Harris JR, Dawson EP, Williams SM, Wood AJ, and Stein CM. Variation in the alpha2B-adrenergic receptor gene (ADRA2B) and its relationship to vascular response in vivo. Pharmacogenet Genomics 15: 407–414, 2005.[Web of Science][Medline]
  24. Muszkat M, Sofowora GG, Wood AJ, and Stein CM. Alpha2-adrenergic receptor-induced vascular constriction in blacks and whites. Hypertension 43: 31–35, 2004.[Abstract/Free Full Text]
  25. Nase GP and Boegehold MA. Postjunctional {alpha}2-adrenoceptors are not present in proximal arterioles of rat intestine. Am J Physiol Heart Circ Physiol 274: H202–H208, 1998.[Abstract/Free Full Text]
  26. Ohashi Y, Kawashima S, Hirata K, Yamashita T, Ishida T, Inoue N, Sakoda T, Kurihara H, Yazaki Y, and Yokoyama M. Hypotension and reduced nitric oxide-elicited vasorelaxation in transgenic mice overexpressing endothelial nitric oxide synthase. J Clin Invest 102: 2061–2071, 1998.[Web of Science][Medline]
  27. Paris A, Philipp M, Tonner PH, Steinfath M, Lohse M, Scholz J, and Hein L. Activation of alpha 2B-adrenoceptors mediates the cardiovascular effects of etomidate. Anesthesiology 99: 889–895, 2003.[CrossRef][Web of Science][Medline]
  28. Shafaroudi MM, McBride M, Deighan C, Wokoma A, Macmillan J, Daly CJ, and McGrath JC. Two "knockout" mouse models demonstrate that aortic vasodilatation is mediated via alpha2a-adrenoceptors located on the endothelium. J Pharmacol Exp Ther 314: 804–810, 2005.[Abstract/Free Full Text]
  29. Sivenius K, Lindi V, Niskanen L, Laakso M, and Uusitupa M. Effect of a three-amino acid deletion in the alpha2B-adrenergic receptor gene on long-term body weight change in Finnish non-diabetic and type 2 diabetic subjects. Int J Obes Relat Metab Disord 25: 1609–1614, 2001.[CrossRef][Web of Science][Medline]
  30. Snapir A, Heinonen P, Tuomainen TP, Alhopuro P, Karvonen MK, Lakka TA, Nyyssonen K, Salonen R, Kauhanen J, Valkonen VP, Pesonen U, Koulu M, Scheinin M, and Salonen JT. An insertion/deletion polymorphism in the alpha2B-adrenergic receptor gene is a novel genetic risk factor for acute coronary events. J Am Coll Cardiol 37: 1516–1522, 2001.[Abstract/Free Full Text]
  31. Snapir A, Mikkelsson J, Perola M, Penttila A, Scheinin M, and Karhunen PJ. Variation in the alpha2B-adrenoceptor gene as a risk factor for prehospital fatal myocardial infarction and sudden cardiac death. J Am Coll Cardiol 41: 190–194, 2003.[Abstract/Free Full Text]
  32. Stanley KP, Chicoine LG, Young TL, Reber KM, Lyons CR, Liu Y, and Nelin LD. Gene transfer with inducible nitric oxide synthase decreases production of urea by arginase in pulmonary arterial endothelial cells. Am J Physiol Lung Cell Mol Physiol 290: L298–L306, 2006.[Abstract/Free Full Text]
  33. Takahashi Y, Nakayama T, Soma M, Uwabo J, Izumi Y, and Kanmatsuse K. Association analysis of TG repeat polymorphism of the neuronal nitric oxide synthase gene with essential hypertension. Clin Genet 52: 83–85, 1997.[Web of Science][Medline]
  34. Takemoto M, Sun J, Hiroki J, Shimokawa H, and Liao JK. Rho-kinase mediates hypoxia-induced downregulation of endothelial nitric oxide synthase. Circulation 106: 57–62, 2002.[Abstract/Free Full Text]
  35. Trendelenburg AU, Philipp M, Meyer A, Klebroff W, Hein L, and Starke K. All three alpha2-adrenoceptor types serve as autoreceptors in postganglionic sympathetic neurons. Naunyn Schmiedebergs Arch Pharmacol 368: 504–512, 2003.[CrossRef][Web of Science][Medline]
  36. van Haperen R, de Waard M, van Deel E, Mees B, Kutryk M, van Aken T, Hamming J, Grosveld F, Duncker DJ, and de Crom R. Reduction of blood pressure, plasma cholesterol, and atherosclerosis by elevated endothelial nitric oxide. J Biol Chem 277: 48803–48807, 2002.[Abstract/Free Full Text]
  37. Von Wowern F, Bengtsson K, Lindblad U, Rastam L, and Melander O. Functional variant in the (alpha)2B adrenoceptor gene, a positional candidate on chromosome 2, associates with hypertension. Hypertension 43: 592–597, 2004.[Abstract/Free Full Text]
  38. Wang SY. Vasoconstrictive versus vasodilatory effects of alpha-2 adrenergic agonists on the spinal microcirculation. Anesthesiology 92: 1488–1489, 2000.[Web of Science][Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
T. W. Cherng, M. J. Campen, T. L. Knuckles, L. Gonzalez Bosc, and N. L. Kanagy
Impairment of coronary endothelial cell ETB receptor function after short-term inhalation exposure to whole diesel emissions
Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2009; 297(3): R640 - R647.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
291/5/H2403    most recent
01066.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Duling, L. C.
Right arrow Articles by Kanagy, N. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Duling, L. C.
Right arrow Articles by Kanagy, N. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.