AJP - Heart Calcium Transients and Cell-Sarcomere
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 292: H516-H521, 2007. First published August 25, 2006; doi:10.1152/ajpheart.00246.2006
0363-6135/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
292/1/H516    most recent
00246.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Basi, D. L.
Right arrow Articles by Hall, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Basi, D. L.
Right arrow Articles by Hall, J. L.

Femoral artery neointimal hyperplasia is reduced after wire injury in Ref-1+/– mice

David L. Basi,1,* Neeta Adhikari,2,* Ami Mariash,2 Qinglu Li,2 Esther Kao,2 Sureni V. Mullegama,2 and Jennifer L. Hall2

1University of Minnesota School of Dental Medicine, Division of Oral and Maxillofacial Surgery; and 2University of Minnesota Lillehei Heart Institute, Division of Cardiology, Department of Medicine, Minneapolis, Minnesota

Submitted 9 March 2006 ; accepted in final form 22 August 2006


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Redox factor-1 (Ref-1) is a multifunctional protein that regulates redox, DNA repair, and the response to cell stress. We previously demonstrated that Ref-1+/– mice exhibit a significantly reduced Ref-1 mRNA and protein levels within the vasculature, which are associated with increased oxidative stress. The goal of this study was to test the hypothesis that partial loss of Ref-1 altered the cellular response to vascular injury. Fourteen days after femoral artery wire injury, we found that vessel intima-to-media ratio was significantly reduced in Ref-1+/– mice compared with that in wild-type mice (P < 0.01). Bromodeoxyuridine labeling and transferase-mediated dUTP nick-end labeling staining at 14 days did not differ in the Ref-1+/– mice. In vitro studies found no significant changes in either serum-induced proliferation or baseline apoptosis in Ref-1+/– vascular smooth muscle cells. Exposure to Fas ligand; however, did result in increased susceptibility of Ref-1+/– vascular smooth muscle cells to apoptosis (P < 0.001). Ref-1+/– mice exhibited an increase in circulating baseline levels of IL-10, IL-1{alpha}, and VEGF compared with those in wild-type mice but a marked impairment in these pathways in response to injury. In sum, loss of a single allele of Ref-1 is sufficient to reduce intimal lesion formation and to alter circulating cytokine and growth factor expression.

redox factor-1; vascular biology; vascular injury; inflammation; neointima formation


REMODELING OF THE VESSEL WALL in response to vascular injury involves the coordinated regulation of cytokines and chemokines affecting apoptosis, cell recruitment, proliferation, migration, and differentiation. We are interested in the identification of upstream candidate genes that collectively modify several of these events after mechanical injury and may be suitable targets for therapy.

Redox factor-1 (Ref-1) was originally identified as a mediator of redox activation of Fos/Jun DNA binding (26, 27). Since this time, Ref-1 has been found to modify the reduction/oxidation of several transcription factors including NF-{kappa}B, hypoxia-inducible factor-1{alpha}, early growth response-1, and p53 (8, 11, 13). In addition to its role in redox activation, Ref-1 mediates DNA damage and repair (28).

Homozygous deletion of Ref-1 results in embryonic lethality and the presence of pyknotic cells and apoptosis within the vasculature (27). Ref-1+/– mice exhibit a significant reduction in Ref-1+/– mRNA and protein associated with a significant increase in oxidative stress (as measured by elevated F2 isoprostanes) (8, 15). Previous work from our laboratory (4, 6, 7, 18) and others has demonstrated a significant increase in oxidative stress associated with vascular injury. Given the proposed role for Ref-1 in redox activation and response to cellular stress, we hypothesized that partial loss of Ref-1 would alter the process of remodeling in response to vascular injury. We provide evidence that Ref-1+/– mice exhibited a significant reduction in the intima-to-media ratio in response to mechanical injury as well as alterations in the circulating expression levels of various chemokines.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Femoral artery wire injury. All animal surgeries were performed in accord with our approved Institutional Animal Care and Use Committee protocols at the University of Minnesota. Wild-type (WT) and Ref-1+/– mice underwent unilateral femoral artery wire injury as described (14, 25). Briefly, left femoral arteries were isolated under aseptic conditions in 16-wk-old male ketamine/xylene-anesthetized mice. A branch of the femoral artery was partially transected to allow the introduction of a 0.015-in. diameter sterile wire (Cook Critical Care, Bloomington, IN). The wire was passed within the vessel three times and then removed. The arterial branch was ligated and the incision closed. The mice were euthanized 1, 7, 14, or 28 days postinjury and perfusion-fixed at physiological pressures for bromodeoxyuridine (BrdU) and morphometry measurements or snap frozen for real-time quantitative PCR.

Vessel morphometry. Paraffin-embedded noninjured and injured femoral arteries from WT and Ref-1+/– mice were sectioned at 5-µm intervals and stained with hematoxylin and eosin. The hematoxylin and eosin-stained tissue sections were examined to determine the beginning, middle, and the end of each lesion. Cross-sectional arterial microscopic images were analyzed for intima-to-media ratios within the middle portion of each lesion by the computer program (NIH image). Lumen, intimal, and medial areas were individually calculated via computer analysis by circumscribing the lumen edge, internal and external elastic lamina, respectively. The intimal area from each section was determined by a subtraction of the intimal area from the lumen area (i.e., final intimal area = intimal area – lumen area). The medial area was determined by a subtraction of the medial area from the intimal area.

Real-time quantitative PCR. Real-time quantitative PCR was performed as previously described (24). Briefly, RNA was extracted from noninjured and injured mouse femoral arteries collected at different time points postinjury (RNeasy, Qiagen) and reverse transcribed to cDNA (Advantage RT-PCR, BD Biosciences). The primers used to generate the PCR products were as follows: Ref-1 (5' GCTCCGTCAGACAAAGAAGG 3', 5' ACGCTGTCGGTATTCCAGTC 3') and cyclophilin A (5' GTGGTCTTTGGGAAGGTGAA 3', 5' TTACAGGACATTGCGAGCAG 3'). Ref-1-specific mRNA expression was normalized to the expression of housekeeper cyclophilin A using computer software (RelQuant, Roche).

Isolation of vascular smooth muscle cells from WT and Ref-1+/– mice. Vascular smooth muscle cells (VSMCs) were isolated by an enzyme digestion method (19). Briefly, aortas were cut into pieces and incubated with collagenase for 6 h. The collagenase solution was removed, and the cells were cultured and maintained in high-glucose DMEM (Invitrogen) containing 10% FBS (Gibco) and penicillin-streptomycin (Gibco). Isolated cells were assessed for the expression of smooth muscle {alpha}-actin (Sigma) and the lack of platelet endothelial cell adhesion molecule expression (CD31, BD Pharmingen).

NF-{kappa}B immunostaining. Deparaffinized femoral artery tissue sections from non- and 7- and 14-day wire-injured WT and Ref-1+/– mice were immunostained with anti-p65 antibody (Santa Cruz Biotechnology) and the Vectastain kit (Vector).

Cellular proliferation. To estimate cell proliferation in primary aortic VSMCs isolated from WT and Ref-1+/– mice, cells were grown in media containing 10% serum for 4 days and then counted after staining. In vivo proliferation indexes were approximated utilizing BrdU incorporation. Two hours before mouse euthanasia, 14 days following femoral wire injury, BrdU (25 mg/kg) was administered intraperitoneally as previously described (3). Deparaffinized tissue sections were stained with a biotinylated anti-BrdU antibody, streptavidin peroxidase, and 3,3-diaminobenzidine according to the instructions provided by the manufacturer (BrdU Label and Detection Kit, Roche).

Apoptosis. Apoptosis in primary aortic VSMCs was induced with Fas ligand (100 ng/ml, Upstate Biotechnology) in media with 5% FBS. Apoptosis was assessed 20 h later by staining with Hoechst 33342, and the percentage of apoptotic nuclei was quantified as previously described (9, 24). Apoptosis was assessed in tissue sections using transferase-mediated dUTP nick-end labeling (TUNEL) in situ death detection kit (Roche) per the manufacturer's instructions as well as staining with Hoechst 33342.

Cytokine profile. Blood from WT and Ref-1+/– mice at baseline and following injury was collected via cardiac puncture immediately after euthanasia and placed in EDTA containing microcentrifuge tubes. The blood was spun at 1,100 rpm for 10 min, and the plasma was removed and snap frozen. All serum samples were stored at –80°C. Samples were shipped to Rules Based Medicine, which performed chemokine analysis via a Luminex bead-based approach (http://www.rulesbasedmedicine.com/).

Statistics. Comparisons between two groups were analyzed via a Student's t-test (P < 0.05; n refers to the total number of replicates in multiple experiments or, where indicated, to the total number of animals). Data comparisons between multiple groups were analyzed by ANOVA (P < 0.05). Data are presented as means ± SE.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Characterization of Ref-1+/– mice. Previous work in our laboratory (8) demonstrated a significant reduction in both mRNA and protein expression in the vessels of Ref-1+/– mice. In addition, F2 isoprostane levels were significantly elevated in the serum, indicative of increased oxidative stress (WT, 82.7 ± 9.2 vs. Ref-1+/–, 133.9 ± 17.3 pg/ml; n = 7; P < 0.02) (8). No detectable gross morphological differences were seen in noninjured Ref-1+/– femoral arteries compared with WT mice (Fig. 1A, i and ii).


Figure 1
View larger version (40K):
[in this window]
[in a new window]

 
Fig. 1. Redox factor-1 (Ref-1+/–) mice have reduced femoral artery neointimal hyperplasia 14 days after wire injury. Femoral arteries from wild-type (WT) and Ref-1+/– mice at baseline and 14 days postinjury are shown. A: representative hematoxylin and esoin-stained cross sections from noninjured WT (i) and Ref-1+/– (ii) and from injured WT (iii) and Ref-1+/– (iv) femoral arteries. Enlarged images from WT (v) and Ref-1+/– (vi) wire-injured femoral artery illustrate lesion formation. I, intima; M, media; arrows point out internal elastic laminae and edge of intima. B: the intima (I)-to-media (M) ratio is significantly reduced in Ref-1+/– femoral arteries compared with that in WT-injured vessels (n = 5 per group, means ± SE, *P < 0.01).

 
Neointimal hyperplasia was reduced in Ref-1+/– mice following mechanical injury. Each animal underwent a well-characterized unilateral femoral artery wire injury as previously described (14, 21, 25). At 14 days post-wire injury, Ref-1+/– mice exhibited a significant reduction in the intima-to-media ratio compared with WT animals (Fig. 1, A, iii-vi, and B). Medial areas were not significantly different between the Ref- 1+/– and WT mice (WT, 0.127 ± 0.01 vs. Ref-1+/–, 0.125 ± 0.009; n = 5/group P = 0.92). Cellular composition of the lesions in Ref-1+/– and WT mice was not significantly different and consisted primarily of smooth muscle cells (smooth muscle {alpha}-actin positive cells).

Cellular proliferation and apoptosis. Cell proliferation, estimated by measuring BrdU staining within the vessels, was not significantly different when comparing Ref-1+/– to WT mice at 14 days (Fig. 2A, i and ii). To determine whether there was an inherent defect in VSMC proliferation, primary aortic VSMCs were isolated from WT and Ref-1+/– animals. No significant differences were noted between WT and Ref-1+/– VSMCs grown in media containing 10% FBS (Fig. 2B). The 14-day time point was chosen based on the fact that Ref-1 expression was significantly increased in WT mice at 14 days postinjury (Fig. 3). In addition, previous work with this vascular injury model reported significant medial and neointimal proliferative indexes 14 days after injury (14). Apoptosis within the vessel wall was assessed by TUNEL staining. The number of TUNEL positive cells in vessels from WT and Ref-1+/– mice was not different at 7 (not shown) or 14 days (Fig. 4A). Baseline apoptosis in isolated VSMCs from Ref-1+/– and WT mice also showed no difference in the percentage of apoptotic nuclei. In response to Fas ligand, however, Ref-1+/– VSMCs exhibited a significant increase in the percentage of apoptotic nuclei compared with that in WT mice (Fig. 4B).


Figure 2
View larger version (77K):
[in this window]
[in a new window]

 
Fig. 2. Ref-1+/– vascular smooth muscle cell (VSMC) number is similar compared with that in WT cells in vitro. A: representative images from bromodeoxyuridine-stained femoral arteries from WT (i) and Ref-1+/– (ii) mice 14 days after wire injury. B: primary VSMC cultures were established from WT and Ref-1+/– aortas. The number of WT and Ref-1+/– VSMCs in serum containing media was not significantly different between each group (n = 6, means ± SE, P = 0.65).

 

Figure 3
View larger version (7K):
[in this window]
[in a new window]

 
Fig. 3. Ref-1 mRNA expression is increased in femoral arteries after wire injury. Wire-injured WT and Ref-1+/– femoral arteries were harvested at various times after injury. Ref-1- and cyclophilin A-specific mRNA expression was analyzed by real-time quantitative PCR. Ratios of Ref-1 to cyclophilin A were calculated to determine the relative abundance of Ref-1 mRNA expression [n = 4/group, except for day 0 (n = 9), means ± SE, *P < 0.001 (ANOVA)].

 

Figure 4
View larger version (53K):
[in this window]
[in a new window]

 
Fig. 4. A: femoral arteries from WT (i and ii) and Ref-1+/– (iii and iv) were excised 14 days after wire injury and stained with transferase-mediated dUTP nick-end labeling (i and iii) and 4',6-diamidino-2-phenylindole dihydrochloride (DAPI) (ii and iv) (enlarged below each image). B: primary WT and Ref-1+/– VSMC subconfluent cultures were serum starved for 24 h. Apoptosis was induced by Fas ligand. Ref-1+/– VSMCs were more susceptible to Fas ligand-induced apoptosis compared with WT cells (n = 5, means ± SE, *P < 0.001).

 
Femoral artery mechanical injury altered Ref-1+/– and WT serum chemokine and cytokine profiles. A cytokine and chemokine serum profile from noninjured WT and Ref-1+/– mice revealed a potential role for IL-10, IL-1{alpha}, and VEGF. Before wire injury, Ref-1+/– mice demonstrated elevated concentrations of IL-10, IL-1{alpha}, and VEGF compared with those in WT mice (Table 1). In response to injury, however, IL-10, IL-1{alpha}, and VEGF expression were markedly increased at 1 and 7 days in WT mice, which was not observed in the Ref-1+/– mice, suggesting an impaired responsiveness in the Ref-1+/– mice.


View this table:
[in this window]
[in a new window]

 
 
NF-{kappa}B staining was similar in WT- and Ref-1+/–-injured mice. NF-{kappa}B expression was assessed by immunostaining for p65 in tissue sections from femoral arteries 7 or 14 days post-wire injury. No significant differences were detected in the intensity of NF-{kappa}B staining between the WT and Ref-1+/– mice (data not shown). NF-{kappa}B staining was similar in WT and Ref-1+/– noninjured femoral arteries (data not shown).


    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In this study, we found a significant reduction in the intima-to-media ratio within mechanically injured Ref-1+/– femoral arteries compared with that in WT controls 14 days postinjury. This finding suggests an in vivo role for Ref-1 during vascular repair after mechanically induced injury.

Despite a significant reduction in the intima-to-media ratio of Ref-1+/– mice, the mechanism(s) governing this response remain unknown. No significant differences in VSMC proliferation were detected 14 days after injury. However, we cannot exclude the possibility that the proliferative index was altered at an earlier time point. As a second approach to determine whether Ref-1+/– VSMC proliferation was intrinsically different, we assessed VSMC proliferation in vitro. Primary VSMCs from WT and Ref-1+/– mice cultured in media containing 10% FBS grew at a similar rate (Fig. 2B). He et al. (10) reported a significant reduction in PDGF-induced S phase entry as well as a reduction in [3H]thymidine incorporation in VSMC exposed to PDGF following a 50% knockdown in Ref-1 protein with antisense oligodeoxynucleotides. Furthermore, Chyu et al. (2) identified an association between reduced cellular proliferation and decreased Ref-1 expression in inducible nitric oxide synthase-deficient VSMCs. Taken together, these findings suggest that a partial loss of Ref-1 is not sufficient to alter the proliferative index in vivo 14 days postinjury or serum-induced proliferation in vitro. However, Ref-1 may have specific effects in the setting of specific growth factors, such as PDGF. Future studies will be needed to address the role of Ref-1 in VSMC proliferation at earlier time points postinjury and to determine the signaling pathways through which Ref-1 may be altering VSMC proliferation.

We next assessed apoptosis within the injured vessels using TUNEL staining. There was no detectable difference in apoptosis within injured Ref-1+/– and WT vessels at 7- (data not shown) or 14-days postinjury (Fig. 4A). Subsequently, we assessed the apoptotic response of Ref-1+/– VSMCs in vitro. Baseline apoptosis in serum containing media was not significantly different between Ref-1+/– and WT mice. Ref-1+/– VSMCs were more susceptible to Fas ligand-induced apoptosis compared with WT cells in vitro. This agrees with a previous work (8) in endothelial cells with compromised Ref-1 expression. Given the multiple signaling mechanisms at play in vivo, it is not surprising that VSMC apoptosis is not altered in the injured vessels of Ref-1+/– mice, despite the increase in response to Fas ligand in vitro. A limitation of this study is that we are unable to rule out effects of Ref-1 on cell survival at earlier or later time points in response to injury.

We have identified a significant increase in oxidative stress in Ref-1+/– mice (8). An increase in oxidative stress has been associated with marked disruption of cytokine signaling pathways (5, 16, 17). Thus, we utilized a Luminex multiplexing approach to assess a limited number of cytokines and chemokines in response to injury in both Ref-1+/– and WT mice. Interestingly, IL-10 and IL-1{alpha} concentrations appeared to be increased in noninjured Ref-1+/– mice compared with WT animals, and VEGF concentrations were similar. In response to femoral artery wire injury, IL-10, IL-1{alpha}, and VEGF concentrations failed to increase at 7 days following injury in Ref-1+/– mice compared with WT mice, suggesting an impaired responsiveness of these pathways. Given that we used pooled serum samples, the variation in each measurement is not known, which was a limitation of this study. However, these findings parallel earlier studies (1, 20, 22) showing disrupted interleukin signaling in inflammatory disease states and situations in which oxidative stress is high. How alterations in circulating cytokines alter the process of remodeling in response to injury is not well defined.

To further elucidate the mechanism(s) of reduced neointmal hyperplasia in Ref-1+/– mice after injury, we assessed NF-{kappa}B expression in injured vessels by immunohistochemistry. NF-{kappa}B is increased in response to vascular injury (13), and previous work (8) from our laboratory identified a significant loss of NF-{kappa}B activity in the aortas during inflammatory challenge in Ref-1+/– mice compared with WT mice. We did not detect a significant change in NF-{kappa}B activity in injured vessels of Ref-1+/– mice versus WT mice in this study at 7 or 14 days postinjury (data not shown).

Potential signaling mechanisms through which loss of Ref-1 leads to a decrease in lesion formation in response to injury could involve the redox modulation of hypoxia-inducible factor-1{alpha}, activator protein-1, early growth response-1, p53, or other transcription factors regulated by changes in the reduction oxidation state. An intriguing yet untested possibility regarding the decreased number of cells in the lesion of Ref-1+/– mice is hinted at from recent work by Ito et al. (12) showing exhaustion of the stem cell population in response to chronic oxidative stress. Previously published work (23) has suggested that a portion of the cells that populate the lesion arise from progenitor cells in the circulation.

In summary, we provide evidence that the loss of a single copy of Ref-1 is sufficient to reduce lesion formation in response to wire injury. Future studies will be needed to determine the mechanism(s) through which Ref-1 regulates the response to injury. Taken together, these findings suggest that Ref-1 may be an important upstream factor regulating remodeling of the vessel in response to injury.


    ACKNOWLEDGMENTS
 
We thank Drs. Tom Curran and Jared Ordway for the Ref-1+/– mice.


    FOOTNOTES
 

Address for reprint requests and other correspondence: J. L. Hall, Lillehei Heart Institute, Univ. of Minnesota, 420 Delaware St., Minneapolis, MN 55455 (e-mail: jlhall{at}umn.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

* D. L. Basi and N. Adhikari contributed equally to this work. Back


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Bazan NG, Palacios-Pelaez R, Lukiw WJ. Hypoxia signaling to genes: significance in Alzheimer's disease. Mol Neurobiol 26: 283–298, 2002.[CrossRef][Web of Science][Medline]
  2. Chyu KY, Dimayuga PC, Zhao X, Nilsson J, Shah PK, Cercek B. Altered AP-1/Ref-1 redox pathway and reduced proliferative response in iNOS-deficient vascular smooth muscle cells. Vasc Med 9: 177–183, 2004.[Abstract/Free Full Text]
  3. Duckers HJ, Boehm M, True AL, Yet SF, San H, Park JL, Clinton Webb R, Lee ME, Nabel GJ, Nabel EG. Heme oxygenase-1 protects against vascular constriction and proliferation. Nat Med 7: 693–698, 2001.[CrossRef][Web of Science][Medline]
  4. Durand E, Al Haj Zen A, Addad F, Brasselet C, Caligiuri G, Vinchon F, Lemarchand P, Desnos M, Bruneval P, Lafont A. Adenovirus-mediated gene transfer of superoxide dismutase and catalase decreases restenosis after balloon angioplasty. J Vasc Res 42: 255–265, 2005.[CrossRef][Web of Science][Medline]
  5. Ferroni P, Basili S, Falco A, Davi G. Inflammation, insulin resistance, and obesity. Curr Atheroscler Rep 6: 424–431, 2004.[Medline]
  6. Griendling KK, FitzGerald GA. Oxidative stress and cardiovascular injury: Part I: basic mechanisms and in vivo monitoring of ROS. Circulation 108: 1912–1916, 2003.
  7. Griendling KK, FitzGerald GA. Oxidative stress and cardiovascular injury: Part II: animal and human studies. Circulation 108: 2034–2040, 2003.
  8. Guan Z, Basi D, Li Q, Mariash A, Xia YF, Geng JG, Kao E, Hall JL. Loss of redox factor 1 decreases NF-kappaB activity and increases susceptibility of endothelial cells to apoptosis. Arterioscler Thromb Vasc Biol 25: 96–101, 2005.[Abstract/Free Full Text]
  9. Hall JL, Matter CM, Wang X, Gibbons GH. Hyperglycemia inhibits vascular smooth muscle cell apoptosis through a protein kinase C-dependent pathway. Circ Res 87: 574–580, 2000.[Abstract/Free Full Text]
  10. He T, Weintraub NL, Goswami PC, Chatterjee P, Flaherty DM, Domann FE, Oberley LW. Redox factor-1 contributes to the regulation of progression from G0/G1 to S by PDGF in vascular smooth muscle cells. Am J Physiol Heart Circ Physiol 285: H804–H812, 2003.[Abstract/Free Full Text]
  11. Huang RP, Adamson ED. Characterization of the DNA-binding properties of the early growth response-1 (Egr-1) transcription factor: evidence for modulation by a redox mechanism. DNA Cell Biol 12: 265–273, 1993.[Web of Science][Medline]
  12. Ito K, Hirao A, Arai F, Takubo K, Matsuoka S, Miyamoto K, Ohmura M, Naka K, Hosokawa K, Ikeda Y, Suda T. Reactive oxygen species act through p38 MAPK to limit the lifespan of hematopoietic stem cells. Nat Med 12: 446–451, 2006.[CrossRef][Web of Science][Medline]
  13. Jayaraman L, Murthy KG, Zhu C, Curran T, Xanthoudakis S, Prives C. Identification of redox/repair protein Ref-1 as a potent activator of p53. Genes Dev 11: 558–570, 1997.[Abstract/Free Full Text]
  14. Liu P, Patil S, Rojas M, Fong AM, Smyth SS, Patel DD. CX3CR1 deficiency confers protection from intimal hyperplasia after arterial injury. Arterioscler Thromb Vasc Biol 26: 2056–2062, 2006.[Abstract/Free Full Text]
  15. Meira LB, Devaraj S, Kisby GE, Burns DK, Daniel RL, Hammer RE, Grundy S, Jialal I, Friedberg EC. Heterozygosity for the mouse Apex gene results in phenotypes associated with oxidative stress. Cancer Res 61: 5552–5557, 2001.[Abstract/Free Full Text]
  16. Naka Y, Bucciarelli LG, Wendt T, Lee LK, Rong LL, Ramasamy R, Yan SF, Schmidt AM. RAGE axis: animal models and novel insights into the vascular complications of diabetes. Arterioscler Thromb Vasc Biol 24: 1342–1349, 2004.[Abstract/Free Full Text]
  17. Pawlak K, Pawlak D, Mysliwiec M. Oxidative stress influences CC-chemokine levels in hemodialyzed patients. Nephron Physiol 96: 105–112, 2004.[CrossRef]
  18. Pollman MJ, Hall JL, Gibbons GH. Determinants of vascular smooth muscle cell apoptosis after balloon angioplasty injury. Influence of redox state and cell phenotype. Circ Res 84: 113–121, 1999.[Abstract/Free Full Text]
  19. Ray JL, Leach R, Herbert JM, Benson M. Isolation of vascular smooth muscle cells from a single murine aorta. Methods Cell Sci 23: 185–188, 2001.[CrossRef][Medline]
  20. Reid MB, Andrade FH, Balke CW, Esser KA. Redox mechanisms of muscle dysfunction in inflammatory disease. Phys Med Rehabil Clin N Am 16: 925–949, 2005.[Medline]
  21. Roque M, Fallon JT, Badimon JJ, Zhang WX, Taubman MB, Reis ED. Mouse model of femoral artery denudation injury associated with the rapid accumulation of adhesion molecules on the luminal surface and recruitment of neutrophils. Arterioscler Thromb Vasc Biol 20: 335–342, 2000.[Abstract/Free Full Text]
  22. Stenvinkel P. Inflammation in end-stage renal disease: the hidden enemy. Nephrology (Carlton) 11: 36–41, 2006.
  23. Tanaka K, Sata M, Hirata Y, Nagai R. Diverse contribution of bone marrow cells to neointimal hyperplasia after mechanical vascular injuries. Circ Res 93: 783–790, 2003.[Abstract/Free Full Text]
  24. Wang X, Xiao Y, Mou Y, Zhao Y, Blankesteijn WM, Hall JL. A role for the beta-catenin/T-cell factor signaling cascade in vascular remodeling. Circ Res 90: 340–347, 2002.[Abstract/Free Full Text]
  25. Wang Y, Sakuma M, Chen Z, Ustinov V, Shi C, Croce K, Zago AC, Lopez J, Andre P, Plow E, Simon DI. Leukocyte engagement of platelet glycoprotein Ibalpha via the integrin Mac-1 is critical for the biological response to vascular injury. Circulation 112: 2993–3000, 2005.
  26. Xanthoudakis S, Curran T. Identification and characterization of Ref-1, a nuclear protein that facilitates AP-1 DNA-binding activity. EMBO J 11: 653–665, 1992.[Web of Science][Medline]
  27. Xanthoudakis S, Miao G, Wang F, Pan YC, Curran T. Redox activation of Fos-Jun DNA binding activity is mediated by a DNA repair enzyme. EMBO J 11: 3323–3335, 1992.[Web of Science][Medline]
  28. Xanthoudakis S, Miao GG, Curran T. The redox and DNA-repair activities of Ref-1 are encoded by nonoverlapping domains. Proc Natl Acad Sci USA 91: 23–27, 1994.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Circ. Res.Home page
M. P. Cole, T. K. Rudolph, N. K.H. Khoo, U. N. Motanya, F. Golin-Bisello, J. W. Wertz, F. J. Schopfer, V. Rudolph, S. R. Woodcock, S. Bolisetty, et al.
Nitro-Fatty Acid Inhibition of Neointima Formation After Endoluminal Vessel Injury
Circ. Res., November 6, 2009; 105(10): 965 - 972.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
292/1/H516    most recent
00246.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Basi, D. L.
Right arrow Articles by Hall, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Basi, D. L.
Right arrow Articles by Hall, J. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.