AJP - Heart Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 292: H2060-H2072, 2007. First published February 2, 2007; doi:10.1152/ajpheart.01169.2006
0363-6135/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A corrigendum has been published
Right arrow All Versions of this Article:
292/5/H2060    most recent
01169.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (9)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Koneru, S.
Right arrow Articles by Maulik, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Koneru, S.
Right arrow Articles by Maulik, N.

CALL FOR PAPERS
Oxygen Sensing: Life and Death of a Cell

Redox regulation of ischemic preconditioning is mediated by the differential activation of caveolins and their association with eNOS and GLUT-4

Srikanth Koneru,1 Suresh Varma Penumathsa,1 Mahesh Thirunavukkarasu,1 Samson Mathews Samuel,1 Lijun Zhan,1 Zhihua Han,2 Gautam Maulik,3 Dipak K. Das,1 and Nilanjana Maulik1

1Molecular Cardiology and Angiogenesis Laboratory, Department of Surgery, University of Connecticut Health Center, Farmington, Connecticut; 2College of Medicine, East Tennessee State University, Johnson City, Tennessee; and 3Department of Thoracic Surgery, Harvard Medical School, Boston, Massachusetts

Submitted 24 October 2006 ; accepted in final form 30 January 2007


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Reactive oxygen species (ROS) generated during ischemia-reperfusion (I/R) enhance myocardial injury, but brief periods of myocardial ischemia followed by reperfusion [ischemic preconditioning (IP)] induce cardioprotection. Ischemia is reported to stimulate glucose uptake through the translocation of GLUT-4 from the intracellular vesicles to the sarcolemma. In the present study we demonstrated involvement of ROS in IP-mediated GLUT-4 translocation along with increased expression of caveolin (Cav)-3, phospho (p)-endothelial nitric oxide synthase (eNOS), p-Akt, and decreased expression of Cav-1. The rats were divided into the following groups: 1) control sham, 2) N-acetyl-L-cysteine (NAC, free radical scavenger) sham (NS), 3) I/R, 4) IP + I/R (IP), and 5) NAC + IP (IPN). IP was performed by four cycles of 4 min of ischemia and 4 min of reperfusion followed by 30 min of ischemia and 3, 24, 48 h of reperfusion, depending on the protocol. Increased mRNA expression of GLUT-4 and Cav-3 was observed after 3 h of reperfusion in the IP group compared with other groups. IP increased expression of GLUT-4, Cav-3, and p-AKT and p-eNOS compared with I/R. Coimmunoprecipitation demonstrated decreased association of Cav-1/eNOS in the IP group compared with the I/R group. Significant GLUT-4 and Cav-3 association was also observed in the IP group. This association was disrupted when NAC was used in conjunction with IP. It clearly documents a significant role of ROS signaling in Akt/eNOS/Cav-3-mediated GLUT-4 translocation and association in IP myocardium. In conclusion, we demonstrated a novel redox mechanism in IP-induced eNOS and GLUT-4 translocation and the role of caveolar paradox in making the heart euglycemic during the process of ischemia, leading to myocardial protection in a clinically relevant rat ischemic model.

redox signaling; glucose transporter 4; caveolin-1; caveolin-3; nitric oxide; Akt; endothelial nitric oxide synthase


REACTIVE OXYGEN SPECIES (ROS) triggered during ischemia enhance myocardial ischemia-reperfusion (I/R) injury. Although ROS at high concentrations are detrimental, evidence shows that at low concentrations they initiate protective cell signaling. ROS also play a crucial role in cardioprotection (2). Both in vitro and in vivo studies indicate that adaptive response in vascular tissue is triggered by ROS signaling in a highly coordinated manner (28). It appears that the massive amount of ROS produced during ischemia and reperfusion in the vascular tissue, especially in the heart, causes significant injury to the cardiomyocyte and endothelial cells. However, during ischemic preconditioning (IP), the same ROS potentiate a repair process and trigger a signal transduction cascade leading to cardioprotection. ROS appear to pave the way of repairing the vascular tissues that have been damaged during ischemia and reperfusion (29). ROS triggered from brief I/R have been recognized to initiate preconditioning (2) that elicits a biphasic myocardial protection during early phase which lasts for 2 to 3 h, whereas a late phase of protection occurs which lasts for 24–72 h (23, 27). Studies have also demonstrated that antioxidants abolish the induction of preconditioning (33, 42). Moreover, it is known that insulin-induced ROS play an important role in insulin signaling pathway and are supported by one of the reports that insulin-stimulated H2O2 generation is involved in the regulation of downstream insulin signaling by activation of phosphatidylinositol 3-kinase (PI3-kinase), Akt, and ultimately glucose transport. It is well proven that insulin-stimulated glucose uptake in muscle and adipose tissues is the result of translocation of insulin-regulated transporter GLUT-4 to the plasma membrane from the intracellular vesicles. Investigations over the decade have also shown that IP-mediated nitric oxide and oxygen free radicals lead to the activation of multiple signaling pathways resulting in an attenuation of myocardial injury (4, 16). Tong et al. (43) demonstrated IP-induced cardioprotection by activating survival PI3-kinase-Akt cascade followed by eNOS activation and expression, which is the downstream target of Akt (43). Previous studies have shown that both inducible nitric oxide synthase and eNOS are activated, leading to nitric oxide production, which plays a crucial role in myocardial preconditioning (3, 14). Moreover dominant-negative Akt cells prevent insulin-induced GLUT-4 translocation (8). It has also been shown that IP upregulates GLUT-4 expression by activation of AMP-activated protein kinase in a PKC-dependent manner (32). Reports have shown that insulin response results in an initial rapid translocation of GLUT-4 to the plasma membrane and a slower transition of GLUT-4 to the plasma membrane fraction enriched in caveolae (13). Caveolae are small membrane invaginations on the surface of cells that participate in membrane trafficking, sorting, transport, and signal transduction. They are enriched by sphingolipids and cholesterol and form lipid raft with caveolins. Caveolin (Cav)-1, -2, and -3 are believed to play a role in the formation of caveolae membranes, acting as scaffolding proteins, organizing and concentrating caveolin interacting proteins and lipids in caveolae microdomains (1, 25). Cav-3 or M-caveolin is expressed in the muscle, whereas Cav-1 is expressed in the endothelial cells (11, 36). Caveolae and caveolins have the ability to tightly regulate the function of proteins such as eNOS/GLUT-4, whereas in a basal state the activity is inhibited but in a stimulated state the activity can be enhanced by virtue of enrichment and compartmentation, which is also known as caveolar paradox (10).

Although IP-mediated GLUT-4 translocation to the membrane is known, its association with caveolar domains is not known. A major question in this field is, How are these IP-mediated ROS signaling pathways involved in trafficking steps to orchestrate the translocation of eNOS and GLUT-4 to the caveolae? Accordingly, our study aims to observe the IP-mediated translocation of eNOS and GLUT-4 into the caveolar domains and the mechanisms involved in eNOS and GLUT-4 translocation.

In this study we demonstrated for the first time that IP-mediated eNOS and GLUT-4 translocation and its association with Cav-1 and Cav-3 is regulated by ROS signaling. We further demonstrated that IP-mediated eNOS and GLUT-4 translocation is abolished by inhibiting ROS, supporting the notion that IP-mediated eNOS and GLUT-4 translocation and its association with Cav-1 and Cav-3 is redox regulated and may be important for cardioprotection.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animal study. This study was performed in accordance with the principles of laboratory animal care formulated by the National Society for Medical Research and with the Guide for the Care and Use of Laboratory Animals, prepared by the National Academy of Sciences and published by the National Institutes of Health (Publication No. 85-23, Revised 1996). The experimental protocol was approved by the Institutional Animal Care Committee of the Connecticut Health Center (Farmington, CT).

Experimental protocol. Male Sprague-Dawley rats (Harlan, Indianapolis, IN), weighing 250–275 g, were used in this study. The rats were randomized into five groups: 1) control sham (sham represents a surgical procedure without 30 min of ischemia); 2) N-acetyle-L-cysteine (NAC; 80 mg/kg body wt for 2 wk orally) sham (NS); 3) left anterior descending coronary artery (LAD) occlusion for 30 min followed by 3, 24, and 48 h of reperfusion (I/R); 4) preconditioning followed by 30 min of LAD occlusion and reperfusion (IP); and 5) NAC + preconditioning followed by 30 min of LAD occlusion (IP) followed by reperfusion (IPN). All experiments were carried out using six animals in each group.

Surgical procedure. After the rat was anesthetized and mechanically ventilated, its heart was exposed via a left lateral thoracotomy as described by Kaga et al. (17). Cefazolin (25 mg/kg ip) was administered as preoperative antibiotic cover. A 6-0 polypropylene (PE) suture was passed under the LAD at the level of the left atrial appendage. A 10-mm section of polyethylene tube was placed on top of the LAD to secure the occlusion without damaging the artery. Both ends of the suture were passed through a segment of flared PE-160 tubing to form a snare. IP was induced by carrying out a short duration of temporary regional ischemia (4 min) by pulling the snare and clamping the tube with a hemostat, followed by a period of reperfusion (4 min) repeated four times (4 x PC). Myocardial ischemia was produced by temporarily occluding the LAD for 30 min followed by 3, 24, and 48 h of reperfusion. In the I/R group, the rats underwent temporary occlusion of LAD for 30 min after opening the chest for 32 min without the IP procedure. The rats in the sham group underwent the same procedure, except for the LAD occlusion. Myocardial ischemia was confirmed visually in situ by regional cyanosis, ST elevation and depression, or T-wave inversion on the electrocardiogram, and hypokinetic or dyskinetic movement of the myocardium. Reperfusion was readily confirmed by hyperemia over the surface of the previously ischemic-cyanotic segment. After completion of all surgical protocols, the chest wall was closed in layers, as described by Kaga et al. (17). After surgery, analgesic buprenorphine (0.1 mg/kg sc) was given, and the rats were weaned from the respirator and placed on a heating pad while recovering from anesthesia. Surgical procedures for all groups were carried out under similar experimental conditions. The sham group was also treated with buprenorphine.

Measurement of infarct size and cardiomyocyte apoptosis. Infarct size and cardiomyocyte apoptosis were measured after 24 h of reperfusion. Infarct size was measured by in vivo perfusion with 50% Unisperse blue (Ciba-Geigy, Tarrytown, NY), followed by postmortem incubation with 1% triphenyltetrazolium chloride (Sigma) as previously described by Kaga et al. (17). The rat hearts were harvested at predetermined times as per the protocol for paraffin-embedded or frozen tissue sectioning. Double-fluorescent immunohistochemical determination of cardiomyocyte apoptosis was performed with transferase-mediated dUTP nick-end labeling (TUNEL) assay with deparafinized 4-µM-thick sections using an Apop Tag Kit (Oncor Inc) according to kit protocol (17) with an antibody against {alpha}-sarcomeric actin (Sigma). The number of TUNEL-positive cardiomyocytes was counted on 100 high-power fields.

Quantitative real-time RT-PCR. Total RNA was isolated from left ventricular tissue using TRIzol (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol. Reverse transcription proceeded with 1 µg of total RNA using iScript cDNA Synthesis kit (Bio-Rad, Hercules, CA). Quantitative real-time RT-PCR was carried out with iCycler iQ (Bio-Rad). The level of transcripts was shown as a relative expression level using beta-actin transcripts as a standard. The primer sets used in quantitative real-time RT-PCR for GLUT-4 was (forward AGGCACCCTCACTACCCTTT; reverse TTTCCTTCCCAACCATTGAG), for Cav-3 (forward GGTGAACAGAGACCCCAAGA; reverse GGAGACGGTGAAAGTGGTGT), and for Cav-1 was (forward TTGTACCGTGCATCAAGAGC; reverse ATCTCTTCCTGCGTGCTGAT).

Isolation of caveolin-rich preparation. Tissue homogenizing buffer was prepared with 25 mM Tris (pH 7.4), 250 mM sucrose, 2 mM EDTA, 150 mM NaCl, 1% Triton X-100, and protease inhibitor cocktail according to the modified protocol of Liu et al. (26). Sucrose solution (5%, 30%, and 80%) was made in Tris, NaCl, and EGTA. Heart tissue (95–100 mg, left ventricle) was homogenized in 2 ml of buffer with the use of a Polytron homogenizer. The lysate was passed through a 23-gauge needle, and the lysate was sonicated. Following sonication, 2 ml of 80% sucrose was added and mixed to make the sucrose concentration to 40% (1:1 dilution). On the top of this, 4 ml of 30% sucrose were added, followed by 4 ml of 5% sucrose solution. Thus the total volume was made to 12 ml. The tubes containing sucrose gradient were centrifuged at 33,000 rpm for 17 h. Following centrifugation, the gradient was separated into 12 fractions of 1 ml each. Equal amount of tissue (100 mg) was used for all the groups, and the protein was estimated following caveolar fractions isolation. Equal amount of protein was loaded for all the groups to perform Western blot analysis.

Immunoprecipitation for Cav-1/eNOS and Cav-3/GLUT-4 association. Caveolin-rich fractions (fractions 46) were used for immunoprecipitation. Immunoprecipitation was performed with Protein-A and protein G Sepharose from Amersham Biosciences (Piscataway, NJ) using a polyclonal antibody against Cav-1 and Cav-3 monoclonal antibody from Santa Cruz Biotechnology (Santa Cruz, CA). The procedure was carried out according to manufacturer's protocol. The caveolin-rich fractions (fractions 46) were immunoprecipitated with Cav-1 and Cav-3, which were reblotted with eNOS and GLUT-4, respectively.

Western blot analysis for Cav-1, Cav-3, GLUT-4, eNOS, and Akt. To quantify the abundance of the Cav-1, Cav-3, GLUT-4, and phosphorylated and nonphosphorylated eNOS and AKT in the lipid raft fractions, standard SDS-PAGE Western blot analysis was performed with the use of polyacrylamide electrophoretic gels (7%, 10%, and 12%; acrylamide-to-bis ratios). The separated proteins were electrophoretically transferred to Immobilon-P membranes (Millipore, Bedford, MA) using a semidry transfer system (Bio-Rad). Protein standards (Bio-Rad) were run in each gel. The blots were blocked in Tris-buffered saline-Tween 20 (TBS-T) solution containing 20 mM Tris base (pH 7.6), 137 mM NaCl, and 0.1% Tween 20, supplemented with 5% (wt/vol) nonfat dry milk for 1 h; blots were incubated overnight at 4°C with the different primary antibodies. The antibodies were purchased (Cell Signaling Technology, Danvers, MA; Abcam, Cambridge, MA; and Santa Cruz Biotechnology) and were used at manufacturer-recommended dilutions. Membranes were washed three times in TBS-T before incubation for 1 h with horseradish peroxidase-conjugated secondary antibody diluted (1:2,000) in TBS-T and 5% (wt/vol) nonfat dry milk. Following incubation, membranes were washed three times with TBS-T for 10 min each, blots were treated with enhanced chemiluminescence (Amersham Biosciences UK, Buckinghamshire, UK) reagents, and the required proteins were detected by autoradiography for variable lengths of time with Kodak X-Omat film (44).

Immunohistochemistry of Cav-3 and GLUT-4. Paraffin-embedded 4-µm-thick tissue sections were used for immunohistochemical analysis of Cav-3 and GLUT-4. The sections were deparaffinized using Histoclear solution and hydrated using 100%, 90%, 80%, and 70% ethanol followed by a phosphate-buffered saline (PBS) wash. Each step was carried out for 5 min. Slides were placed in boiling antigen retrieval buffer for 15 min and were then allowed to cool at room temperature for 20 min. The slides were again rinsed in PBS. The sections were rinsed in 0.5% BSA and 0.4% Triton X-100 in PBS for 20 min. The slides were blocked in 10% normal donkey serum in 1% BSA plus 0.4% Triton X-100 in PBS for 2 h. Following the blocking, the sections were incubated overnight with primary antibody for Cav-3 (Cat. No. 610421, BD Pharmingen, San Diego, CA) and GLUT-4 (Cat. No. AB1049, Chemicon International, Temecula, CA) and diluted with 1% BSA and 0.4% Triton X-100 in PBS overnight at room temperature. Both primary antibodies were diluted at 1:100 ratios. After overnight incubation, the sections were washed in PBS. The sections were rinsed in 0.5% BSA and 0.4% Triton X-100 in PBS for 20 min. The sections were incubated with FITC-conjugated donkey anti-mouse IgG (for Cav-3) and rhodamine tetramethylrhodamine isothiocyanate-conjugated rabbit anti-goat IgG (for GLUT-4) (both were purchased from Jackson Immunoresearch, West Grove, PA). The secondary antibodies were diluted in 1% BSA and 0.4% Triton X-100 in PBS. The sections were incubated in secondary for 2 h. After incubation, the sections were rinsed in PBS and mounted with Citifluor mounting medium (Vector, Burlingame, CA). The sections were observed and pictures were taken using a Confocal 410 microscope.

Statistical analysis. Results are expressed as means (SD). Differences between groups were tested for statistical significance by one-way ANOVA, followed by Bonferroni's correction, to test for any differences between the mean values of all groups.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Effect of IP on infarct size and cardiomyocyte apoptosis. The infarct size was significantly reduced in IP after 24 h of reperfusion [19% (SD 2.31%)] compared with the I/R group [36% (SD 2.43%)]. Rat hearts pretreated with NAC significantly abolished IP-mediated reduction in infarct size (Fig. 1A). Similarly, cardiomyocyte apoptosis (Fig. 1B) measured after 24 h of reperfusion was also found to be reduced in the IP group compared with the I/R group. No difference was observed between NS and sham groups.


Figure 1
View larger version (12K):
[in this window]
[in a new window]

 
Fig. 1. A: infarct size between comparative groups following 24 h of reperfusion. B: cardiomyocyte apoptosis between comparative groups following 24 h of reperfusion. #P ≤ 0.05 compared with ischemia-reperfusion (I/R) group; {dagger}P ≤ 0.05 compared with ischemic preconditioning (IP) group (n = 6 animals in each group). IPN, N-acetyl-L-cysteine (NAC)-treated animals subjected to IP; HPF, high-powered field.

 
Effect of IP on mRNA expression of Cav-1, Cav-3, and GLUT-4. IP following 3 h of reperfusion (in vivo) documented increased Cav-3 and GLUT-4 mRNA expression but not Cav-1 (Fig. 2A) compared with those in sham, I/R, and IPN groups. NAC abolished the IP-mediated increased Cav-3 and GLUT-4 mRNA expression (Fig. 2, B and C). As expected, NAC sham group has not shown any significant difference compared with control sham.


Figure 2
View larger version (11K):
[in this window]
[in a new window]

 
Fig. 2. A: real-time RT-PCR analysis for caveolin (Cav)-1 mRNA expression between comparative groups. B: Cav-3 mRNA between comparative groups. C: GLUT-4 mRNA between comparative groups. *P ≤ 0.05 compared with control sham-operated group (sham); #P ≤ 0.05 compared with I/R group; {dagger}P ≤ 0.05 compared with IP group (n = 6 animals in each group).

 
Effect of IP on Cav-1 eNOS association. Immunoprecipitation assay with Cav-1 was performed to show the association of Cav-1 and eNOS in the caveolar-rich fractions (fractions 46). Reduced eNOS phosphorylation observed during I/R may be due to increased Cav-1/eNOS interaction that possibly made eNOS unavailable for its activation. However, during IP, we observed dissociation of Cav-1 and eNOS as documented by immunoprecipitation with Cav-1 followed by Western blot (reblot) with eNOS. Thus increased phosphorylation of eNOS in IP may be due to eNOS availability compared with that in non-IP. From Fig. 3 (immunoprecipitation), it is very clear that during I/R, eNOS is significantly associated with Cav-1 after 3, 24, and 48 h of reperfusion. The IPN group demonstrated a modest binding of eNOS with Cav-1 compared with the I/R group, whereas the sham and the NAC groups showed no effect on the association of Cav-1 and e-NOS as documented in Fig. 3.


Figure 3
View larger version (49K):
[in this window]
[in a new window]

 
Fig. 3. Immunoprecipitation with Cav-1 and reblot with endothelial nitric oxide (NO) synthase (eNOS) following 3, 24, and 48 h of reperfusion (n = 4 repeated experiments with equivalent results). NS, NAC sham-operated group.

 
Effect of IP on eNOS phosphorylation. To isolate the lipid raft fractions, samples following 24 and 48 h of reperfusion were used. After isolation of caveolar fractions, the protein was estimated and equal amount of protein was loaded for Western blot analysis. Protein expression was quantitatively measured, and the difference is represented by bar graphs as shown in the figures. IP resulted in increased phosphorylation of eNOS compared with the other groups (Fig. 4, A and B). Increased phosphorylation of eNOS in IP might be due to decreased expression of Cav-1 and, thus, dissociation of Cav-1/eNOS interaction. The phosphorylated eNOS antibody was specific to serine-1177. As expected, phosphorylation of eNOS was found to be decreased following 3 h of reperfusion in the I/R compared with the IP group. However, IP-mediated phosphorylation of eNOS was found to be abolished by NAC in the IPN group. NAC alone has no effect on the phosphorylation of eNOS qualitatively and quantitatively by measuring the ratio of phospho (p)-eNOS/total eNOS as shown in Fig. 4, A and B. eNOS was used as the loading control.


Figure 4
View larger version (55K):
[in this window]
[in a new window]

 
Fig. 4. A: quantitative expression of the phospho (p)-eNOS protein between groups. B: p-eNOS/eNOS protein expression in caveolin/lipid raft fractions after 3 h of reperfusion. Fractions 812 represent cytosolic fractions. *P ≤ 0.05 compared with sham; #P ≤ 0.05 compared with I/R group; {dagger}P ≤ 0.05 compared with IP group (n = 4 repeated experiments with equivalent results).

 
Effect of IP on phosphorylated Akt level. In cytosolic fractions (fractions 812), increased phosphorylation of Akt was observed in IP myocardium compared with I/R and/or IPN following 3 h of reperfusion. IP-induced induction of Akt phosphorylation was abolished in the IPN group (Fig. 5, A and B). However, there was no effect on the phosphorylation of Akt when NAC was used alone. Akt was used as the loading control.


Figure 5
View larger version (43K):
[in this window]
[in a new window]

 
Fig. 5. A: quantitative expression of the p-Akt protein between groups. B: p-Akt/Akt protein expression in caveolin/lipid raft fractions after 3 h of reperfusion. Fractions 812 represent cytosolic fractions. *P ≤ 0.05 compared with sham; #P ≤ 0.05 compared with I/R group; {dagger}P ≤ 0.05 compared with IP group (n = 4 repeated experiments with equivalent results).

 
Effect of IP on Cav-1 and Cav-3 protein levels within lipid rafts. A significant decrease in Cav-1 level was observed in the IP group both in membrane (fractions 46) and cytosolic (fractions 812) fractions compared with that in the I/R and IPN groups, both after 24 and 48 h of reperfusion (Figs. 6, AC, and 7, AC) . In contrast, Cav-3 expression was increased both in membrane (fractions 46) and cytosolic (fractions 812) fractions in IP myocardium and was decreased in I/R and IPN groups compared with the sham group (Figs. 8, AC, and 9, AC) . The expected IP-mediated significant increase in Cav-3 was reduced by the inhibition of ROS by NAC treatment in the IPN group. A similar pattern was observed both at 24 and 48 h after reperfusion. Thus these results validate the involvement of ROS-mediated increased Cav-3 expression in the IP group, which is significantly inhibited in the IPN group. NAC alone demonstrated no effect either on Cav-1 or on Cav-3 compared with the sham group.


Figure 6
View larger version (51K):
[in this window]
[in a new window]

 
Fig. 6. A: quantitative expression of Cav-1 protein between groups in (fractions 46) membrane fractions following 24 h of reperfusion. B: quantitative expression of Cav-1 protein between groups in (fractions 812) cytosolic fractions. C: Cav-1 protein expression in caveolin/lipid raft fractions after 24 h of reperfusion. *P ≤ 0.05 compared with sham; #P ≤ 0.05 compared with I/R group; {dagger}P ≤ 0.05 compared with IP group (n = 4 repeated experiments with equivalent results).

 

Figure 7
View larger version (52K):
[in this window]
[in a new window]

 
Fig. 7. A: quantitative expression of Cav-1 protein between groups in (fractions 46) membrane fractions following 48 h of reperfusion. B: quantitative expression of Cav-1 protein between groups in (fractions 812) cytosolic fractions. C: Cav-1 protein expression in caveolin/lipid raft fractions after 48 h of reperfusion. *P ≤ 0.05 compared with sham; #P ≤ 0.05 compared with I/R group; {dagger}P ≤ 0.05 compared with IP group (n = 4 repeated experiments with equivalent results).

 

Figure 8
View larger version (50K):
[in this window]
[in a new window]

 
Fig. 8. A: quantitative expression of Cav-3 protein between groups in (fractions 46) membrane fractions following 24 h of reperfusion. B: quantitative expression of Cav-3 protein between groups in (fractions 812) cytosolic fractions. C: Cav-3 protein expression in caveolin/lipid raft fractions after 24 h of reperfusion. *P ≤ 0.05 compared with sham; #P ≤ 0.05 compared with I/R group; {dagger}P ≤ 0.05 compared with IP group (n = 4 repeated experiments with equivalent results).

 

Figure 9
View larger version (53K):
[in this window]
[in a new window]

 
Fig. 9. A: quantitative expression of Cav-3 protein between groups in (fractions 46) membrane fractions following 48 h of reperfusion. B: quantitative expression of the Cav-3 protein between groups in (fractions 812) cytosolic fractions. C: Cav-3 protein expression in caveolin/lipid raft fractions after 48 h of reperfusion. *P ≤ 0.05 compared with sham; #P ≤ 0.05 compared with I/R group; {dagger}P ≤ 0.05 compared with IP group (n = 4 repeated experiments with equivalent results).

 
Effect of IP on GLUT-4. Increased expression of GLUT-4 was observed in membrane and cytosolic fractions in IP compared with that in the I/R and IPN groups. The increase in GLUT-4 in the membrane fraction in the IP group might be due to an increased translocation of GLUT-4 following IP. NAC treatment reduced the IP-induced GLUT-4 translocation in the IPN group. Decreased expression of GLUT-4 was observed in both membrane and cytosolic fractions in the I/R and IPN groups (Figs. 10, AC, and 11, AC) compared with that in the IP group. NAC demonstrated no effect on GLUT-4 in the membrane and cytosolic fractions as documented in Figs. 10, A and B, and 11, A and B. A similar pattern was observed both after 24 and 48 h of reperfusion.


Figure 10
View larger version (67K):
[in this window]
[in a new window]

 
Fig. 10. A: quantitative expression of GLUT-4 protein between groups in (fractions 46) membrane fractions following 24 h of reperfusion. B: quantitative expression of GLUT-4 protein between groups in (fractions 812) cytosolic fractions. C: GLUT-4 protein expression in caveolin/lipid raft fractions after 24 h of reperfusion. *P ≤ 0.05 compared with sham; #P ≤ 0.05 compared with I/R group; {dagger}P ≤ 0.05 compared with IP group (n = 4 repeated experiments with equivalent results).

 

Figure 11
View larger version (69K):
[in this window]
[in a new window]

 
Fig. 11. A: quantitative expression of GLUT-4 protein between groups in (fractions 46) membrane fractions following 48 h of reperfusion. B: quantitative expression of the GLUT-4 protein between the groups in (fractions 812) cytosolic fractions. C: GLUT-4 protein expression in caveolin/lipid raft fractions after 48 h of reperfusion. *P ≤ 0.05 compared with sham; #P ≤ 0.05 compared with I/R group; {dagger}P ≤ 0.05 compared with IP group (n = 4 repeated experiments with equivalent results).

 
Effect of IP on Cav-3-GLUT-4 association. An immunoprecipitation assay was performed to show the association of Cav-3 and GLUT-4 (Fig. 12). The samples were immunoprecipitated with Cav-3, followed by Western analysis (reblot) with GLUT-4. IP documented an increased association of GLUT-4 with Cav-3 compared with that in the I/R group. The IPN group demonstrated a modest binding of GLUT-4 with Cav-3 compared with that in the I/R group.


Figure 12
View larger version (42K):
[in this window]
[in a new window]

 
Fig. 12. Immunoprecipitation with Cav-3 and reblot with GLUT-4 following 3, 24, and 48 h of reperfusion (n = 4 repeated experiments with equivalent results).

 
Membrane association of Cav-3 and GLUT-4. Immunohistochemical analysis of Cav-3 and GLUT-4 is summarized in Fig. 13, AC. After 3, 24, and 48 h of reperfusion, an increased sarcolemmal GLUT-4 translocation and its association with Cav-3 were observed in IP myocardium compared with the other groups (Fig. 13, AC, as indicated by arrows). NAC abolished the IP-mediated association of Cav-3 and GLUT-4 at all time points (3, 24, and 48 h).


Figure 13
Figure 13
Figure 13
View larger version (316K):
[in this window]
[in a new window]

 
Fig. 13. Rat cardiac paraffin sections labeled with immunofluorescence and visualized using confocal microscopy following 3 (A), 24 (B), and 48 (C) h of reperfusion. Green fluorescence-labeled Cav-3 (a, d, and g), red fluorescence-labeled GLUT-4 (b, e, and h), and merged photo that clearly shows colocalization of Cav-3 and GLUT-4 (c, f, and i) are shown in A, B, and C.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
In the present study we report IP-mediated eNOS and GLUT-4 translocation and its association to the membrane caveolar-rich fractions. The principal results of this work include increased expression of Cav-3, GLUT-4, p-eNOS, and p-Akt; decreased Cav-1/eNOS; and increased Cav-3/GLUT-4 interaction following IP (Fig. 14). We observed increased translocation of GLUT-4 to the membrane fraction and its colocalization with Cav-3. Increased GLUT-4 and Cav-3 mRNA expression was observed following 3 h of reperfusion in the IP group, whereas increased expression of GLUT-4, Cav-3, p-Akt, and p-eNOS was observed following 24 and 48 h of reperfusion. Although a significant difference was not observed in Cav-1 mRNA expression following IP, however, decreased protein expression was observed following 24 and 48 h of reperfusion. Moreover, it is known that antioxidants abolish the IP-mediated cardioprotection, and, as expected, we have observed a reversal of the expression pattern both in mRNA and protein levels in the presence of NAC. From the results observed, we hypothesize that IP-mediated GLUT-4 translocation might be nitric oxide/ROS mediated and regulated by the caveolar paradox. We also hypothesize that Akt might play an important role in GLUT-4 trafficking in response to IP. Above all, our data convincingly demonstrated data that ROS plays a major role in the whole process of phosphorylation and activation of Akt and eNOS, including GLUT-4 translocation during IP compared with I/R.


Figure 14
View larger version (23K):
[in this window]
[in a new window]

 
Fig. 14. Proposed mechanism of IP-mediated eNOS and GLUT-4 translocation to the Cav-1 and Cav-3, respectively.

 
Previous reports have shown the role of nitric oxide in AMPK-mediated glucose uptake and GLUT-4 translocation in the heart (24). Both exercise and insulin-mediated glucose uptake was found to be stimulated by nitric oxide (18, 19, 37). Li et al. (24) observed that a relatively low concentration of nitric oxide donors increased glucose uptake and stimulated GLUT-4 translocation in isolated heart papillary muscles. Reports suggest that caveolae might be involved in insulin-stimulated exocytosis of the GLUT-4 vesicles to the plasma membrane (40). Moreover, it is also shown that two domains of Cav-1 interact with eNOS, and, specifically, when eNOS interacts with caveolin, it is in an inactive form and calmodulin acts as a direct allosteric competitor to promote the Ca2+-dependent activation of eNOS (30, 31). Considering these reports, we thought that Cav-1/eNOS interaction and the impact of IP on the status of caveolin and eNOS would be a major breakthrough in understanding the role of nitric oxide in GLUT-4 translocation since it is shown that IP-mediated cardioprotection is by activation of eNOS. Bolli et al. (3) have shown that late preconditioning against myocardial stunning in rabbits is by generation of nitric oxide (3), and eNOS has been found to be activated in the preconditioning heart (3, 14). The observed decrease in expression of Cav-1 expression and increased phosphorylated eNOS expression in IP myocardium compared with the other groups supported the notion that IP-mediated GLUT-4 translocation might be nitric oxide mediated. This result was supported by the previous studies that show an unavailability of eNOS during I/R may be due to an association of Cav-1/eNOS (7).

The insulin-induced translocation of GLUT-4 to the surface involves different signaling pathways like phosphorylation of insulin receptor substrate-1, activation of PI3-kinase, and serine/threonine kinases like PKC and Akt/PKB. Akt (PKB), a serine/threonine kinase, is a critical enzyme in signal transduction pathways in cell proliferation, apoptosis, and angiogenesis. Phosphorylation of Akt plays a very important role in facilitating growth factor-mediated cell survival and in blocking apoptotic cell death (6). The phosphoinositide signal is transmitted through 3-phosphoinositide-dependent kinase-1 and its downstream targets Akt/PKB. Although the precise mechanism of Akt/PKB action in GLUT-4 translocation remains to be determined, it is known to be involved in GLUT-4 trafficking. Reports have shown that phosphorylation and activation of Akt play an essential role in insulin-stimulated GLUT-4 translocation (8, 15) by being involved in docking and/or fusion of GLUT-4 containing vesicles with the cell surface. Evidence has shown that input of Akt/PKB at the level of intracellular compartments includes migration of Akt to endomembranes containing GLUT-4 in response to insulin (22) and prevention of GLUT-4 interendosomal acceleration in cells expressing dominant-negative Akt/PKB (12). Intriguingly, in adipocytes, it has been shown that active Akt is sufficient to stimulate GLUT-4 translocation and insertion into the plasma membrane (5, 20). We have observed an increased expression of phosphorylated/active Akt in the IP group, supporting the notion that Akt might help in GLUT-4 translocation and trafficking. In addition, signal transduction in IP is through the PI3-kinase-Akt-eNOS-cGMP pathway, which leads to an opening of potassium ATP channels, which in turn activate survival kinases through the generation of ROS (35, 38). Downey and colleagues (21) demonstrated both eNOS and PKC-{epsilon} to be downstream of Akt (21), and PKC-{epsilon} has been shown to induce ROS-mediated cardioprotection in IP, and, furthermore, disruption of the PKC-{epsilon} gene was found to reduce the cardioprotective effect of IP (39). Although IP-mediated cardioprotection by Akt is well proven by the above reports, its role in GLUT-4 translocation is not known, so we hypothesize that an IP-mediated increase in Akt might help in GLUT-4 translocation, at least indirectly in the latter stages of IP for an insertion of GLUT-4 vesicles to the plasma membrane or for an involvement in the trafficking of GLUT-4 vesicles.

Our confocal microscopy study demonstrated increased Cav-3 and GLUT-4 association during IP after 3, 24, and 48 h of reperfusion. This result was also supported by real-time RT-PCR and Western blot analysis. Increased expression of Cav-3 along with GLUT-4 and their association in IP myocardium supports the notion that Cav-3 regulates the IP-mediated GLUT-4 translocation. At present, we have no answer how this GLUT-4 translocation can offer cardioprotection during IP, but it is obvious that it plays a role in spatial and temporal modulation of signal transduction related to this event.

Previous studies show that, in adipocytes, GLUT-4 translocates to caveolin-enriched membrane domains after insulin stimulation (13, 40). In addition, it is a known fact that Cav-3 expression is essentially restricted to muscle cells and cardiac myocytes (41). Insulin resistance and decreased glucose uptake were also observed in Cav-3 null mice (34). A recent report has shown that insulin stimulation activates insulin receptor, PI3-kinase, and Akt in skeletal muscle cells and that an expression of Cav-3 is necessary for the activation of PI3-kinase and Akt since they give evidence that cells lacking Cav-3 expression reduced activation of both PI3-kinase and Akt (9).

Thus, in summary, IP-mediated GLUT-4 translocation may be mediated by 1) dissociation of Cav-1/eNOS interaction resulting in increased phosphorylation of eNOS and 2) increased Akt phosphorylation. Therefore, the mechanism of GLUT-4 translocation to Cav-3 and trafficking after IP may be similar as in the case of insulin-mediated translocation of GLUT-4 to membrane for its association with Cav-3. The reduction in infarct size and cardiomyocyte apoptosis in IP myocardium might be due to the activation of Akt and eNOS, and this effect was abolished partially by NAC. Moreover, we have also observed decreased expression of IP-mediated GLUT-4 translocation in the NAC-treated group, supporting the notion that the effect of IP can be blocked by ROS scavengers like NAC. However, further investigations are needed to confirm the role of ROS in caveolin signaling during IP in knockout animals, demonstrating the mechanism of eNOS and GLUT-4 translocation and its association with Cav-1 and Cav-3.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This study was supported by National Heart, Lung, and Blood Institute Grants HL-56803, HL-69910, and HL-85804 (to N. Maulik) and HL-22559, HL-33889, and HL-56322 (to D. K. Das).


    FOOTNOTES
 

Address for reprint requests and other correspondence: N. Maulik, Molecular Cardiology and Angiogenesis Laboratory, Dept. of Surgery, Univ. of Connecticut Health Center, 263 Farmington Ave., Farmington, CT 06030-1110 (e-mail: nmaulik{at}neuron.uchc.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Anderson RG. Plasmalemmal caveolae and GPI-anchored membrane proteins. Curr Opin Cell Biol 5: 647–652, 1993.[CrossRef][Medline]
  2. Baines CP, Goto M, Downey JM. Oxygen radicals released during ischemic preconditioning contribute to cardioprotection in the rabbit myocardium. J Mol Cell Cardiol 29: 207–216, 1997.[CrossRef][Web of Science][Medline]
  3. Bolli R, Bhatti ZA, Tang XL, Qui Y, Zhang Q, Guo Y. Evidence that late preconditioning against myocardial stunning in conscious rabbits is triggered by the generation of nitric oxide. Circ Res 81: 42–52, 1997.[Abstract/Free Full Text]
  4. Bolli R. The late phase of preconditioning. Circ Res 87: 972–983, 2000.[Abstract/Free Full Text]
  5. Cong LN, Chen H, Li Y, Zhou L, McGibbon MA. Physiological role of Akt in insulin stimulated translocation of GLUT4 in transfected rat adipose cells. Mol Endocrinol 11: 1881–1890, 1997.[Abstract/Free Full Text]
  6. Datta SR, Brunet A, Greenberg ME. Cellular survival: a play in three Akts. Genes Dev 13: 2905–2927, 1999.[Free Full Text]
  7. Der P, Cui J, Das DK. Role of lipid raft in ceramide and nitric oxide sigmaling in the ischemic and preconditioned hearts. J Mol Cell Cardiol 40: 313–320, 2006.[CrossRef][Web of Science][Medline]
  8. Ducluzeau PH, Fletcher LM, Welsh GI, Tavare JM. Functional consequence of targeting protein kinase B/Akt to GLUT4 vesicles. J Cell Sci 115: 2857–2866, 2002.[Abstract/Free Full Text]
  9. Fecchi K, Volonte D, Hezel MP, Schmeck K, Galbiati F. Spatial and temporal regulation of GLUT4 translocation by flotillin-1 and caveloin-3 in skeletal muscle cells. FASEB J 20: 705–707, 2006.[Abstract/Free Full Text]
  10. Feron O, Kelly RA. The caveolar paradox: suppressing, inducing, and terminating eNOS signaling. Circ Res 88: 129–131, 2001.[Free Full Text]
  11. Fleming I, Busse R. Signal transduction of eNOS activation. Cardiovasc Res 43: 532–541, 1999.[Abstract/Free Full Text]
  12. Foster LJ, Li D, Randhawa VK, Klip A. Insulin accelerates inter-endosomal GLUT4 traffic via phosphatidylinositol-3,4,5-triphosphate and protein kinase B. J Biol Chem 276: 44212–44221, 2001.[Abstract/Free Full Text]
  13. Gustavsson J, Parpal S, Stralfors P. Insulin-stimulated glucose uptake involves the transition of glucose transporters to a caveolae-rich fraction within the plasma membrane: implications for Type II diabetes. Mol Med 2: 367–372, 1996.[Web of Science][Medline]
  14. Hattori R, Otani H, Maulik N, Das DK. Pharmalogical preconditioning with resveratrol: a role of nitric oxide. Am J Physiol Heart Circ Physiol 282: H1988–H1995, 2002.[Abstract/Free Full Text]
  15. Hill MM, Clark SF, Tucker DF, Birnbaum MJ, James DE, Macaulay SL. A role for protein kinase Bbeta/Akt2 in insulin-stimualted GLUT4 translocation in adipocytes. Mol Cell Biol 19: 7771–7781, 1999.[Abstract/Free Full Text]
  16. Hoshida S, Yamashita N, Otsu K, Hori M. The importance of manganese superoxide dismutase in delayed preconditioning: involvement of reactive oxygen species and cytokines. Cardiovasc Res 55: 495–505, 2002.[Abstract/Free Full Text]
  17. Kaga S, Zhan L, Altaf E, Maulik N. Glycogen synthase kinase-3beta/beta-catenin promotes angiogenic and anti-apoptotic signaling through the induction of VEGF, Bcl-2 and survivin expression in rat ischemic preconditioned myocardium. J Mol Cell Cardiol 40: 138–147, 2006.[CrossRef][Web of Science][Medline]
  18. Kapur S, Bédard S, Marcotte B, Côté C, Marette A. Expression of nitric oxide synthase in skeletal muscle: a novel role for nitric oxide as a modulator of insulin action. Diabetes 46: 1691–1700, 1997.[Abstract]
  19. Kingwell BA, Formosa M, Muhlmann M, Bradley SJ, McConell GK. Nitric oxide synthase inhibition reduces glucose uptake during exercise in individuals with Type 2 diabetes more than in control subjects. Diabetes 51: 2572–2580, 2002.[Abstract/Free Full Text]
  20. Kohn AD, Summers SA, Birnbaum MJ, Roth RA. Expression of a constitutively active Akt Ser/Thr kinase in 3T3-L1 adipocytes stimulates glucose uptake and glucose transporter 4 translocation. J Biol Chem 271: 31372–31378, 1996.[Abstract/Free Full Text]
  21. Kreig T, Landsberger M, Alexeyev MF, Cohen MV, Downey JM. Activation of Akt is essential for acetylcholine to trigger generation of oxygen free radicals. Cardiovasc Res 58: 196–202, 2003.[Abstract/Free Full Text]
  22. Kupriyanova TA, Kandror KV. Akt-2 binds to Glut4 containing vesicles and phosphorylates their component proteins in response to insulin. J Biol Chem 274: 1458–1464, 1999.[Abstract/Free Full Text]
  23. Kuzuya T, Hoshida S, Yamashita N, Fuji H, Oe H, Hori M, Kamada T, Tada M. Delayed effects of sublethal ischemia on the acquisition of tolerance to ischemia. Circ Res 72: 1293–1299, 1993.[Abstract/Free Full Text]
  24. Li J, Hu X, Selvakumar P, Russell RR, Cushman SW, Holman GD, Young LH. Role of nitric oxide pathway in AMPK-mediated glucose uptake and GLUT4 translocation in heart muscle. Am J Physiol Endocrinol Metab 287: E834–E841, 2004.[Abstract/Free Full Text]
  25. Lisanti MP, Tang Z, Scherer PE, Kubler E, Koleske AJ, Sargiacomo M. Caveolae, transmembrane signaling and cellular transformation. Mol Membr Biol 12: 121–124, 1995.[Web of Science][Medline]
  26. Liu Y, Casey L, Pike LJ. Compartmentalization of phosphatidylinositol 4,5-bisphosphate in low-density membrane domains in the absence of caveolin. Biochem Biophys Res Commun 245: 684–690, 1998.[CrossRef][Web of Science][Medline]
  27. Marber MS. Ischemic preconditioning in isolated cells. Circ Res 86: 926–931, 2000.[Free Full Text]
  28. Maulik N. Reactive oxygen species drives myocardial angiogenesis. Antioxid Redox Signal 8: 2161–2168, 2006.[CrossRef][Web of Science][Medline]
  29. Maulik N. Molecular control of redox switch in the preconditioned myocardium. Antioxid Redox Signal 6: 321–323, 2004.[CrossRef][Web of Science][Medline]
  30. Michel JB, Feron O, Sacks K, Michel T. Reciprocal regulation of endothelial nitric-oxide synthase by Ca2+-calmodulin and caveolin. J Biol Chem 272: 15583–15586, 1997.[Abstract/Free Full Text]
  31. Michel JB, Feron O, Sase K, Prabhakar P, Michel T. Caveolin versus calmodulin. Counterbalancing allosteric modulators of endothelial nitric oxide synthase. J Biol Chem 272: 25437–25440, 1997.[Abstract/Free Full Text]
  32. Nishino Y, Miura T, Miki T, Sakamoto J, Nakamura Y, Ikeda Y, Kobayashi H, Shimamoto K. Ischemic preconditioning activates AMPK in a PKC-dependent manner and induces GLUT4 up-regulation in the late phase of cardioprotection. Cardiovasc Res 61: 610–619, 2004.[Abstract/Free Full Text]
  33. Osada M, Takeda S, Sato T, Komori S, Tamura K. The protective effect of preconditioning on reperfusion-induced arrhythmia is lost by treatment with superoxide dismutase. Jpn Circ J 58: 259–263, 1994.[Medline]
  34. Oshikawa J, Otsu K, Toya Y, Tsunematsu T, Hankins R, Kawabe J, Minamisawa S, Umemura S, Hagiwara Y, Ishikawa Y. Insulin resistance in skeletal muscles of caveolin-3-null mice. Proc Natl Acad Sci USA 101: 12670–12675, 2004.[Abstract/Free Full Text]
  35. Pain T, Yang XM, Critz SD, Yue Y, Nakano A, Liu GS, Heusch G, Cohen MV, Downey JM. Opening of mitochondrial KATP channels triggers the preconditioned state by generating free radicals. Circ Res 87: 460–466, 2000.[Abstract/Free Full Text]
  36. Park H, Go YM, Darji R, Choi JW, Lisanti MP, Maland MC, Jo H. Caveolin-1 regulates shear stress-dependent activation of extracellular signal-regulated kinase. Am J Physiol Heart Circ Physiol 278: H1285–H1293, 2000.[Abstract/Free Full Text]
  37. Roberts CK, Barnard RJ, Scheck SH, Balon TW. Exercise-stimulated glucose transport on skeletal muscle is nitric oxide dependent. Am J Physiol Endocrinol Metab 273: E220–E225, 1997.[Abstract/Free Full Text]
  38. Samavati L, Monick MM, Sanlioglu S, Beuttner GR, Oberley LW, Hunninghake GW. Mitochondrial KATP channel openers activate the ERK kinase by an oxidant-dependent mechanism. Am J Physiol Cell Physiol 283: C273–C281, 2002.[Abstract/Free Full Text]
  39. Saurin AT, Pennington DJ, Raat NJ, Latchman DS, Owen MJ, Marber MS. Targeted disruption of protein kinase C epsilon gene abolishes the infarct size reduction that follows ischaemic preconditioning of isolated buffer-perfused mouse hearts. Cardiovasc Res 55: 672–680, 2002.[Abstract/Free Full Text]
  40. Scherer PE, Lisanti MP, Baldini G, Sargiacomo M, Mastick CC, Lodish HF. Induction of caveolin during adipogenesis and association of GLUT4 with caveolin-rich vesicles. J Cell Biol 127: 1233–1243, 1994.[Abstract/Free Full Text]
  41. Song KS, Scherer PE, Tang Z, Okamoto T, Li S, Chafel M, Chu C, Kohtz DS, Lisanti MP. Expression of caveolin-3 in skeletal, cardiac, and smooth muscle cells. Caveolin-3 is a component of the sarcolemma and co-fractionates dystrophin and dystrophin-associated glycoproteins. J Biol Chem 271: 15160–15165, 1996.[Abstract/Free Full Text]
  42. Tanaka M, Fujiwara H, Yamasaki K, Sasayama S. Superoxide dismutase and N-2-mercaptopropionyl glycine attenuate infarct size limitation effect of ischaemic preconditioning in the rabbit. Cardiovasc Res 28: 980–986, 1994.[Abstract/Free Full Text]
  43. Tong H, Chen W, Steenbergen C, Murphy E. Ischemic preconditioning activates phosphatidylinositol-3-kinase upstream of protein kinase C. Circ Res 87: 309–315, 2000.[Abstract/Free Full Text]
  44. Vidavalur R, Penumathsa SV, Zhan L, Thirunavukkarasu M, Maulik N. Sildenafil induces angiogenic response in human coronary arteriolar endothelial cells through the expression of thioredoxin, hemeoxygenase and vascular endothelial growth factor. Vascul Pharmacol 45: 91–95, 2006.[CrossRef][Web of Science][Medline]



This article has been cited by other articles:


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. C. R. Carrao, W. M. Chilian, J. Yun, C. Kolz, P. Rocic, K. Lehmann, J. P.H.M. van den Wijngaard, P. van Horssen, J. A.E. Spaan, V. Ohanyan, et al.
Stimulation of Coronary Collateral Growth by Granulocyte Stimulating Factor: Role of Reactive Oxygen Species
Arterioscler Thromb Vasc Biol, November 1, 2009; 29(11): 1817 - 1822.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
Y. M. Tsutsumi, Y. T. Horikawa, M. M. Jennings, M. W. Kidd, I. R. Niesman, U. Yokoyama, B. P. Head, Y. Hagiwara, Y. Ishikawa, A. Miyanohara, et al.
Cardiac-Specific Overexpression of Caveolin-3 Induces Endogenous Cardiac Protection by Mimicking Ischemic Preconditioning
Circulation, November 4, 2008; 118(19): 1979 - 1988.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
G.-Y. Liang, Q.-Y. Cai, Y.-M. Niu, H. Zheng, Z.-Y. Gao, D.-X. Liu, and G. Xu
Cardiac Glucose Uptake and Suppressed Expression/Translocation of Myocardium Glucose Transport-4 in Dogs Undergoing Ischemia-Reperfusion
Experimental Biology and Medicine, September 1, 2008; 233(9): 1142 - 1148.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A corrigendum has been published
Right arrow All Versions of this Article:
292/5/H2060    most recent
01169.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (9)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Koneru, S.
Right arrow Articles by Maulik, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Koneru, S.
Right arrow Articles by Maulik, N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.