AJP - Heart Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Heart Circ Physiol 292: H2083-H2092, 2007. First published January 26, 2007; doi:10.1152/ajpheart.00944.2006
0363-6135/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
292/5/H2083    most recent
00944.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, Z.
Right arrow Articles by Jose, P. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, Z.
Right arrow Articles by Jose, P. A.

CALL FOR PAPERS
Cardiovascular-Renal Mechanisms in Health and Disease

The elevated blood pressure of human GRK4{gamma} A142V transgenic mice is not associated with increased ROS production

Zheng Wang,1 Ines Armando,1 Laureano D. Asico,1 Crisanto Escano,1 Xiaoyan Wang,1 Quansheng Lu,1 Robin A. Felder,2 Christine G. Schnackenberg,3 David R. Sibley,4 Gilbert M. Eisner,5 and Pedro A. Jose1

1Department of Pediatrics and Physiology and Biophysics, Georgetown University School of Medicine, Washington, District of Columbia; 2Department of Pathology, University of Virginia Health Sciences Center, Charlottesville, Virginia; 3Department of Investigative and Cardiac Biology, GlaxoSmithKline, King of Prussia, Pennsylvania; 4Molecular Neuropharmacology Section, National Institute of Neurological Disorders and Stroke/National Institutes of Health, Bethesda, Maryland; and 5Department of Medicine, Georgetown University Medical Center, Washington, District of Columbia

Submitted 31 August 2006 ; accepted in final form 19 January 2007


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
G protein-coupled receptor (GPCR) kinases (GRKs) regulate the sensitivity of GPCRs, including dopamine receptors. The GRK4 locus is linked to, and some of its polymorphisms are associated with, human essential hypertension. Transgenic mice overexpressing human (h) GRK4{gamma} A142V on a mixed genetic background (C57BL/6J and SJL/J) have impaired renal D1-dopamine receptor (D1R) function and increased blood pressure. We now report that hGRK4{gamma} A142V transgenic mice, in C57BL/6J background, are hypertensive and have higher blood pressures than hGRK4{gamma} wild-type transgenic and nontransgenic mice. The hypertensive phenotype is stable because blood pressures in transgenic founders and F6 offspring are similarly increased. To determine whether the hypertension is associated with increased production of reactive oxygen species (ROS), we measured renal NADPH oxidase (Nox2 and Nox4) and heme oxygenase (HO-1 and HO-2) protein expressions and urinary excretion of 8-isoprostane and compared the effect of Tempol on blood pressure in hGRK4{gamma} A142V transgenic mice and D5R knockout (D5–/–) mice in which hypertension is mediated by increased ROS. The expressions of Nox isoforms and HO-2 and the urinary excretion of 8-isoprostane were similar in hGRK4{gamma} A142V transgenic mice and their controls. HO-1 expression was increased in hGRK4{gamma} A142V relative to hGRK4{gamma} wild-type transgenic mice. In contrast with the hypotensive effect of Tempol in D5–/– mice, it had no effect in hGRK4{gamma} A142V transgenic mice. We conclude that the elevated blood pressure of hGRK4{gamma} A142V transgenic mice is due mainly to the effect of hGRK4{gamma} A142V transgene acting via D1R and increased ROS production is not a contributor.

hGRK4 polymorphism; hypertension; reactive oxygen species; G protein-coupled receptor kinases

THE KIDNEY PARTICIPATES IN the long-term and day-to-day control of blood pressure by regulating the transport of electrolytes (e.g., sodium, chloride, and others) and secretion/degradation of vasoactive hormones/humoral agents (21, 32). Some agents promote vasoconstriction and induce sodium retention, like the renin-angiotensin-aldosterone system; others promote vasodilation and enhance sodium excretion, like atrial natriuretic peptide, dopamine, some eicosanoids, and nitric oxide (1, 5, 15, 23, 26). During states of sodium depletion, the renin-angiotensin system is activated to conserve sodium, whereas under conditions of sodium excess, renal dopamine production and the inhibitory effect of dopamine on sodium transport are enhanced (15, 23, 26). Increased activity of the renin angiotensin system and decreased activity of the renal dopaminergic system have been found in some forms of genetic hypertension (6, 15, 16, 26, 53). Thus the ability of dopamine and D1-like agonists to decrease renal tubular transport is impaired in genetic rodent hypertension and human essential hypertension (1, 15, 37). The impairment is not caused by changes in the coding region of the D1-dopamine receptor (D1R), or abnormalities in effector enzymes or proteins, but rather by an uncoupling of the D1R from its G protein/effector complex, similar to a state of desensitization (14, 15).1

G protein-coupled receptor kinases (GRKs) are important in regulating the sensitivity of G protein-coupled receptors to agonist stimulation (9, 17, 27) and have been implicated in genetic and secondary hypertension by participating in the desensitization of G protein-coupled receptors (14, 15). There are seven members of the GRK family, divided into three subfamilies: GRK1 and GRK7 belong to the rhodopsin kinase subfamily; GRK2 and GRK3 belong to the beta-adrenergic receptor kinase subfamily; and GRK4, GRK5, and GRK6 belong to the GRK4 subfamily (9, 14, 15, 39, 40). The GRK4 gene locus, 4p16.3, is linked to human essential hypertension (2, 3, 10). Single-nucleotide polymorphisms of GRK4 are associated with essential hypertension (8, 14, 20, 47, 50, 61) and with increasing blood pressure with age (66). We have reported previously that transgenic mice overexpressing human (h) GRK4{gamma} A142V have increased blood pressure and impaired natriuretic and diuretic but conserved systemic vasodilatory responses to D1-like receptor agonist stimulation (14). hGRK4{gamma} A142V transgenic mice also have increased sensitivity to the hypertensinogenic effects of ANG II and an increased hypotensive response to ANG II type 1 (AT1) receptor blockade (57).

Reactive oxygen species (ROS) may also play an important pathophysiological role in the development and maintenance of hypertension (5, 25, 28, 33, 38, 45, 46, 49, 53, 54, 60, 62). ROS encompass a series of oxygen intermediates that include the free radical superoxide anion (O2–), the nonradical hydrogen peroxide (H2O2), the highly reactive hydroxyl radical (·OH), and hypochlorous acid (42, 53, 60). Generation of ROS is increased in human essential and animal models of hypertension, and a variety of antioxidant treatments reduces blood pressure in genetic and experimentally induced models of hypertension (5, 13, 25, 28, 38, 45, 46, 49, 52–54, 60, 62).

D1-like receptors are involved in the regulation of ROS production. Low concentrations of dopamine, acting at D1R and D5R, decrease ROS in renal tubular and vascular smooth muscle cells (59, 63) and brain cortical cells (36). We have previously reported that stimulation of the D5R results in an antioxidant response that is mediated by inhibition of NADPH oxidase activity, in the short term, and inhibition of NADPH oxidase expression, in the long term (62). Furthermore, hypertension in mice lacking the D5R is caused, in part, by increased systemic ROS production that is related to increased expression/activity of pro-oxidants and decreased expression/activity of antioxidants (62). In contrast, stimulation of AT1 receptors increases ROS production (53, 60). ANG II increases superoxide formation in aortic rings (28), and vascular smooth muscle (13, 33), neuronal (67), renal tubular (60) and afferent arteriolar cells (16).

The aim of the present study was to determine whether increased blood pressure in transgenic mice overexpressing hGRK4{gamma} A142V is mediated by increased ROS production. To this end, we determined the renal expression of NADPH oxidase (Nox2 and Nox4), the major nonmitochondrial enzyme involved in the generation of ROS (60), as well as the expression of heme oxygenase (HO-1 and HO-2), an enzyme that has antioxidant activity (31, 41) . We measured the urinary excretion of 8-isoprostane as an index of oxidative stress (35). We also studied the blood pressure response of transgenic mice overexpressing hGRK4{gamma} wild-type, hGRK4{gamma} A142V, and nontransgenic mice to administration of the superoxide dismutase mimetic Tempol (38, 49). The responses were compared with those in D5–/– mice, in which the increase in blood pressure is mediated by increased ROS (62).


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Transgenic Mice

Construction of the hGRK4{gamma} wild-type and hGRK4{gamma} A142V transgenes. The full-length hGRK4{gamma} wild-type cDNA was originally obtained from reverse transcription-PCR of mRNA of human kidney cortex and subcloned into a pTet-Off response plasmid (Clontech, Palo Alto, CA). The cDNA was removed and inserted into the pcDNA3.1 vector (Invitrogen, Carlsbad, CA) between the KpnI and BamHI restriction sites. The A142V polymorphism was produced by site-directed mutagenesis (Clontech). Both cDNAs including 3-bp 5' untranslated region and 3-bp 3' untranslated region were produced. Sequencing of the complete transgene and junction fragments was carried out to confirm that each transgene construct had a functional cytomegalovirus promoter, an initiation codon, and a bovine growth hormone polyadenylation signal (Georgetown University Macromolecular Analysis Shared Resources).

Generation of transgenic mice. The transgene inserts were removed from the plasmids by digestion with Mfe I and Pvu II (New England Biolabs, Beverly, MA). The digestion reactions yielded a 2.7-kb cDNA product that included the cDNA, promoter, and poly-A tail. The concentrations of the cDNA fragments were adjusted to 0.1–0.2 µg/µl, and the cDNAs were resolved on 1% (wt/vol) low-melt preparative agarose gels and excised. Gel pieces containing the cDNAs were purified using Nucleospin columns (Clontech). The purified hGRK4{gamma} wild-type and hGRK4{gamma} A142V transgene constructs were quantified and microinjected into (C57BL/6J x SJL/J) F2 oocytes and surgically transferred into ovariduct of ICR mice pseudopregnant foster dams previously mated with vasectomized ICR males (14). Tail biopsies (0.5 cm) were obtained 5 wk after microinjection of the eggs (3-wk gestation and 2-wk postnatal) and analyzed for the presence of the transgenic constructs. All procedures involving the generation of transgenic mice were carried out in the University of Michigan Transgenic Core Facility according to the University of Michigan Committee on Use and Care of Animals approved protocols and Guide for the Care and Use of Laboratory Animals, published by the National Institutes of Health (NIH Publication No. 85-23, Revised 1996).

Genotyping of transgenic founders. The screening of transgenic mice was performed with two rounds of PCR. The first set of PCR primers (pcDNA, sense 5'-CGACTCACTATAGGGAGAC-3'; hGRK4, antisense 5'-ATGGTTCCCCTCTTAGGTAG-3') with a thermal cycler profile of 95°C/3 min; 94°C/45 s, 53°C/45 s, 72°C/45 s, 30 cycles; 72°C/10 min, with a 4°C hold, generated a 530-bp product. The second primer set (sense, 5' CGACTCACTATAGGGAGAC 3' and antisense, 5' CTTGATTCTTTGATCGACCTCCTCCC 3') with a thermal cycle profile of 95°C/3 min; 94°C/45 s, 53°C/45 s, 72°C/95 s, 30 cycles; 72°C/10 min, with a 4°C hold, generated a 1,260-bp product. Only those mice that passed two rounds of PCR screenings were used as transgenic founders (Fig. 1). Transgenic founders were identified and weaned at 3 wk of age.


Figure 1
View larger version (17K):
[in this window]
[in a new window]

  		Fig. 1. Identification of transgenic founders by PCR. Top: representative image of a gel of the first-round PCR screening for transgenic founders. Only one of fifteen mice was transgene positive. L, 1-kb ladder; lane 1 to lane 15, DNA samples from 15 puppies; lane 16, positive control. Bottom: representative image of a gel of the second-round of PCR screening for transgenic founders. Eight of thirteen mice that were transgene positive in the first-round screening were also positive in the second-round screening and were chosen as breeding founders. Lane 1 to 13, DNA of the first-round PCR positive samples; lane 14, positive control.

 
Breeding of transgenic mice. Three to five founders of each transgene (wild-type transgenic founder nos. 312, 649, and 657, and A142V transgenic founder nos. 39, 50, 258, 263, and 284) were bred into C57BL/6J (Jackson Laboratory, Bar Harbor, ME). Transgenic positive offspring were identified with the same PCR method used to identify the transgenic founders. The transgene positive offspring were repeatedly backcrossed to different C57BL/6J mice up to F6 for both hGRK4{gamma} wild-type and hGRK4{gamma} A142V transgenes to obtain congenic strains (34). Analysis of transgene expression and phenotype were conducted in these offspring. Both hGRK4{gamma} wild-type and hGRK4{gamma} A142V were expressed in the kidney as determined by reversed transcription-PCR and immunoblotting (14). The ROS study utilized 6- to 13-mo-old (male and female) F5/F6 mice in C57BL/6J background. Nontransgenic littermates of hGRK4{gamma} wild-type and hGRK4{gamma} A142V transgenic mice were used as controls.

D5–/– Mice

The generation of D5–/– mice has been reported previously (22). In our studies, we used >F6 generation mice in a C57BL/6T (C57BL/6 mice from Taconic Farms, Germantown, NY) background (3–6 mo old, male and female) (>98% congenic).

Blood Pressure Determination Under Anesthesia

The animal studies were approved by the Georgetown University Animal Care and Use Committee. The mice were housed in a temperature-controlled facility with a 12:12-h light-dark cycle and fed with mouse chow and water ad libitum. The mice were anesthetized with pentobarbital sodium (50 mg/kg ip) and placed on a heated board to maintain rectal temperature at 37°C. A catheter (PE-50 heat-stretched to 180-µm tip) was then inserted into the right femoral artery and pushed toward the aorta to monitor blood pressure. Another catheter was inserted into the right jugular vein for fluid administration. After a 30- to 60-min stabilization period, blood pressures were monitored using Cardiomax II (Columbus Instruments, Columbus, OH) (14, 22). At the conclusion of the experiment, the mice were killed with an intravenous injection of pentobarbital (100 mg/kg).

Immunoblotting

Kidneys were homogenized in isolation medium (10 mM triethanolamine and 250 mM sucrose adjusted at pH 7.6) containing protease inhibitors, PMSF (100 µg/ml), and leupeptin (10 µg/ml). Homogenates were centrifuged at 1,000 g for 10 min at 4°C. The supernatant was removed, transferred to another tube, and centrifuged at 42,000 g for 30 min at 4°C. The pellet was resuspended in isolation solution and, after protein concentration measurement, mixed with Laemmli solution and kept frozen until assay. Samples were subjected to immunoblotting as previously reported (62). The proteins were electrophoresed and transferred onto nitrocellulose membranes. The membranes were probed with monoclonal anti-HO-1 and polyclonal anti-HO-2 (Stressgen, Victoria, BC, Canada), monoclonal anti-Nox2 (62) and polyclonal anti-Nox4 or polyclonal anti-beta-actin antibodies (Sigma). The Nox4 affinity-purified (SulfoLink, Pierce) antibody used in these studies was raised in rabbit against the peptide KVPSRRTRRLLDKSKT, which is 100% homologous to both rat (NCBI accession no. NP-445976) and mouse [National Center for Biotechnology Information (NCBI) accession no. NP-056575] Nox4 and 93% homologous to human Nox4 (NCBI accession no. AAH40105) at sequence 88–103 of 578 amino acids. Two bands at 55 kDa and 60 kDa were detected in mouse renal cortex homogenates, probably representing Nox4 and its isoforms. The 60-kDa band was no longer visible, whereas the 55-kDa band was greatly diminished when the antibody was preadsorbed by its immunizing peptide, confirming the specificity of the Nox4 antibody (data not shown).

The blots were incubated with peroxidase-conjugated secondary antibody, the bands visualized by ECL reagents (Amersham, Arlington Heights, IL), and the density of the bands quantified by densitometry using Quantiscan (Ferguson, MO), as previously reported (62). The amount of protein transferred onto the membranes was verified by Ponceau-S staining and immunoblotting for beta-actin.

Urine and Tissue Collection

For urine collection, the mice were housed for 24 h in metabolic cages with food and water ad libitum. After this period, the mice were anesthetized and blood pressure was measured as described above. After the animals were killed, the kidneys were harvested and immediately processed for immunoblotting. Urinary protein was determined by Bio-Rad protein assay (Hercules, CA), and 8-isoprostanes were determined by enzyme immunoassay (Cayman Chemicals, Ann Arbor, MI), following the manufacturer's protocol, and values were corrected for urinary creatinine.

Treatment With Tempol

In preliminary experiments, D5–/– mice and their D5+/+ littermate controls were given a bolus intravenous injection of two different doses of Tempol, 10 mg/kg or 30 mg/kg (58 µmol/kg and 174 µmol/kg, respectively) diluted in 40 µl saline. Blood pressure was continuously recorded for 30 min after Tempol injection. In D5–/– mice, the hypotensive effect of a 30 mg/kg dose of Tempol was not greater than that of 10 mg/kg (not shown). Thus, in further experiments, only the 10 mg/kg dose was used in all the mice studied. Transgenic mice overexpressing hGRK4{gamma} wild-type and hGRK4{gamma} A142V and nontransgenic mice were given a bolus infusion of Tempol at a dose of 10 mg/kg, and the blood pressure was monitored for 30 min after Tempol injection.

Statistical Analysis

The data are expressed as means ± SE. Significant differences among and within groups were determined by one-way repeated-measures and factorial ANOVA, Duncan's test for n > 2, and t-test for n = 2. A P < 0.05 was considered as significant.


   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
Blood Pressure Under Pentobarbital Anesthesia

Blood pressure was measured under pentobarbital anesthesia in 37 hGRK4{gamma} wild-type mice, 46 hGRK4{gamma} A142V transgenic mice, and 7 nontransgenic littermates. hGRK4{gamma} wild-type transgenic mice had the same basal systolic and diastolic blood pressure as their nontransgenic littermates (systolic, 102 ± 1 vs. 99 ± 1; diastolic, 72 ± 2 vs. 69 ± 1 mmHg). In contrast, both systolic and diastolic blood pressures of hGRK4{gamma} A142V transgenic mice were higher than those of their nontransgenic littermates or hGRK4{gamma} wild-type transgenic mice (systolic, 124 ± 2; diastolic, 92 ± 1 mmHg) (Fig. 2). The increased blood pressure in hGRK4{gamma} A142V transgenic mice was independent of age and did not affect heart weight as a function of body weight (Table 1). The blood pressures of hGRK4{gamma} wild-type transgenic mice remained in normal range even at 86 wk of age. In contrast, the hGRK4{gamma} A142V transgenic mice had elevated blood pressure as young as 6.5 wk and did not increase any further with age (Table 1). There was no effect of sex on blood pressure in hGRK4{gamma} wild-type or hGRK4{gamma} A142V transgenic mice. Both systolic and diastolic blood pressures of hGRK4{gamma} A142V transgenic mice [males (n = 25): systolic, 126 ± 2; diastolic, 94 ± 2; females (n = 21): systolic, 122 ± 4; diastolic, 91 ± 4 mmHg] were higher than those of hGRK4{gamma} wild-type transgenic mice [males (n = 25): systolic, 98 ± 1; diastolic, 68 ± 1; females (n = 12): systolic, 100 ± 2; diastolic, 72 ± 2 mmHg] regardless of sex (Fig. 3A). The blood pressure phenotype was inherited because the blood pressures of the transgenic founders and their offspring (up to F6) were similar (Fig. 3B).


Figure 2
View larger version (21K):
[in this window]
[in a new window]

  		Fig. 2. Mice blood pressures measured under pentobarbital sodium anesthesia. Data are means ± SE. Both systolic and diastolic blood pressures were higher in hGRK4{gamma} A142V transgenic mice (n = 46) than in nontransgenic littermates (NT; n = 7) and hGRK4{gamma} wild-type transgenic mice (n = 37) (*P < 0.05, one-way factorial ANOVA, Duncan's test).

 

View this table:
[in this window]
[in a new window]

  		Table 1. Blood pressure and body weight of anesthetized transgenic mice

 

Figure 3
View larger version (16K):
[in this window]
[in a new window]

  		Fig. 3. Mice blood pressures measured under pentobarbital anesthesia. A: systolic and diastolic blood pressures in hGRK4{gamma} wild-type (male, n = 25; female, n = 12) and hGRK4{gamma} A142V (male, n = 25; female, n = 21) transgenic mice grouped by sex. B: comparison of systolic and diastolic blood pressures of transgenic founders (hGRK4{gamma} wild type, n = 22; hGRK4{gamma} A142V, n = 12) and their offspring (hGRK4{gamma} wild type, n = 15; hGRK4{gamma} A142V, n = 34).

 
Renal Expression of Nox and HO isoforms

Both Nox2 and Nox4 were expressed in kidneys of nontransgenic, hGRK4{gamma} wild-type, and hGRK4{gamma} A142V transgenic mice. There were no significant differences in the renal expression of both Nox isoforms among the groups. The absolute difference of Nox2 between nontransgenic littermate and hGRK4{gamma} A142V transgenic mice appeared greater than the difference between nontransgenic littermate and hGRK4{gamma} wild-type transgenic mice (Fig. 4A). Both HO isoforms, HO-1 and HO-2, were also expressed in kidneys of the three groups of mice. There were no significant differences among the three groups in the renal expression of HO-2. However, renal HO-1 protein was increased in hGRK4{gamma} A142V relative to hGRK4{gamma} wild-type transgenic mice (P < 0.05, ANOVA, Duncan's test) (Fig. 4B).


Figure 4
View larger version (19K):
[in this window]
[in a new window]

  		Fig. 4. Expression of NADPH oxidase and heme oxygenase (HO) isoforms in kidney membranes from hGRK4{gamma} A142V and hGRK4{gamma} wild-type transgenic and NT mice. Immunoblotting results are expressed as relative density units (DU) and normalized by beta-actin. A: expression of Nox2 (55–60 kDa) and Nox4 (60 kDa). Inset: one blot (n = 7 in NT and hGRK4{gamma} A142V; n = 6 in hGRK4{gamma} wild type). B: expression of HO-1 (35kDa) and HO-2 (40kDa). Inset: one blot (n = 7 in NT and hGRK4{gamma} A142V; n = 6 in hGRK4{gamma} wild type. *P < 0.05, hGRK4{gamma} A142V vs. hGRK4{gamma} wild-type, one-way factorial ANOVA, Duncan's test).

 
Urinary Excretion of 8-Isoprostane

There were no significant differences in urinary excretion of 8-isoprostane among the three groups although the levels of urinary 8-isoprostane tended to be lower in hGRK4{gamma} A142V transgenic mice relative to hGRK4{gamma} wild-type and nontransgenic littermates (Fig. 5A).


Figure 5
View larger version (17K):
[in this window]
[in a new window]

  		Fig. 5. Urinary levels of 8-isoprostane and protein. A: urinary excretion of 8-isoprostane (an index of oxidative stress) in hGRK4{gamma} A142V and hGRK4{gamma} wild-type transgenic and nontransgenic mice. 8-Isoprostane was determined by enzyme immunoassay and normalized by urinary excretion of creatinine (n = 7 in NT and hGRK4{gamma} A142V; n = 6 in hGRK4{gamma} wild type). B: urinary protein was determined by Bio-Rad protein assay and normalized by urinary excretion of creatinine (n = 7 in NT and hGRK4{gamma} A142V; n = 6 in hGRK4{gamma} wild type; 3/group of D5R mice).

 
Urinary Proteins

There were no differences in urinary protein concentrations among hGRK4{gamma} A142V and hGRK4{gamma} wild-type transgenic mice and nontransgenic littermates (Fig. 5B). However, the urinary protein concentration in D5–/– was higher than in D5+/+, hGRK4{gamma} A142V and hGRK4{gamma} wild-type transgenic mice and their nontransgenic littermates (P < 0.05, ANOVA, Duncan's test) (Fig. 5B).

Effect of Tempol

Bolus intravenous injection of a 10 mg/kg dose of Tempol had no significant effect on mean arterial blood pressure (MAP) in nontransgenic, hGRK4{gamma} wild-type or hGRK4{gamma} A142V transgenic mice (Fig. 6A). There was no significant percent change from control in any of the three groups during the period of study (Fig. 6B). One hGRK4{gamma} A142V transgenic mouse had a very high blood pressure and was omitted from the statistical analysis after performing the Grubb's Outlier test. Even in this mouse, Tempol had no hypotensive effect. In contrast, Tempol significantly decreased MAP in D5–/– mice. The maximal effect (11.3% decrease in MAP) was reached 5 min after injection. The effect lasted until the end of the experiment. The hypotensive effect of Tempol was not observed in D5+/+ mice, their littermate controls (Fig. 6C). The baseline mean arterial pressures of D5–/– mice used in the Tempol study were higher than those observed in D5+/+ littermates (D5–/–, 110 ± 1.8 mmHg, vs. D5+/+, 86 ± 1.2 mmHg. P < 0.001, t-test), in agreement with our previous reports (22, 62).


Figure 6
View larger version (14K):
[in this window]
[in a new window]

  		Fig. 6. Effect of Tempol (10 mg/kg; 58 µmol/kg) on mean arterial blood pressure (MAP) in anesthetized mice. A: MAP after Tempol administration in NT littermates (n = 5), hGRK4{gamma} wild-type (n = 3), or hGRK4{gamma} A142V transgenic mice (n = 4). Tempol was administered at time 0. B: percent change of MAP after Tempol administration in NT littermates (n = 5), hGRK4{gamma} wild-type (n = 3), and hGRK4{gamma} A142V transgenic mice (n = 4). C: percent change of MAP after Tempol administration (time 0) in D5R-deficient mice (D5–/–: n = 7) and their littermate controls (D5+/+: n = 7) (*P < 0.05 vs. D5+/+, t-test). [The baseline MAPs were higher in D5–/– (110 ± 1.8 mmHg) than in D5+/+ mice (86 ± 1.2 mmHg) (P < 0.001, t-test)].

 

   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
The GRK4 gene fulfills the criteria needed to qualify gene or genes as causal of complex disease, suggested by Glazier et al. (18). Thus the GRK4 gene locus 4p16.3 (3) is linked to hypertension (2, 10). Single-nucleotide polymorphisms of GRK4, by themselves, or with polymorphisms of angiotensin-converting enzyme, are associated with essential hypertension in several populations (Africans, Caucasians, Chinese, and Japanese) (8, 20, 47, 50, 61, 66). Of all the gene variations shown to be associated with essential hypertension, only the hGRK4{gamma} A142V gene variant has been shown to produce hypertension in transgenic mice fed a normal NaCl diet (14).

There are four isoforms of human GRK4 ({alpha}, beta, {gamma}, and {delta}) (40). While there are also at least five GRK4 isoforms in rodents (A, B, C, D, and E) (48, 55), only the GRK4{alpha} in humans and GRK4A in rats are homologous. There is no equivalent of hGRK4{gamma} in rodents. Expression of hGRK4{gamma} in Chinese hamster ovary or hGRK4{alpha} in human embryonic kidney cells constitutively impairs the ability of D1 receptors to increase cAMP production (14, 44). The GRK4 gene is expressed in renal proximal tubule and thick ascending limb of Henle in rodent and human kidney (14, 48) and renal arteries in rats (48). Inhibition of GRK4 expression with antisense oligonucleotides normalizes D1R malfunction in renal proximal tubule cells from hypertensive humans (14, 15). Renal cortical GRK4 expression is increased in spontaneously hypertensive rats (SHRs) relative to their normotensive Wistar-Kyoto (WKY) controls, and chronic inhibition of GRK4 expression in the renal cortex lowers blood pressure in SHRs but not in WKY rats (48).

We have reported that hGRK4{gamma} A142V transgenic founders had elevated blood pressure relative to hGRK4{gamma} wild-type transgenic founders under anesthesia (14) and that hGRK4{gamma} A142V transgenic offspring had elevated blood pressure relative to hGRK4{gamma} wild-type transgenic offspring in conscious unanesthetized states (57). Interestingly, in mice, GRK4 is located on chromosome 5, near the D5MIT75 marker (39); the mouse GRK4 has V142 as its wild-type allele, but there is only one form of GRK4 in mice (39), which is equivalent to hGRK4{alpha}. Since the mouse GRK4 sequence is only 77% identical to human GKR4 (39), the A142V in different GRK4 proteins of humans or mice may play different roles in the protein structure and function. In this report, we show that the inheritance of hGRK4{gamma} A142V (697 C to T) in transgenic mice was stable. The blood pressure of hGRK4{gamma} A142V mice was higher than that found in hGRK4{gamma} wild-type transgenic or nontransgenic littermates, whereas there was no difference between hGRK4{gamma} wild-type transgenic and nontransgenic littermates. The elevated blood pressure was noted as early as 6.5 wk of age and as old as 2 yr and unrelated to sex. The normal blood pressure of nontransgenic littermates and the hGRK4{gamma} wild-type transgenic mice eliminated the possibility of genetic background differences (besides hGRK4{gamma} A142V) as a cause for the blood pressure difference. The large number of transgenic founders, a total of 22 hGRK4{gamma} wild-type and 12 hGRK4{gamma} A142V founders, suggested that the blood pressure difference between the hGRK4{gamma} wild-type transgenic and hGRK4{gamma} A142V transgenic mice was unlikely to be due to the transgene integration sites, flanking genes, or copy number (56).

As mentioned above, oxidative stress in the kidney appears to play a key role in the development and maintenance of some forms of hypertension, and increased ROS or ROS-dependent products in renal tissue, mediated by increased production or decreased scavenging or metabolism, have been demonstrated in kidneys of experimentally induced or genetically hypertensive animals (5, 13, 25, 28, 38, 45, 46, 49, 52–54, 59, 60, 62, 65). We have used several different approaches to assess the contribution of increased ROS in the increased blood pressure of hGRK4{gamma} A142V transgenic mice. We first determined the expression of Nox2 and Nox4, the two main Nox isoforms expressed in the kidney, since one of the main mechanisms underlying an increase in ROS production is a chronic increase in the expression and abundance of these components subunits (60, 62). Both isoforms were present in kidneys of hGRK4{gamma} A142V, hGRK4{gamma} wild-type transgenic and nontransgenic mice, and the levels of expression were similar in all three groups. The slight and nonsignificant tendency to lower levels of Nox2 expression in hGRK4{gamma} A142V relative to nontransgenic littermates and hGRK4{gamma} wild-type mice would suggest, if anything, decreased rather than increased ROS production. This finding is in contrast with that reported in D5–/– mice, which are hypertensive and have increased renal expression of both Nox isoforms (62).

A measure of oxidative stress in vivo is the quantification of 8-isoprostanes, the prostaglandin-like compounds that are the result of the free-radical catalyzed peroxidation of arachidonic acid. The renal excretion of 8-isoprostane is increased in several experimental models of hypertension (60), including mice, and has been used as a parameter of oxidative stress (35). In agreement with the studies on NADPH oxidase expression in the kidney, the excretion of 8-isoprostane in hGRK4{gamma} A142V mice was not statistically different from that in the other two groups of mice, although it tended to lower levels. D5–/– mice, which are hypertensive because of increased ROS production, had increased protein excretion and cardiac hypertrophy (22). However, hGRK4{gamma} A142V transgenic mice that were also hypertensive had normal urinary protein and heart weight. Proteinuria was not apparent, and heart weights were not increased in the hypertension induced by ANG II (58); heart weight was also not increased in hypertensive p47phox –/– mice (19). Although the hypertension in the latter mice was not associated with oxidative stress, the hypertension in glutathione-depleted mice was associated with oxidative stress but not with proteinuria or cardiac hypertrophy (11). Thus oxidative stress may not always be associated with proteinuria or cardiac hypertrophy (7, 11, 24).

To determine directly a role of increased oxidative stress in the high blood pressure of hGRK4{gamma} A142V transgenic mice, we determined the effects on blood pressure of acute administration of the superoxide dismutase mimetic Tempol. Acute and chronic administration of Tempol has been shown to be effective in decreasing blood pressure in animals with oxidative stress-dependent hypertension (49, 60). Tempol did not lower blood pressure in hGRK4{gamma} A142V mice; however, the same dose was effective in decreasing both systolic and diastolic blood pressure in D5–/– mice. We have already reported that D5–/– mice have increased expression of Nox2 and Nox4 and increased NADPH oxidase activity in kidneys and brain and increased plasma thiobarbituric acid-reactive substances, a marker of oxidative stress (62). We have also shown that blood pressure in these animals was normalized after treatment with apocynin, an NADPH oxidase inhibitor (62). Taken together, the biochemical and physiological data support the notion that increased ROS production is not the cause of the high blood pressure in the hGRK4{gamma} A142V mice.

The level of ROS depends not only on their generation but also on their metabolism by antioxidant enzymes. Heme oxygenase, of which there are at least two isoforms (HO-1 and HO-2), is an important antioxidant enzyme that degrades heme, a pro-oxidant, and generates biliverdin, which has antioxidant activity against O2– (4, 12, 25, 41, 46, 51, 60). The acute and chronic administration of inducers of HO-1 normalizes blood pressure in SHRs (25, 41, 46). Renal HO-1 (but not HO-2) protein was increased in hGRK4{gamma} A142V, relative to hGRK4{gamma} wild-type mice, supporting the notion that ROS production is not increased and may be decreased in hGRK4{gamma} A142V transgenic mice. In the kidney, HO-1 is found in proximal and distal tubules (12, 41), and HO-2 is present in the medullary thick ascending limb and preglomerular arterioles (12, 41). As a heat shock protein, HO-1 has multiple protective functions, including protecting thick ascending limb cells from ANG II-evoked oxidative injury (41). Because hGRK4{gamma} A142V transgenic mice have decreased D1-like receptor function (14) but increased AT1 receptor function (57), an increase in ROS production may have been expected. We suggest that this did not occur because of the increase in HO-1 expression. Indeed, Wesseling et al. (58) have suggested that the resistance to oxidative stress following ANG II infusion in mice is due to increased HO-1 expression. The ability of medullary HO-1 to induce a natriuresis (29) could have alleviated the impaired natriuretic effect of D1R in hGRK4{gamma} A142V transgenic mice and prevented an even higher blood pressure (29). HO-1 expression and activity were decreased in D5–/– mice, and D5R increased HO-1 activity and expression (30). D5R is probably not regulated by GRK4 because D5R action is not impaired in SHRs, which have increased GRK4 expression and activity (48, 64). It is possible that other G protein-coupled receptors, including D5R (30) and D2R (4), may have prevented any increase in ROS production in hGRK4{gamma} A142V transgenic mice.

There are several instances in which hypertension is not caused by increased ROS production. Norepinephrine-induced hypertension in rats was not associated with O2– production (43). The hypertension in mice caused by a chronic infusion of ANG II or inhibition of nitric oxide synthesis with nitro-L-arginine was not associated with increased urinary thiobarbituric acid reactive substances, an index of oxidative stress (11, 58). Grote et al. (19) reported that p47phox–/– mice had increased blood pressure, plasma renin, and renal angiotensin-converting enzyme activities but not oxygen radical formation (19). The hypertension was ameliorated by AT1 receptor blockade but not by Tempol (19), findings similar to the hGRK4{gamma} A142V transgenic mice (current report and Ref. 57). There is, however, a difference in the blood pressure phenotype in p47phox–/– mice and hGRK4{gamma} A142V transgenic mice; blood pressure elevation was no longer apparent after 60 wk of age in p47phox–/– mice, whereas in hGRK4{gamma} A142V transgenic mice, the blood pressure continued to be elevated at 86 to 104 wk of age.

In summary, we report that overexpression of hGRK4{gamma} A142V in mice increases blood pressure. To date hGRK4{gamma} is the only gene the locus of which is linked to and the variants of which are associated with human essential hypertension and the expression of which in mice produces hypertension. We also report that hypertension in hGRK4{gamma} A142V mice is not dependent on increased ROS production, possibly because of compensatory mechanisms that increased antioxidant activity, e.g., HO-1. The cause of the increase in HO-1 activity is not readily apparent but could be due to increased expression or activity of other G protein-coupled receptors. Although D1R function is decreased, D5R and D2R function may not have been affected in these animals and may have been able to effectively downregulate ROS production.


   GRANTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
This work was supported by National Institutes of Health Grants PG-00127–2004.R1, HL-23081, DK-39308, HL-68686, DK-52612, and HL-074940.


   ACKNOWLEDGMENTS
 
The authors express thanks to Dr. Jean E. Robillard for help in generating the transgenic mice.


   FOOTNOTES
 

Address for reprint requests and other correspondence: Z. Wang, Georgetown Univ. School of Medicine, Bldg. D/Room 366, 4000 Reservoir Road, NW, Washington, DC 20057 (e-mail: wangz10{at}georgetown.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This paper was presented at the 9th Cardiovascular-Kidney Interactions in Health and Disease Meeting at Amelia Island Plantation, Florida, on May 26–29, 2006. Back


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Albrecht FE, Drago J, Felder RA, Printz MP, Eisner GM, Robillard JE, Sibley DR, Westphal HJ, Jose PA. Role of the D1A dopamine receptor in the pathogenesis of genetic hypertension. J Clin Invest 97: 2283–2288, 1996.[ISI][Medline]
  2. Allayee H, de Bruin TW, Michelle Dominguez K, Cheng LS, Ipp E, Cantor RM, Krass KL, Keulen ET, Aouizerat BE, Lusis AJ, Rotter JI. Genome scan for blood pressure in Dutch dyslipidemic families reveals linkage to a locus on chromosome 4p. Hypertension 38: 773–778, 2001.[Abstract/Free Full Text]
  3. Ambrose C, James M, Barnes G, Lin C, Bates G, Altherr M, Duyao M, Groot N, Church D, Wasmuth JJ, Lehrach H, Housman D, Buckler A, Gusella JF, MacDonald ME. A novel G protein-coupled receptor kinase gene cloned from 4p163. Hum Mol Genet 1: 697–703, 1992.[Abstract/Free Full Text]
  4. Armando I, Wang X, Villar VA, Jones JE, Asico LD, Escano C, Jose PA. Reactive oxygen species-dependent hypertension in dopamine D2 receptor-deficient mice. Hypertension 49: 672–678, 2007.[Abstract/Free Full Text]
  5. Banday AA, Marwaha A, Tallam LS, Lokhandwala MF. Tempol reduces oxidative stress, improves insulin sensitivity, decreases renal dopamine D1 receptor hyperphosphorylation, and restores D1 receptor-G-protein coupling and function in obese Zucker rats. Diabetes 54: 2219–2226, 2005.[Abstract/Free Full Text]
  6. Becker M, Umrani D, Lokhandwala MF, Hussain T. Increased renal angiotensin II AT1 receptor function in obese Zucker rat. Clin Exp Hypertens 25: 35–47, 2003.[CrossRef][ISI][Medline]
  7. Bendall JK, Cave AC, Heymes C, Gall N, Shah AM. Pivotal role of a gp91phox-containing NADPH oxidase in angiotensin II-induced cardiac hypertrophy in mice. Circulation 105: 293–296, 2002.[Abstract/Free Full Text]
  8. Bengra C, Mifflin TE, Khripin Y, Manunta P, Williams SM, Jose PA, Felder RA. Genotyping of essential hypertension single-nucleotide polymorphisms by a homogeneous PCR method with universal energy transfer primers. Clin Chem 48: 2131–2140, 2002.[Abstract/Free Full Text]
  9. Carman CV, Benovic JL. G-protein-coupled receptors: turn-ons and turn-offs. Curr Opin Neurobiol 8: 335–344, 1998.[CrossRef][ISI][Medline]
  10. Casari G, Barlassina C, Cusi D, Zagato L, Muirhead R, Righetti M, Nembri P, Amar K, Gatti M, Macciardi F, Binelli G, Bianchi G. Association of the alpha-adducin locus with essential hypertension. Hypertension 25: 320–326, 1995.[Abstract/Free Full Text]
  11. Chon H, Bluyssen HA, Holstege FC, Koomans HA, Joles JA, Braam B. Gene expression of energy and protein metabolism in hearts of hypertensive nitric oxide- or GSH-depleted mice. Eur J Pharmacol 513: 21–33, 2005.[CrossRef][ISI][Medline]
  12. Da Silva JL, Zand BA, Yang LM, Sabaawy HE, Lianos E, Abraham NG. Heme oxygenase isoform-specific expression and distribution in the rat kidney. Kidney Int 59: 1448–1457, 2001.[CrossRef][ISI][Medline]
  13. Dikalova A, Clempus R, Lassegue B, Cheng G, McCoy J, Dikalov S, San Martin A, Lyle A, Weber DS, Weiss D, Taylor WR, Schmidt HH, Owens GK, Lambeth JD, Griendling KK. Nox1 overexpression potentiates angiotensin II-induced hypertension and vascular smooth muscle hypertrophy in transgenic mice. Circulation 112: 2668–2676, 2005.[CrossRef][ISI][Medline]
  14. Felder RA, Sanada H, Xu J, Yu PY, Wang Z, Watanabe H, Asico LD, Wang W, Zheng S, Yamaguchi I, Williams SM, Gainer J, Brown NJ, Hazen-Martin D, Wong LJ, Robillard JE, Carey RM, Eisner GM, Jose PA. G protein-coupled receptor kinase 4 gene variants in human essential hypertension. Proc Natl Acad Sci USA 99: 3872–3877, 2002.[Abstract/Free Full Text]
  15. Felder RA, Jose PA. Mechanisms of disease: the role of GRK4 in the etiology of essential hypertension and salt sensitivity. Nat Clin Pract Nephrol 2: 637–650, 2006.[CrossRef][ISI][Medline]
  16. Fellner SK, Arendshorst WJ. Angiotensin II, reactive oxygen species, and Ca2+ signaling in afferent arterioles. Am J Physiol Renal Physiol 289: F1012–F1019, 2005.[Abstract/Free Full Text]
  17. Gainetdinov RR, Premont RT, Bohn LM, Lefkowitz RJ, Caron MG. Desensitization of G protein-coupled receptors and neuronal functions. Annu Rev Neurosci 27: 107–144, 2004.[CrossRef][ISI][Medline]
  18. Glazier AM, Nadeau JH, Aitman TJ. Finding genes that underlie complex traits. Science 298: 2345–2349, 2002.[Abstract/Free Full Text]
  19. Grote K, Ortmann M, Salguero G, Doerries C, Landmesser U, Luchtefeld M, Brandes RP, Gwinner W, Tschernig T, Brabant EG, Klos A, Schaefer A, Drexler H, Schieffer B. Critical role for p47phox in renin-angiotensin system activation and blood pressure regulation. Cardiovasc Res 71: 596–605, 2006.[CrossRef][ISI][Medline]
  20. Gu D, Su S, Ge D, Chen S, Huang J, Li B, Chen R, Qiang B. Association study with 33 single-nucleotide polymorphisms in 11 candidate genes for hypertension in Chinese. Hypertension 47: 1147–1154, 2006.[Abstract/Free Full Text]
  21. Hall JE. The kidney, hypertension, obesity. Hypertension 41: 625–633, 2003.[Abstract/Free Full Text]
  22. Hollon TR, Bek MJ, Lachowicz JE, Ariano MA, Mezey E, Ramachandran R, Wersinger SR, Soares-da-Silva P, Liu ZF, Grinberg A, Drago J, Young WS 3rd, Westphal H, Jose PA, Sibley DR. Mice lacking D5 dopamine receptors have increased sympathetic tone and are hypertensive. J Neurosci 22: 10801–10810, 2002.[Abstract/Free Full Text]
  23. Ichihara A, Kobori H, Nishiyama A, Navar LG. Renal renin-angiotensin system. Contrib Nephrol 143: 117–130, 2004.[ISI][Medline]
  24. Jin L, Beswick RA, Yamamoto T, Palmer T, Taylor TA, Pollock JS, Pollock DM, Brands MW, Webb RC. Increased reactive oxygen species contributes to kidney injury in mineralocorticoid hypertensive rats. J Physiol Pharmacol 57: 343–357, 2006.[ISI][Medline]
  25. Johnson RA, Lavesa M, DeSeyn K, Scholer MJ, Nasjletti A. Heme oxygenase substrates acutely lower blood pressure in hypertensive rats. Am J Physiol Heart Circ Physiol 271: H1132–H1138, 1996.[Abstract/Free Full Text]
  26. Jose PA, Eisner GM, Felder RA. Regulation of blood pressure by dopamine receptors. Nephron Physiol 95: p19–p27, 2003.[CrossRef][Medline]
  27. Kim OJ, Gardner BR, Williams DB, Marinec PS, Cabrera DM, Peters JD, Mak CC, Kim KM, Sibley DR. The role of phosphorylation in D1 dopamine receptor desensitization: evidence for a novel mechanism of arrestin association. J Biol Chem 279: 7999–8010, 2004.[Abstract/Free Full Text]
  28. Laursen JB, Rajagopalan S, Galis Z, Tarpey M, Freeman BA, Harrison DG. Role of superoxide in angiotensin II-induced but not catecholamine-induced hypertension. Circulation 95: 588–593, 1997.[ISI][Medline]
  29. Li N, Yi F, dos Santos EA, Donley DK, Li PL. Role of renal medullary heme oxygenase in the regulation of pressure natriuresis and arterial blood pressure. Hypertension 49: 148–154, 2007.[Abstract/Free Full Text]
  30. Lu Q, Asico LD, Jones JE, Bai R, Li H, Maines MD, Jose PA. Impaired heme oxygenase activity, increased reactive oxygen species, and high blood pressure in D5 dopamine receptor deficient mice (Abstract). J Am Soc Nephrol 16: 163A, 2005.[CrossRef]
  31. Maines MD, Trakshel GM, Kutty RK. Characterization of two constitutive forms of rat liver microsomal heme oxygenase. Only one molecular species of the enzyme is inducible. J Biol Chem 261: 411–419, 1986.[Abstract/Free Full Text]
  32. Meneton P, Jeunemaitre X, de Wardener HE, MacGregor GA. Links between dietary salt intake, renal salt handling, blood pressure, and cardiovascular diseases. Physiol Rev 85: 679–715, 2005.[Abstract/Free Full Text]
  33. Miller FJ Jr, Gutterman DD, Rios CD, Heistad DD, Davidson BL. Superoxide production in vascular smooth muscle contributes to oxidative stress and impaired relaxation in atherosclerosis. Circ Res 82: 1298–1305, 1998.[Abstract/Free Full Text]
  34. Moore KJ, Nagle DL. Complex trait analysis in the mouse: the strengths, the limitations and the promise yet to come. Annu Rev Genet 34: 653–686, 2000.[CrossRef][ISI][Medline]
  35. Morrow JD. Quantification of isoprostanes as indices of oxidant stress and the risk of atherosclerosis in humans. Arterioscler Thromb Vasc Biol 25: 279–286, 2005.[Abstract/Free Full Text]
  36. Noh JS, Gwag BJ. Attenuation of oxidative neuronal necrosis by a dopamine D1 agonist in mouse cortical cell cultures. Exp Neurol 146: 604–608, 1997.[CrossRef][ISI][Medline]
  37. O'Connell DP, Ragsdale NV, Boyd DG, Felder RA, Carey RM. Differential human renal tubular responses to dopamine type 1 receptor stimulation are determined by blood pressure status. Hypertension 29: 115–122, 1997.[Abstract/Free Full Text]
  38. Park JB, Touyz RM, Chen X, Schiffrin EL. Chronic treatment with a superoxide dismutase mimetic prevents vascular remodeling and progression of hypertension in salt-loaded stroke-prone spontaneously hypertensive rats. Am J Hypertens 15: 78–84, 2002.[CrossRef][ISI][Medline]
  39. Premont RT, Macrae AD, Aparicio SA, Kendall HE, Welch JE, Lefkowitz RJ. The GRK4 subfamily of G protein-coupled receptor kinases. Alternative splicing, gene organization, and sequence conservation. J Biol Chem 274: 29381–29389, 1999.[Abstract/Free Full Text]
  40. Premont RT, Macrae AD, Stoffel RH, Chung N, Pitcher JA, Ambrose C, Inglese J, MacDonald ME, Lefkowitz RJ. Characterization of the G protein-coupled receptor kinase GRK4. Identification of four splice variants. J Biol Chem 271: 6403–6410, 1996.[Abstract/Free Full Text]
  41. Quan S, Yang L, Shnouda S, Schwartzman ML, Nasjletti A, Goodman AI, Abraham NG. Expression of human heme oxygenase-1 in the thick ascending limb attenuates angiotensin II-mediated increase in oxidative injury. Kidney Int 65: 1628–1639, 2004.[CrossRef][ISI][Medline]
  42. Quinn MT, Gauss KA. Structure and regulation of the neutrophil respiratory burst oxidase: comparison with nonphagocyte oxidases. J Leukoc Biol 76: 760–781, 2004.[Abstract/Free Full Text]
  43. Rajagopalan S, Kurz S, Munzel T, Tarpey M, Freeman BA, Griendling KK, Harrison DG. Angiotensin II-mediated hypertension in the rat increases vascular superoxide production via membrane NADH/NADPH oxidase activation. Contribution to alterations of vasomotor tone. J Clin Invest 97: 1916–1923, 1996.[ISI][Medline]
  44. Rankin ML, Marinec PS, Cabrera DM, Wang Z, Jose PA, Sibley DR. The D1 dopamine receptor is constitutively phosphorylated by G protein-coupled receptor kinase 4. Mol Pharmacol 69: 759–769, 2006.[Abstract/Free Full Text]
  45. Rodriguez-Iturbe B, Zhan CD, Quiroz Y, Sindhu RK, Vaziri ND. Antioxidant-rich diet relieves hypertension and reduces renal immune infiltration in spontaneously hypertensive rats. Hypertension 41: 341–346, 2003.[Abstract/Free Full Text]
  46. Sabaawy HE, Zhang F, Nguyen X, ElHosseiny A, Nasjletti A, Schwartzman M, Dennery P, Kappas A, Abraham NG. Human heme oxygenase-1 gene transfer lowers blood pressure and promotes growth in spontaneously hypertensive rats. Hypertension 38: 210–215, 2001.[Abstract/Free Full Text]
  47. Sanada H, Yatabe J, Midorikawa S, Hashimoto S, Watanabe T, Moore JH, Ritchie MD, Williams SM, Pezzullo JC, Sasaki M, Eisner GM, Jose PA, Felder RA. Single-nucleotide polymorphisms for diagnosis of salt-sensitive hypertension. Clin Chem 52: 352–360, 2006.[Abstract/Free Full Text]
  48. Sanada H, Yatabe J, Midorikawa S, Katoh T, Hashimoto S, Watanabe T, Xu J, Luo Y, Wang X, Zeng C, Armando I, Felder RA, Jose PA. Amelioration of genetic hypertension by suppression of renal G protein-coupled receptor kinase type 4 expression. Hypertension 47: 1131–1139, 2006.[Abstract/Free Full Text]
  49. Schnackenberg CG, Welch WJ, Wilcox CS. Normalization of blood pressure and renal vascular resistance in SHR with a membrane-permeable superoxide dismutase mimetic: role of nitric oxide. Hypertension 32: 59–64, 1998.[Abstract/Free Full Text]
  50. Speirs HJ, Katyk K, Kumar NN, Benjafield AV, Wang WY, Morris BJ. Association of G-protein-coupled receptor kinase 4 haplotypes, but not HSD3B1 or PTP1B polymorphisms, with essential hypertension. J Hypertens 22: 931–936, 2004.[CrossRef][ISI][Medline]
  51. Taille C, El-Benna J, Lanone S, Dang MC, Ogier-Denis E, Aubier M, Boczkowski J. Induction of heme oxygenase-1 inhibits NAD(P)H oxidase activity by down-regulating cytochrome b558 expression via the reduction of heme availability. J Biol Chem 279: 28681–28688, 2004.[Abstract/Free Full Text]
  52. Thakali KM, Lau Y, Fink GD, Galligan JJ, Chen AF, Watts SW. Mechanisms of hypertension induced by nitric oxide (NO) deficiency: focus on venous function. J Cardiovasc Pharmacol 47: 742–750, 2006.[CrossRef][ISI][Medline]
  53. Touyz RM, Schiffrin EL. Signal transduction mechanisms mediating the physiological and pathophysiological actions of angiotensin II in vascular smooth muscle cells. Pharmacol Rev 52: 639–672, 2000.[Abstract/Free Full Text]
  54. Virdis A, Neves MF, Amiri F, Touyz RM, Schiffrin EL. Role of NAD(P)H oxidase on vascular alterations in angiotensin II-infused mice. J Hypertens 22: 535–542, 2004.[CrossRef][ISI][Medline]
  55. Virlon B, Firsov D, Cheval L, Reiter E, Troispoux C, Guillou F, Elalouf JM. Rat G protein-coupled receptor kinase GRK4: identification, functional expression, and differential tissue distribution of two splice variants. Endocrinology 139: 2784–2795, 1998.[Abstract/Free Full Text]
  56. Wang Z, Asico LD, Felder RA, Robillard JE, Jose PA. Human GRK4{gamma} A142V variant produces hypertension in transgenic mice (Abstract). FASEB J 18: A353, 2004.
  57. Wang Z, Zeng C, Asico LD, Felder RA, Jose PA. The role of GRK4{gamma}A142V in the dysfunction of renal AT1 and D1 dopamine receptor in genetic hypertension (Abstract). Circulation 112: II187, 2005.
  58. Wesseling S, Ishola DA Jr, Joles JA, Bluyssen HA, Koomans HA, Braam B. Resistance to oxidative stress by chronic infusion of angiotensin II in mouse kidney is not mediated by the AT2 receptor. Am J Physiol Renal Physiol 288: F1191–F1200, 2005.[Abstract/Free Full Text]
  59. White BH, Sidhu A. Increased oxidative stress in renal proximal tubules of the spontaneously hypertensive rat: a mechanism for defective dopamine D1A receptor/G-protein coupling. J Hypertens 16: 1659–1665, 1998.[CrossRef][ISI][Medline]
  60. Wilcox CS. Oxidative stress and nitric oxide deficiency in the kidney: a critical link to hypertension? Am J Physiol Regul Integr Comp Physiol 289: R913–R935, 2005.[Abstract/Free Full Text]
  61. Williams SM, Ritchie MD, Phillips JA 3rd, Dawson E, Prince M, Dzhura E, Willis A, Semenya A, Summar M, White BC, Addy JH, Kpodonu J, Wong LJ, Felder RA, Jose PA, Moore JH. Multilocus analysis of hypertension: a hierarchical approach. Hum Hered 57: 28–38, 2004.[CrossRef][ISI][Medline]
  62. Yang Z, Asico LD, Yu P, Wang Z, Jones JE, Escano CS, Wang X, Quinn MT, Sibley DR, Romero GG, Felder RA, Jose PA. D5 dopamine receptor regulation of reactive oxygen species production, NADPH oxidase, and blood pressure. Am J Physiol Regul Integr Comp Physiol 290: R96–R104, 2006.[Abstract/Free Full Text]
  63. Yasunari K, Kohno M, Kano H, Minami M, Yoshikawa J. Dopamine as a novel antioxidative agent for rat vascular smooth muscle cells through dopamine D1-like receptors. Circulation 101: 2302–2308, 2000.[ISI][Medline]
  64. Zeng C, Yang Z, Wang Z, Jones J, Wang X, Altea J, Mangrum AJ, Hopfer U, Sibley DR, Eisner GM, Felder RA, Jose PA. Interaction of angiotensin II type 1 and D5 dopamine receptors in renal proximal tubule cells. Hypertension 45: 804–810, 2005.[Abstract/Free Full Text]
  65. Zhou MS, Hernandez Schulman I, Pagano PJ, Jaimes EA, Raij L. Reduced NAD(P)H oxidase in low renin hypertension: link among angiotensin II, atherogenesis, and blood pressure. Hypertension 47: 81–86, 2006.[Abstract/Free Full Text]
  66. Zhu H, Lu Y, Wang X, Treiber FA, Harshfield GA, Snieder H, Dong Y. The G protein-coupled receptor kinase 4 gene affects blood pressure in young normotensive twins. Am J Hypertens 19: 61–66, 2006.[CrossRef][ISI][Medline]
  67. Zimmerman MC, Sharma RV, Davisson RL. Superoxide mediates angiotensin II-induced influx of extracellular calcium in neural cells. Hypertension 45: 717–723, 2005.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
292/5/H2083    most recent
00944.2006v1
Right arrow