| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
1Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, Indiana; and 2Institute of Molecular and Experimental Therapeutics, East China Normal University, Shanghai, China
Submitted 2 August 2006 ; accepted in final form 17 February 2007
 |
ABSTRACT |
|---|
 TOP ABSTRACT MATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
congestive heart failure; endothelial nitric oxide synthase; cGMP-dependent protein kinase-I; vasodilation-stimulated phosphoprotein; coronary blood flow; cardiac recovery
eNOS is mainly located in the vascular endothelium, and its expression is under translational control by mRNA levels of eNOS. However, it was not clear whether reduced expression of eNOS in CHF is associated with a decrease in its messenger level and whether this is reversible during cardiac recovery (CR). Moreover, eNOS has been traditionally characterized as a calcium/calmodulin-dependent constitutive enzyme, by which the activity of eNOS is predominantly controlled (10). Recent studies showed that the activity of eNOS could also be regulated through the Akt-dependent phosphorylation of Ser1179 on eNOS (P-eNOS) (7, 11). Furthermore, it is not clear whether the phosphorylation of eNOS functions as a compensatory mechanism to promote NO production when eNOS expression is lower in CHF and CR. In addition, the cGMP/cGMP-dependent protein kinase (cGK)-I pathway is downstream of NO signaling in vascular smooth muscle and plays a key role in the regulation of vascular tone (18, 33). In response to NO, soluble guanylyl cyclase (sGC) produces the second messenger cGMP, leading to the activation of cGK-I, which mediates vascular relaxation via phosphorylation of several proteins regulating intracellular Ca2+ mobilization and cytoskeleton organization (18). However, it is also unclear whether an increase in cGMP/cGK-I signaling could lead to a compensatory enhancement of the vascular relaxation response to NO in CHF and CR when NO bioavailability is reduced.
To address these questions, we conducted this longitudinal study using a well-characterized canine model of pacing-induced CHF, in which CHF was induced by 3- to 4-wk rapid ventricular pacing and CR was created by termination of cardiac pacing (27, 30). In this way, we performed in vivo assessments of coronary vascular response to the selective endothelium-dependent vasodilators bradykinin (BK) and acetylcholine (ACh) and to an endothelium-independent vasodilator, nitroglycerin (NTG), in the same group of dogs over three stages: control, CHF, and CR. Furthermore, using myocardial biopsy specimens collected from three groups of dogs with normal, failing, or recovered hearts, respectively, we conducted molecular analysis to provide direct evidence of alterations of eNOS in translational and posttranslational regulation, as well as the adaptive changes of cGMP/cGK-I signaling. The combination of in vivo and molecular data demonstrates the alterations of NO/cGMP/cGK-I involved in both coronary vascular endothelial dysfunction and NO deficiency in CHF and the restoration of endothelium-dependent regulation of coronary blood flow (CBF) during CR.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Male adult mongrel dogs (25–30 kg) were anesthetized with isoflurane in oxygen and ventilated with a respirator after induction with acepromazine (0.03 mg/kg im) and propofol (5.5 mg/kg iv). A left thoracotomy was performed through the fifth intercostal space under sterile conditions. Tygon catheters were implanted in the descending thoracic aorta and left atrial appendage for measuring pressures. A solid-state miniature pressure transducer (model P6, Konigsberg, Pasadena, CA) was placed into the left ventricular (LV) chamber via an apical stab incision for recording LV pressure (LVP). A coronary catheter was implanted in the base of the left circumflex artery for intracoronary infusions of BK and ACh, and a transonic transit time flow probe (Transonic Systems, Ithaca, NY) was placed around the left circumflex artery distal to the coronary catheter for measurement of CBF. A pair of piezoelectric ultrasonic crystals was implanted on opposing anterior and posterior endocardial surfaces of the LV for measuring LV internal diameter (LVID). The position of the crystals was confirmed at autopsy. A screw-in pacing lead was attached to the right ventricular free wall, and a pair of stainless steel pacing wires was placed on the left atrium. All catheters and lead wires from instruments were externalized, the thoracotomy was closed in layers, and the intrapleural space was evacuated. An antibiotic (cephalexin, 500 mg) was administrated postoperatively for 7 days after surgery. The indwelling catheters were flushed daily with heparinized saline to maintain patency. The study was initiated 2–3 wk after surgery when the dogs had recovered from surgery. The study was approved by the Lilly Institutional Animal Care and Use Committee, and all animals were maintained in accordance with the guidelines in The Guide for Care and Use of Laboratory Animals [DHHS Pub. No. (NIH) 83-23, revised 1985].
Experimental Recordings and Analysis
All hemodynamic signals were collected online and analyzed on a beat-to-beat basis with a digital data acquisition system (Ponemah, Gould Instrument System). The sampling rate was 250 Hz for arterial pressure (AP) and CBF and 500 Hz for LVP and LVID signals.
AP and left atrial pressure (LAP) were measured with the fluid-filled aortic and left atrial catheters connected to Statham strain gauge transducers (P23ID, Statham, Newark, NJ), which were calibrated with a mercury manometer. Mean arterial pressure (MAP) and mean LAP signals were recorded. LVP was measured with a solid-state miniaturized pressure gauge and was cross-calibrated in vivo against measurements of systolic AP and LAP. LV dP/dt was the first derivative of LVP, and LV dP/dtmax, the maximum positive value of LV dP/dt, was calculated online by the data acquisition system. LVID was measured with ultrasonic transit time dimension gauges (Crystal Biotech, Houston, TX). LV end-diastolic dimension (LVEDD) and LV end-systolic dimension (LVESD) were measured, and LV fractional shortening (LVFS, %) was calculated as 100 x (LVEDD – LVESD)/LVEDD. LV pressure-dimension loops were constructed from LVP and LVID data obtained simultaneously. LV stroke work was measured as the integral area of the pressure-dimension loops, and cardiac work (per minute) was calculated as the product of LV stroke work and heart rate (HR). CBF was recorded and mean CBF was measured online. Mean coronary vascular resistance was calculated as MAP/mean CBF. These methods have been published previously (26–28).
Development of Heart Failure and Recovery From Heart Failure
CHF was induced by chronic rapid right ventricular pacing with a programmable pacemaker (Pace Medical, Waltham, MA) at 240 beats/min for 3–4 wk (27, 28). Cardiac pacing was stopped after the development of CHF, and the animal was allowed to recover for 3–4 wk (cardiac recovery, CR) (26). After the in vivo measurements were completed, the dogs were killed with an overdose of pentobarbital sodium, and LV biopsy specimens were excised, frozen in liquid nitrogen, and stored at –80°C until being analyzed.
In Vivo Assessment of Coronary Vascular Relaxation
All in vivo measurements were made with conscious animals lying in a right lateral recumbent position after an intramuscular injection of morphine sulfate (0.2 mg/kg).
Determination of in vivo endothelium-dependent coronary vascular relaxation. CBF responses to BK and ACh, endothelium-dependent vasodilators, were examined at all three phases of the experiment: control, CHF, and CR. BK (0.1 and 0.5 µg/min) and ACh (1 and 5 µg/min) were administered by intracoronary infusion. To avoid infusion-related change of CBF baseline, the infusion procedure was conducted with a pump-driven syringe at the constant rate of 1 ml/min. Infusions started with 1 ml of saline, followed by 2 ml of BK or ACh solution. The order of the infusion of vasodilators was randomized, and at least 10–15 min intervened between each infusion to permit recovery to predrug baseline values before the subsequent infusion.
Determination of in vivo endothelium-independent coronary vascular relaxation. CBF response to NTG, an endothelium-independent vasodilator, was examined at each of the three phases of the experiment: control, CHF, and CR. NTG (25 µg/kg) was administered by an intravenous injection.
Determination of role of NO in endothelium-dependent and -independent coronary vascular relaxation. CBF responses to the vasodilators BK, ACh, and NTG were examined immediately after a treatment with nitro-L-arginine (NLA), a specific NOS inhibitor. NLA was administered by an intracoronary infusion for 20 min (2 mg/min).
In Vitro Biochemistry and Molecular Analysis
LV myocardial biopsy samples collected from normal dogs (n = 5), dogs with pacing-induced heart failure (n = 5), and dogs recovered from CHF (n = 5) were used for in vitro biochemistry and molecular analysis.
Western blot analysis.
The protein levels of eNOS, P-eNOS, cGK-I, vasodilation-stimulated phosphoprotein (VASP), and phosphorylated VASP (P-VASP) were examined by Western blot analysis. Calsequestrin was used as an internal control. LV myocardial biopsy specimens (
150 mg) were pulverized to a fine powder. Aliquots (50 mg) were transferred to a precooled Lysing Matrix D tube (Qbiogene) containing 300 µl of extraction buffer and homogenized with the Fast Prep FP 20 (Bio101). Samples were microcentrifuged at 14,000 rpm at 4°C for 15 min, and the protein concentration in the supernatants was analyzed with the Bio-Rad Protein Assay. Protein samples were subjected to SDS-PAGE (10–12% gels), transferred to Hybond-P membrane (Amersham Pharmacia Biotech) or nitrocellulose, blocked in 5–7% milk, and incubated with primary antibodies against eNOS, P-eNOS, cGK-I, VASP, and P-VASP. Primary antibodies were incubated overnight in 3% milk at 4°C. Secondary antibody IgGs (alkaline phosphatase-conjugated anti-mouse, -rabbit, or -goat) were incubated for 1 h at room temperature in 0.5–3% milk. Chemifluorescent detection was performed directly with the Vistra ECF reagent (RPN 5785; Amersham Pharmacia Biotech) and scanned with a PhosphorImager. Bands were quantified by densitometry.
Real-time PCR.
The RNA level of eNOS was analyzed by quantitative real-time PCR. LV myocardial biopsy specimens (150 mg) were homogenized in 1 ml of TRIzol. Total RNA was purified with RNeasy columns (Qiagen, Valencia, CA) before DNase treatment (DNA-free; Ambion, Austin, TX) and reverse-transcribed with the SuperScript First-Strand Synthesis System (Invitrogen, Carlsbad, CA). Gene-specific primers were designed with Primer Express 1.5 software (Applied Biosystems, Foster City, CA) for eNOS (F: GCCAACGTGGAGATCACTGA; R: GTTTCGCCGGCAAAGGA). PCR reactions containing template, each primer at 100 nM, and 2x SYBR Green PCR Master Mix (Applied Biosystems) were incubated at 50°C for 2 min and denatured for 10 min at 95°C, followed by 50 cycles at 95°C for 15 s and 60°C for 1 min. Relative quantitation was performed according to the comparative threshold cycle (CT) method, with 18s RNA as the normalization gene (ABI User Bulletin 2).
Measurement of NOx content in cardiac tissue. Total NOx (nitrate/nitrite) content was measured with the Nitrate/Nitrite Fluorometric Assay Kit (Cayman Chemical). In brief, the tissue samples were rinsed, homogenized in buffer, and centrifuged at 14,000g for 20 min. Tissue homogenates were ultrafiltered through 10-kDa molecular mass cutoff filters. The assay is performed by first converting nitrate to nitrite with nitrate reductase and then adding 2,3-diaminonaphthalene followed by NaOH, which converts nitrite into a fluorescent compound.
Statistical Analysis
Data are reported as means ± SE. Differences between means were considered statistically significant if the probability of their occurring by chance was <5% (P < 0.05). For all comparisons, data within and among the protocols were analyzed with one-way or two-way ANOVA with post hoc test for statistical significance.
|
RESULTS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Table 1 summarizes hemodynamic and cardiac functional changes in conscious dogs during the control, CHF, and CR phases of the experiment. After rapid ventricular pacing for 3–4 wk, all dogs developed severe heart failure accompanied by exertional dyspnea and ascites. Compared with control, there were significant increases in HR and LV end-diastolic pressure (LVEDP) and decreases in MAP, LV systolic pressure, LV dP/dtmax, LVFS, and cardiac work. Cardiac recovery was initiated by terminating the ventricular pacing. Three to four weeks later cardiac systolic functional parameters, LV dP/dtmax, LVFS, and cardiac work, were restored to 80–95% of their control level, while LVEDP and HR were reduced.
|
To examine endothelium-dependent coronary vasodilation in CHF and CR, the peak CBF responses to BK and ACh were repeatedly assessed and compared in the same dogs over the three phases: control, CHF, and CR.
Since BK could potentially cause pain, dogs received a pretreatment of morphine (0.2 mg/kg im) before each experiment, and they were quiet during intracoronary infusions of BK without any observed pain response.
Intracoronary infusions of BK and ACh resulted in dose-dependent increases in CBF without significant change in hemodynamics or cardiac parameters (Table 2). BK (0.5 µg/min ic) caused a marked increase in peak CBF response by 109 ± 13 ml/min in the control. The peak CBF response to BK was significantly depressed (50 ± 5 ml/min, P < 0.05) in heart failure and was completely restored (101 ± 14 ml/min) after 3- to 4-wk cardiac recovery (Fig. 1, Table 2). ACh (5 µg/min ic) produced a significant increase in peak CBF response by 136 ± 14 ml/min in the control. The peak CBF response to ACh was reduced (76 ± 8 ml/min, P < 0.05 vs. control) in CHF and completely recovered (120 ± 19 ml/min, P > 0.05 vs. control) after 3- to 4-wk CR (Fig. 2, Table 2). Our data show that the endothelium-dependent coronary vasodilation in heart failure was significantly depressed and was completely restored after CR from heart failure.
|
|
|
To identify the role of NO in the endothelium-dependent CBF response, the effect of NO blockade with NLA on the CBF response to BK or ACh was repeatedly assessed in the phases of control, CHF and CR (Figs. 1 and 2). Treatment with NLA (2 mg/min, 20 min) did not significantly alter systemic hemodynamics, cardiac functional parameters, or the baseline of CBF.
Before heart failure (control), treatment with NLA significantly decreased the peak CBF response to BK (0.5 µg/min ic) by 47 ± 14 ml/min (P < 0.05) and to ACh (5 µg/min ic) by 60 ± 9 ml/min (P < 0.05), confirming the role of NO in the endothelium-dependent coronary vasodilation response to BK and ACh. The inhibitory effect of NLA on the peak CBF response to BK and ACh was significantly reduced (–23 ± 3 and –32 ± 4 ml/min, both P < 0.05 vs. control) in CHF, indicating an impairment of endogenous NO-mediated coronary vasodilation. After cardiac recovery for 3–4 wk, the inhibitory effect of NLA on the peak CBF response to BK and ACh was restored (–42 ± 9 and –43 ± 14 ml/min), suggesting a recovery of endogenous NO-mediated coronary vasodilation.
CBF Response to NTG
To determine the response of coronary vascular smooth muscle to NO, the CBF response to the endothelium-independent vasodilator NTG was examined before and after treatment with NLA. This assessment was repeated in five dogs in the control, CHF, and CR phases of the experiment.
Intravenous injection of NTG resulted in a substantial increase in CBF (63.2 ± 7.0 ml/min) in the control phase and a similar response (64.7 ± 7.6 ml/min) in CHF. Interestingly, after cardiac recovery, the CBF response to NTG was significantly enhanced by 71% compared with the response in the control, with similar changes in hemodynamics and cardiac parameters (Fig. 3 and Table 3). The CBF response to NTG was not affected by treatment with NLA. These results suggest an augmented relaxation of coronary vascular smooth muscle in response to NO after cardiac recovery.
|
|
To determine the alteration of NO production in failing and recovering hearts, we measured the myocardial NOx (nitrate/nitrite) content. As shown in Fig. 4, myocardial NOx content was significantly reduced (34 ± 14% of control) in failing hearts and partially restored (78 ± 14% of control) in recovery hearts.
|
To determine the translational and posttranslational regulation of eNOS in failing and recovery hearts, we examined eNOS mRNA expression, total eNOS protein, and phosphorylation of eNOS. As illustrated in Fig. 5, compared with control, eNOS expression was reduced to 34 ± 12% (P < 0.05) of control, with a parallel reduction of total eNOS protein (57 ± 17%, P < 0.05) and P-eNOS (48 ± 20%, P < 0.05) in heart failure (Fig. 5, B–D). In recovery hearts, eNOS expression and total protein level remained at the same level as failing hearts, 41 ± 13% and 49 ± 15% of control hearts (both P < 0.05; Fig. 5, B and C), respectively. However, P-eNOS was completely restored to the control level (111 ± 30%, P > 0.05; Fig. 5D), and the ratio of P-eNOS and total eNOS was greatly increased by twofold (Fig. 5E), indicating a posttranslational regulation.
|
To determine the alteration of activity in the cGMP/cGK-I signaling pathway in CHF and cardiac recovery, we examined a novel biomarker for cGMP/cGK-I signaling, VASP and P-VASP at two different sites (Ser239 and Ser157). As illustrated in Fig. 6B, cGK-I protein levels were unaltered in CHF and recovery. However, activity of this pathway was altered in recovering hearts as indicated by the phosphorylation status of VASP (nearly a 3-fold increase) at Ser239 (Fig. 6D), although no change in protein expression was detected (Fig. 6B). The other phosphorylation site (Ser157), activated by PKA, was unchanged (Fig. 6E). All the data taken together indicate an increase in activity of cGK-I and an elevation of sensitivity of the cGMP/cGK-I signaling pathway to NO.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Heart Failure and Recovery in Dogs
In the present study, rapid ventricular pacing led to heart failure that was associated with depression of myocardial contractility, increase in LV wall stress, and dilation of cardiac chambers. Termination of the ventricular pacing after the development of CHF allowed failing hearts to recover, leading to the normalization of LV contractile function and wall stress. Thus we established a unique model for this longitudinal investigation of endothelium-dependent and -independent coronary vascular relaxation and their related molecular mechanisms during the development of CHF and CR.
Endothelium-Dependent CBF Response
BK stimulates B2 BK receptors and ACh activates muscarinic cholinergic receptors on vascular endothelial cells, and both cause the production of NO, resulting in endothelium-dependent relaxation of vascular smooth muscle (11, 16). In the present study using a chronically implanted intracoronary catheter technique, the in vivo endothelium-dependent CBF response was assessed through stimulations with BK and ACh in conscious dogs during three phases of the experiment: control, CHF, and CR. Either BK or ACh caused a significant increase in CBF, which was significantly reduced after specific NO blockade with NLA, indicating NO dependence in the CBF response. In CHF, the CBF response to BK or ACh was significantly depressed and the inhibitory effect of NLA was reduced. Our results confirmed previous observations (4, 25, 34, 36) indicating endothelial dysfunction and NO deficiency in CHF. Importantly, we found the full recovery of coronary vasodilation with BK or ACh infusions and the inhibitory effect of NLA after 3- to 4-wk CR indicated a complete restoration of the depressed NO-dependent CBF response in the failing heart, which paralleled the cardiac contractile functional recovery. It is noteworthy that the endothelium-mediated BK and ACh relaxing response in coronary vessels also contains a NO-independent component, such as endothelium-derived hyperpolarizing factor (3), including prostaglandins and cytochrome P-450 products of arachidonic acid (1, 23). In the present study, the NO-independent component was mainly represented by the CBF response to BK and ACh after NLA treatment. Interestingly, the NO-independent component in the CBF response to BK and ACh was also reduced in CHF and fully restored in the dog recovered from CHF. The impairment of myocardial blood flow regulation, associated with vascular endothelial dysfunction and NO deficiency, contributes to the cardiac functional abnormalities in CHF (32). Thus the restoration of endothelium-dependent coronary vascular relaxation may be important for the improvement of cardiac function in failing heart during CR.
Transcriptional and Posttranscriptional Regulation of eNOS
Although eNOS is a constitutive enzyme, eNOS gene expression and protein levels in vascular endothelium can be modulated by many pathological conditions. It has been reported that, associated with the decrease in NO production, eNOS mRNA and protein levels were reduced in CHF (5, 29). Confirming earlier reports, we showed a significant reduction of eNOS expression and protein level in failing hearts, accompanied by depression of in vivo endothelium-dependent CBF response and myocardial NO content. Surprisingly, we found that eNOS expression and protein levels remained low during recovery from heart failure, despite a significant contractile functional rebound in these hearts. Our results suggested that recovery of impaired endothelial function, particularly the eNOS system, in CHF is a slower process. Currently the details of these transcriptional and posttranscriptional regulatory mechanisms remain unclear, and this is an area needing further investigation.
eNOS was originally characterized as a calcium/calmodulin-dependent enzyme, by which the activity of eNOS is primarily controlled (9). Recently, it was found that the Akt-dependent phosphorylation of Ser1179 on eNOS resulted in a calcium-independent activation of eNOS and augmentation of NO production (6, 10, 12). The phosphorylation of eNOS could be regulated by shear stress (12) or enhanced by ACh and BK (10, 13). In this study, we showed that P-eNOS decreased significantly in the failing heart and was proportional to the decrease in the total eNOS protein. This suggests that, as a part of the regulatory mechanism for the activity of eNOS, the decrease in phosphorylation of eNOS could directly lead to the reduction of NO production in heart failure. More importantly, we found that P-eNOS was able to be completely restored in recovery hearts, despite the fact that total eNOS protein remained at a low level. It has been reported that P-eNOS could be 15–20 times more effective in producing NO than unphosphorylated eNOS (10, 12). Consistently, we showed that the NOx content in cardiac tissue recovered from 34 ± 14% of control in failing hearts to 78 ± 14% of control in recovery hearts, which was in agreement with a recent study of NO deficiency in the failing human heart unloaded by LV assist device (22). Thus the modification of eNOS protein by phosphorylation, as a posttranslational regulation, could play an essential compensatory role contributing to the restoration of eNOS activity and NO production during CR from heart failure.
Endothelium-Independent CBF Response
NTG acts as a NO donor, resulting in coronary vascular relaxation. In the present study, we used NTG for the in vivo assessment of the endothelium-independent CBF response. In contrast to the marked decrease in the endothelium-dependent CBF response to BK and ACh, the endothelium-independent CBF response to NTG did not change significantly in CHF. This observation was also consistent with a previous report (4, 34). Interestingly, the coronary vasodilation response to NTG was significantly enhanced by 70% after CR, representing enhanced relaxation of the coronary vascular smooth muscle in response to NO. It has been shown that both acute inhibition of endothelial NO formation (2, 7) and the chronic deficiency of NO in eNOS–/– mice (2, 8, 17) results in an increase in the sensitivity of vascular relaxation to NO donors. Our findings suggest that augmentation of vascular smooth muscle relaxation to NO could have a compensatory contribution to the restoration of endothelium-dependent coronary vasodilation under the condition of incomplete recovery of endothelial dysfunction and NO deficiency.
P-VASP and cGMP/cGK-I Signaling
The cGMP/cGK-I signaling pathway has been well established as a NO downstream target in vascular smooth muscle for the essential role in the regulation of vascular relaxation. NO stimulates the target enzyme, sGC, to produce the second messenger cGMP, causing further activation of cGK-I, which mediates vascular relaxation via phosphorylation of several proteins regulating intracellular Ca2+ mobilization and cytoskeleton organization (18). Although sGC has been found to be widely distributed in vascular smooth muscle, endothelial cells, and myocytes, particularly associated with cellular membranes (35), immunoelectron microscopy demonstrated an overlapping cellular distribution of cGK-I and its substrate VASP, primarily localized in vascular endothelium and smooth muscle cells (19). Evidence from the study of cGK-I-deficient mice further indicated that VASP, a family member of proline-rich protein, was phosphorylated primarily by cGK-I at Ser239 (P-VASPSer239) (20). Thus P-VASPSer239 has been proposed to be a sensitive biochemical marker for monitoring the activity of cGMP/cGK-I signaling pathway and endothelial integrity, associated with NO-related vascular relaxation. In the present study, we found that there was no appreciable change in the expression of cGK-I, VASP, and P-VASPSer239 in failing heart. In contrast, the expression of P-VASPSer239 increased nearly threefold in recovery hearts, even though the expression of cGK-I and VASP were unchanged. In addition, we examined the expression of P-VASPSer157, which is phosphorylated by PKA (14) and did not change in recovery hearts. Thus the selective augmentation of P-VASPSer239 expression in recovery hearts indicated an increase in the activity of cGK-I and cGMP/cGK-I signaling. This conclusion was further supported by our in vivo observation that the endothelium-independent CBF response to NTG was significantly enhanced in dogs after CR from CHF. Since the measurement of myocardial NOx (nitrate/nitrite) content suggested that the NO production in recovery hearts was not completely restored and only reached 78 ± 14% of control level (Fig. 3A), an increase in the activity of cGK-I and cGMP/cGK-I signaling was most likely due to an increased enzyme catalytic sensitivity in response to NO, although the details of the mechanisms remain unclear. Together, our results demonstrate a compensatory change in the NO downstream target, cGMP/cGK-I signaling pathway, in coronary vascular smooth muscle during development of CHF with insufficient NO production. This adaptive enhancement of vascular smooth muscle response to NO could play an important role in supporting the restoration of endothelium-mediated coronary vascular relaxation during CR from CHF.
In summary, an increase in eNOS phosphorylation and enhancement of the activity of cGMP/cGK-I contributes to the restoration of endothelium-dependent coronary vascular relaxation during cardiac recovery from heart failure. Our results suggest that the promotion of eNOS phosphorylation and the elevation of activity of cGMP/cGK-I could be a potential therapeutic approach for heart failure.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
* R. M. Gill and J. C. Braz contributed equally to this work. 
|
REFERENCES |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  W. Song, H.-B. Kwak, J.-H. Kim, and J. M. Lawler Exercise Training Modulates the Nitric Oxide Synthase Profile in Skeletal Muscle From Old Rats J Gerontol A Biol Sci Med Sci, May 1, 2009; 64A(5): 540 - 549. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |
P < 0.05 vs. control; *P < 0.05 vs. pretreatment with NLA.
