|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
promotes a proliferative and proinflammatory phenotype in human vascular smooth muscle cells1Molecular Cardiology Research Institute and 2Department of Medicine, Tufts-New England Medical Center, Tufts University School of Medicine, Boston, Massachusetts
Submitted 30 June 2006 ; accepted in final form 5 February 2007
| ABSTRACT |
|---|
|
|
|---|
, but it is unknown whether endogenous IL-1
stimulates VSMC in an autocrine manner. Here we tested the hypothesis that endogenous IL-1
contributes to TLR-induced proliferation and chemokine release in human VSMC by using RNA interference to knock down IL-1
expression. Knockdown of IL-1
abolished TLR-induced proliferation and suppressed TLR4-induced release of monocyte chemoattractant protein-1 (MCP-1) by VSMC, indicating that endogenous IL-1
plays a crucial role in both responses. Serum, PDGF, FGF-2, and EGF each increased cellular IL-1
concentrations, and IL-1
knockdown inhibited serum- and PDGF-induced DNA synthesis, further indicating that endogenous IL-1
also contributed to VSMC responses to growth factors. IL-1 receptor antagonist, a competitive inhibitor of IL-1 receptor I (IL-1RI), also attenuated TLR-induced proliferation and both basal and TLR-induced MCP-1 expression, indicating at least a partial role of the IL-1RI in mediating these responses. The results support the hypothesis that autocrine actions of endogenous IL-1
, mediated at least in part via IL-1RI signaling, contribute to a proproliferative and proinflammatory phenotypic shift in TLR-activated human VSMC, which might play a pathogenic role in vascular disorders.
monocyte chemoattractant protein-1; cell proliferation; type I interleukin-1 receptor
(IL-1
) and monocyte chemoattractant protein-1 (MCP-1) (7, 9, 22, 29). The functions of endogenous VSMC-derived IL-1
in this context are unknown, but we have hypothesized that it may play an autocrine role in promoting VSMC proliferation, based on in vitro and in vivo lines of evidence. For example, in coronary bypass patients, IL-1
was found in spindle-shaped cells within saphenous vein grafts that had become stenotic but not in those that remained patent (5). Similarly, IL-1
mRNA was found in medial smooth muscle cells (SMC) within arterial lesions of hypercholesterolemic monkeys but not in normal arteries (21). Furthermore, human VSMC exhibited markedly enhanced serum-induced proliferative responses when either coincubated with exogenous IL-1
or stably transfected so as to produce low levels of the IL-1
precursor protein (3, 17). Also, activation of the type I IL-1 receptor (IL-1RI) was found to contribute to injury-induced neointima formation in transgenic mouse models (13, 24).
The IL-1RI superfamily also includes Toll-like receptors (TLRs), proinflammatory signaling molecules that are expressed in cells of the innate immune system, wherein they mediate host responses to microbial infection, but that are also expressed in VSMC, wherein they can induce profound phenotypic changes. For example, VSMC express TLR2, TLR3, and TLR4, which, when activated by their respective microbial ligands, induce both proliferation and MCP-1 release (26, 3638). Because TLR activation also stimulates the synthesis and intracellular accumulation of IL-1
within VSMC (36, 38), we hypothesized that IL-1
may mediate the dramatic phenotypic changes elicited by activating the endogenous TLRs expressed within VSMC. To test this hypothesis, we used an RNA interference approach to selectively inhibit endogenous IL-1
synthesis in primary cultures of human arterial SMC, complemented by additional studies using anti-IL-1
antibodies and IL-1 receptor antagonist (IL-1RA). We found that VSMC-derived endogenous IL-1
is crucial to TLR-induced proliferation and also promotes TLR-induced chemokine expression and growth factor-induced proliferation in human VSMC. The results suggest a role of IL-1
as an endogenous activator of a proproliferative and proinflammatory phenotypic shift in human arterial SMC, potentially relevant in a broad range of human vascular disorders and injury.
| METHODS |
|---|
|
|
|---|
Small interfering RNA transfections.
Human VSMC were plated at subconfluent density (25,000/cm2) and were transfected the following day with either IL-1
-specific small interfering RNA (siRNA) or nonspecific control siRNA complexed with Lipofectamine 2000 (Invitrogen), with a final siRNA concentration of 50 nM. After 5 h, RNA-lipid complexes were removed and SMC were incubated overnight in complete media. To ensure the specificity of any observed effects, several different IL-1
-specific and nontargeting siRNAs were used, including two nontargeting single-duplex siRNAs (NS1, UAGCGACUAAACACAUCAAUU, and NS2, CUUACGCUGAGUACUUCGAdTdT; sense strand sequences) and a single-duplex IL-1
-specific siRNA (GAUCAUCUGUCUCUGAAUCdTdT), used in experiments shown in Fig. 1E and Fig. 2, D and E. Alternatively, a pool consisting of either four nonspecific (siCONTROL, catalog no. D-001206; Dharmacon) or four IL-1
-specific siRNAs (siGENOME SMARTpool, catalog no. M-007952; Dharmacon) was used in the experiments shown in Fig. 1, AC, Fig. 2C, Fig. 3, and Fig. 4, B and C. SMC were then trypsinized and replated as indicated for experiments.
|
|
|
|
, hypoxia inducible factor (HIF)-1
, and
-actin mRNA levels were determined by semiquantitative RT-PCR, as previously described (25, 38). Briefly, RNA was isolated from VSMC by using an RNeasy kit (Qiagen), treated with DNase I, and quantified spectrophotometrically, and RNA (1 µg) was reverse transcribed with Moloney murine leukemia virus reverse transcriptase and oligo(dT) primer. Cellular proliferation assays. As an index of cellular proliferation, we measured the incorporation of [3H]thymidine into newly synthesized DNA. SMC were plated in 48-well plates (5,000/well) and were serum-deprived for 24 h (DMEM/1% FCS), and media were replaced with DMEM with 1% FCS, with or without TLR agonist or growth factor. To activate TLR4, we used ultrapure Eschericha coli serotype 0111:B4 lipopolysaccharide (LPS; List Biologicals). All incubations with LPS also included human recombinant CD14 (100 ng/ml; R&D Systems) to compensate for potentially low CD14 expression in subcultured human VSMC (36), permitting efficient delivery of LPS monomers to the TLR4 signaling complex (11). To activate TLR3, we used polyinosinic-polycytidylic acid [poly(I-C); Amersham], a widely studied mimic of viral double-stranded RNA (dsRNA). For experiments with HCoASMC, 1 µCi/well [3H]thymidine was added after 24 h and cells were incubated for an additional 24 h, then washed three times in ice-cold PBS. For HPASMC, which proliferate at a faster rate, [3H]thymidine was added after 16 h and cells were incubated for an additional 8 h. Nonincorporated [3H]thymidine was extracted from the cells with 5% ice-cold TCA, and incorporated [3H]thymidine was extracted into 0.5 N NaOH. Samples were neutralized by the addition of 0.5 N HCl and were added to scintillation fluid, and incorporated [3H]thymidine was determined by scintillation counting. Cellular proliferation was also determined directly by cell counting. For these studies, HCoASMC were plated at 5,000 cells/cm2 and were serum-deprived for 48 h, and cell counts were determined before and 96 h after incubation in basal media with 1% FCS, with or without poly(I-C) (1 µg/ml).
MCP-1 and IL-1
ELISA.
HPASMC were plated in 48-well plates (10,000/well), serum-deprived (1% FCS) for 72 h, and then incubated for 6 h in serum-free media with or without LPS/CD14. Human MCP-1 concentrations were determined in cell supernatants by ELISA (R&D Systems), and cell-associated IL-1
concentrations in whole cell lysates were determined by ELISA (Cayman Chemical) as described (3).
IL-1
immunocytochemistry.
HPASMC were plated onto glass coverslips and were transfected with IL-1
-specific or control nonspecific siRNA as described above, or else were left untransfected. After 24 h, HPASMC were serum-deprived (1% FCS) for 24 h, then were fixed, permeabilized, and immunostained by using rabbit anti-human IL-1
IgG (R&D Systems) and Alexa Fluor 594-labeled goat anti-rabbit IgG (Molecular Probes), as previously described (3).
Statistical analysis. Data are presented as means ± SE. Significant differences were determined by analysis of variance, followed by Bonferroni post hoc tests where indicated, using Prism 4.0 software. Values of P < 0.05 were taken as significant.
| RESULTS |
|---|
|
|
|---|
expression is essential to TLR3- and TLR4-induced proliferative responses.
We found earlier that Chlamydophila pneumoniae, a microorganism frequently present in atherosclerotic lesions, stimulates human VSMC proliferation by a pathway involving TLR4 signaling (26) and that TLR3 (dsRNA) and TLR4 (E. coli LPS) agonists likewise promote HCoASMC proliferation by activating the respective TLR subtypes (38). Because the TLR3-induced VSMC proliferation was accompanied by persistent (>48 h) increases in cell-associated levels of the growth-promoting cytokine IL-1
(3, 38), here we tested the hypothesis that IL-1
promotes TLR-induced VSMC proliferation by using siRNA-mediated gene silencing. We confirmed by RT-PCR analysis that IL-1
-directed siRNA markedly reduced the levels of mRNA encoding IL-1
but not those encoding the nontargeted proteins HIF-1
and
-actin, documenting the efficacy and specificity of siRNA-induced knockdown of gene expression (Fig. 1A). Transfection of HCoASMC with IL-1
-directed siRNA reduced the concentrations of cell-associated IL-1
in nonstimulated HCoASMC and abolished the marked increase in IL-1
levels seen following stimulation with poly(I-C) (Fig. 1B). Poly(I-C) stimulated DNA synthesis (Fig. 1C), as well as cell proliferation (Fig. 1D), and siRNA-mediated IL-1
knockdown abolished both poly(I-C)- and LPS-induced DNA synthesis without affecting baseline DNA synthesis rates (Fig. 1, C and E), indicating that endogenous IL-1
is a crucial mediator of TLR-induced proliferation of HCoASMC. Importantly, LPS-induced IL-1
accumulation was similar in HCoASMC transfected with nontargeting siRNAs (0.47 ± 0.05 and 0.64 ± 0.04 ng/106 cells in NS1- and NS2-transfected cells, respectively) to that seen in nontransfected HCoASMC (0.37 ± 0.08 ng/106 cells).
Endogenous IL-1
promotes growth factor-induced proliferation of human VSMC.
We found that SMC derived from either human coronary (Fig. 1B) or pulmonary arteries (Fig. 2, A and B) produce IL-1
, even in the absence of TLR stimulation. Furthermore, cell-associated IL-1
concentrations increased markedly after stimulation of HPASMC by FCS (Fig. 2A) or by tyrosine kinase receptor-activating growth factors, including platelet-derived growth factor (PDGF)-AB, FGF-2, and EGF (Fig. 2B). Because the IL-1
content of growth factor-stimulated HPASMC was similar to the concentrations we found earlier to promote proliferation in transfected human VSMC stably expressing IL-1
precursor (0.22.1 ng/106 cells) (3), we hypothesized that endogenous IL-1
may promote growth factor-induced proliferation in VSMC. In support of this hypothesis, siRNA-induced IL-1
knockdown inhibited FCS-induced proliferation in HPASMC (Fig. 2C) and PDGF-stimulated proliferation in HCoASMC (Fig. 2D). Furthermore, exogenous IL-1
(1 ng/ml) reversed the inhibitory effect of IL-1
knockdown on PDGF-induced proliferation (Fig. 2E), confirming that the suppressive effect of IL-1
siRNA on proliferative responses was mediated by its reduction of IL-1
activity. On the other hand, exogenous IL-1
did not stimulate either basal or PDGF-induced thymidine incorporation in cells not subjected to IL-1
knockdown, indicating that exposure of VSMC to IL-1
levels exceeding those produced endogenously does not further augment proliferation.
Suppression of constitutive intranuclear IL-1
expression by IL-1
-directed siRNA.
Although cell-associated IL-1
was expressed constitutively, and its concentrations were increased by TLR agonists and growth factors, we found that IL-1
was undetectable (<2 pg/ml) in media conditioned for 48 h by unstimulated or PDGF-, FCS-, or LPS/CD14-stimulated HCoASMC (data not shown), suggesting that IL-1
remained primarily or exclusively cell associated. The cell-associated IL-1
in LPS-stimulated HCoASMC was found by Western blot analysis to be present primarily in its 31-kDa form, corresponding to the predicted size of the IL-1
precursor (10), whereas the 17-kDa mature form of IL-1
was not detectable (data not shown). The IL-1
precursor contains a nuclear localization signal that promotes its nuclear uptake in various cell types, including VSMC, whereas mature IL-1
lacks the nuclear localization signal and remains cytosolic (3, 35). We therefore determined the distribution of cell-associated IL-1
by using immunocytochemistry and found, accordingly, that IL-1
was localized predominantly within the nuclei of unstimulated HPASMC (Fig. 3). Transfection of HPASMC with IL-1
-specific siRNA led to reduction of immunoreactive nuclear IL-1
to background levels (i.e., indistinguishable from fluorescent signal in cells expressing IL-1
but stained with a nonspecific primary antibody; not shown), indicating that the immunoreactive IL-1
detected was the protein product of IL-1
gene expression rather than a spurious cross-reacting antigenic species (Fig. 3). The results further suggest that constitutive expression of intranuclear IL-1
precursor protein requires ongoing IL-1
gene expression.
Endogenous IL-1
promotes MCP-1 release by human VSMC.
Because LPS stimulates both IL-1
accumulation and MCP-1 release in HPASMC (36), we also tested whether endogenous IL-1
contributes to LPS-induced MCP-1 release. LPS-induced expression of IL-1
was maximal after 6 h exposure and declined thereafter. This contrasted with the time course of dsRNA-induced IL-1
accumulation, which was not significant by 6 h but was markedly stimulated after 2448 h (Fig. 4A). Exposure to LPS stimulated IL-1
accumulation similarly in HPASMC transfected with nontargeting siRNA (Fig. 4B) relative to that in nontransfected HPASMC (Fig. 4A). Importantly, siRNA-mediated IL-1
knockdown in HPASMC markedly suppressed basal and LPS/CD14-stimulated IL-1
levels (Fig. 4B) and also inhibited LPS-stimulated MCP-1 release (Fig. 4C), strongly suggesting that autocrine effects of IL-1
promote both basal and TLR4-induced MCP-1 release.
Role of IL-1R1 in MCP-1 release and TLR-induced proliferation.
To determine whether the autocrine stimulatory effects of IL-1
on VSMC proliferation and chemokine release may involve activation of IL-1RI, we used recombinant IL-1RA, a competitive inhibitor of IL-1-induced IL-1RI signaling (10). We used a relatively high concentration of IL-1RA (250 ng/ml), based on several lines of evidence: a 1,000-fold excess of IL-1RA inhibited both exogenous IL-1
-induced proliferation in human VSMC (3) and the stimulation of MCP-1 mediated by endogenous IL-1
released by apoptotic human VSMC (28). Also, IL-1RA (250 ng/ml) markedly inhibited IL-8 release induced by cell membrane-associated IL-1
in human endothelial cells (15). Exogenous IL-1RA inhibited LPS-induced DNA synthesis in HCoASMC by 46% (Fig. 5A), indicating a contributing role of IL-1RI in LPS-stimulated proliferation. The IL-1RI-mediated component of LPS-induced DNA synthesis did not involve a role of secreted IL-1
, because IL-1
was undetectable (<2 pg/ml) by sensitive ELISA in the supernatants of LPS-stimulated HCoASMC. Exogenous IL-1RA (250 ng/ml for 48 h) did not affect basal, PDGF-, or FCS-induced proliferation in HCoASMC (Fig. 5B) or FCS-induced proliferation in HPASMC (Fig. 5C), even when it was present from the time of plating, suggesting that activation of IL-1RI expressed at the cell surface may not be required for basal or growth factor-induced VSMC proliferation and further indicating that IL-1RA did not exert nonspecific inhibitory effects on cell proliferation. In contrast, exogenous IL-1RA did reduce both basal and LPS-induced MCP-1 release in HPASMC (Fig. 5D), similar to the effect of IL-1
knockdown (Fig. 4C), although to a somewhat lesser extent. To determine whether endogenous IL-1
stimulates MCP-1 release by acting extracellularly in cultured HPASMC, we preincubated HPASMC with IL-1
-neutralizing antibodies and found that they reduced both basal and LPS-stimulated MCP-1 release, whereas nonspecific IgG had no effect (Fig. 5E). Together, these findings indicate that IL-1RI signaling promotes basal and TLR agonist-stimulated MCP-1 release, as well as TLR-induced proliferation in human VSMC, acting at least in part via IL-1RI signaling.
|
| DISCUSSION |
|---|
|
|
|---|
in human VSMC, as a common mediator of the recently described proproliferative and proinflammatory VSMC phenotype elicited by TLR activation (3638). Knockdown of IL-1
expression abrogated the stimulation both of proliferative responses and release of the key proinflammatory chemokine, MCP-1, induced in VSMC by agonists of TLR subtypes, including TLR3 and TLR4. Furthermore, cellular IL-1
levels were increased by several different tyrosine kinase receptor-stimulating growth factors, and the proliferative responses of VSMC both to serum and to PDGF were attenuated by IL-1
knockdown, supporting the hypothesis that IL-1
is a previously unrecognized promoter of the proliferative responses of VSMC to multiple classes of growth signals.
A proproliferative role of IL-1
might contribute to the pathogenesis of conditions including postangioplasty restenosis, which is caused by excessive VSMC proliferation and which remains a common clinical problem despite its mitigation to some extent through the increasing use of intravascular stents (20). Such proproliferative actions of IL-1
in VSMC might also play a role in atherosclerosis, contributing to the neointimal thickening that occurs early in atherosclerosis, although such effects may not necessarily be pathogenic (33). Moreover, synthesis of MCP-1 has been observed within medial VSMC in vivo, both following injury (29) and within human atherosclerotic plaques (22). In such settings, MCP-1 would likely promote the infiltration and activation of mononuclear phagocytes that help orchestrate local inflammatory responses, which in turn are thought to be major etiological factors in atherosclerosis. Therefore, the present findings support the hypothesis that IL-1
, through its actions in arterial VSMC, may potentially contribute to arterial vascular disorders involving excessive proliferation or localized arterial inflammation.
Although the present findings are the first to directly demonstrate a role of endogenous, VSMC-derived IL-1
in mediating the switch to a proinflammatory phenotype that is elicited in VSMC by TLR engagement (3, 17, 3638), previous studies have suggested that endogenous IL-1
may mediate local inflammatory responses involving other cell types. For example, constitutively expressed IL-1
promoted IL-6 and PDGF-A expression in skin fibroblasts from patients with systemic sclerosis (16), was required for T cell receptor-induced proliferation of T helper 2 cells (12), and was also found to be largely responsible for constitutive NF-
B activity in pancreatic cancer cell lines (23). Therefore, through such proinflammatory actions, endogenous IL-1
may not only potentially contribute to normal immune responses but may also play a pathogenic role in a broad range of human disorders that involve aberrant cellular proliferation or cytokine production (10).
On the other hand, IL-1
was undetectable in the medium of TLR4-activated VSMC, suggesting that little or none was released by the cells, consistent with the absence of a consensus signal sequence for secretion within the IL-1
precursor molecule (10). IL-1
is released by some cell types under certain conditions, but only after calpain-dependent processing of the 31-kDa precursor molecule to its 17-kDa mature form, which is then released by unknown mechanisms (6). For example, activation by the proapoptotic Fas ligand causes human VSMC to process and release IL-1
, which in turn exerts autocrine effects (27, 28). Therefore, the absence of detectable IL-1
release suggests that calpain-dependent IL-1
processing may be selectively characteristic of apoptotic rather than TLR-activated VSMC. Here we found that IL-1
in VSMC is present in its 31-kDa precursor form and is predominantly localized in the cell nucleus, consistent with the known presence of a nuclear localization sequence within the IL-1
precursor. In contrast to mature IL-1
, the precursor form of IL-1
need not necessarily be released to produce the IL-1RI-dependent components of its effects, because it can localize to the plasma membrane, where it is bioactive and capable of activating IL-1RI on adjacent cells by a juxtacrine mechanism (2, 15, 25). Thus endogenous IL-1
may promote MCP-1 release and proliferation in TLR-activated VSMC via juxtacrine mechanisms that involve IL-1RI signaling but are not dependent on IL-1
release. Alternatively or in addition, its strong intranuclear localization also raises the possibility that IL-1
may also influence VSMC gene expression directly within the nucleus (34), but the present data do not permit functional assessment of this hypothesis. Our studies also do not rule out the possibility that IL-1
was released into the media and degraded, but this is unlikely because IL-1
is readily detectable in conditioned media of human VSMC stably overexpressing IL-1
(3) or stimulated with Fas ligand (28). Determining the mechanistic contributions of intranuclear, juxtacrine-acting, and released IL-1
to its IL-1RI-mediated and potential IL-1RI-independent proinflammatory actions in VSMC is a complex problem that will require further study.
The present findings concerning the roles of IL-1
as a mediator of VSMC proliferative responses, including those elicited by TLR activation, are especially relevant because receptors of the IL-1 receptor/TLR superfamily have previously been implicated as mediators of injury-induced intimal hyperplasia in vivo. For example, IL-1RI deficiency markedly inhibited neointima formation elicited by carotid artery ligation in mice (24), and deficiency of endogenous IL-1RA, a native antagonist of IL-1RI activation (10), increased the extent of neointima formation that followed the placement of a nonocclusive cuff around the femoral artery (13), suggesting that endogenous IL-1RI signaling contributes to these responses. Similarly, adventitial stimulation by TLR2 or TLR4 ligands exacerbated the neointima formation that was elicited by femoral artery injury in mice (30, 32), responses that not only indicate broad involvement of the IL-1R/TLR superfamily but also could conceivably involve a role of IL-1
, as indicated by the present in vitro findings that IL-1
mediates TLR-induced VSMC proliferation.
The role of IL-1
as a promoter of chemokine synthesis in VSMC may be relevant in the context of atherogenesis, because pathogenic roles of TLRs and IL-1RI have been implicated in mouse models of atherosclerosis. IL-1RI deficiency diminished aortic lesions, whereas IL-1RA deficiency exacerbated them, in ApoE-deficient mice fed high fat/high cholesterol "Western" diets, suggesting that IL-1RA tonically opposes a contributing role of endogenous IL-1 (acting via IL-1RI) in such lesion formation (18). IL-1RI deficiency also reduced aortic lesions in mice infected systemically with Porphyromonas gingivalis, a periodontal pathogen, indicating a mediating role of IL-1RI in microbially induced vasculopathy (8). Also, TLR4 deficiency decreased aortic lesion size, and the extent of chemokine expression and macrophage accumulation therein, in hypercholesterolemic ApoE-deficient mice (4, 19). Furthermore, deficiency of MyD88, which is a key downstream signal transducer utilized by IL-1RI and by TLRs, yielded larger reductions in lesion size than did TLR4 deficiency, suggesting that such proatherogenic roles of TLR4 and IL-1RI may be nonredundant in vascular lesion formation (4, 19).
Although siRNAs reportedly can induce cytokine and interferon synthesis in mice and in human peripheral blood mononuclear cells, perhaps involving activation of innate immunity signaling pathways by the foreign RNA (14), the roles of endogenous IL-1
identified presently in human VSMC cannot be attributed to such mechanisms, for several reasons. First, experiments with IL-1RA and neutralizing antibodies confirmed a role of endogenous IL-1
in both unstimulated and LPS-stimulated HCoASMC. Second, the effects of IL-1
knockdown observed using multiple distinct sets of IL-1
siRNAs were similar. Finally, the control siRNAs had only minimal effects on IL-1
expression and do not influence human SMC proliferation, as shown earlier (31).
Convergent evidence thus strongly suggests that IL-1RI and TLRs are involved in arterial proliferative and pathogenic responses in diverse models, including vasculopathies induced by infectious pathogens and hypercholesterolemia. On exposure to microbial products or TLR agonists, VSMC exhibit a profound switch to a proliferative and proinflammatory phenotype, as reported here and in several recent studies (3638), strongly suggesting that such changes may render VSMC capable of contributing substantially to a variety of vascular disorders. Therefore, the present findings that IL-1
is a key mediator of the phenotypic responses of human VSMC to TLR agonists and that it also contributes to growth factor-induced proliferative responses in vitro suggest a potential role of endogenous IL-1
as a common mediator of vascular pathogenic responses in human vascular disorders. Elucidating the significance of these actions in vivo and their mechanistic details should therefore prove a rewarding direction for future research.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
precursor promotes human vascular smooth muscle cell proliferation. Am J Physiol Heart Circ Physiol 276: H901H912, 1999.
precursor. J Biol Chem 266: 1216212167, 1991.
precursor promote iNOS expression in vascular smooth muscle cells. Am J Physiol Heart Circ Physiol 280: H1615H1623, 2001.
promote growth factor-induced proliferation of human vascular smooth muscle cells. Am J Physiol Heart Circ Physiol 290: H2528H2534, 2006.
is an intracrine proinflammatory activator of transcription. Proc Natl Acad Sci USA 101: 24342439, 2004.This article has been cited by other articles:
![]() |
L.-N. Zhang, J. Vincelette, Y. Cheng, U. Mehra, D. Chen, S.-K. Anandan, R. Gless, H. K. Webb, and Y.-X. Wang Inhibition of Soluble Epoxide Hydrolase Attenuated Atherosclerosis, Abdominal Aortic Aneurysm Formation, and Dyslipidemia Arterioscler Thromb Vasc Biol, September 1, 2009; 29(9): 1265 - 1270. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wu, Q. Zhou, L. Huang, A. Sun, K. Wang, Y. Zou, and J. Ge Ageing-exaggerated proliferation of vascular smooth muscle cells is related to attenuation of Jagged1 expression in endothelial cells Cardiovasc Res, March 1, 2008; 77(4): 800 - 808. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |