|
|
||||||||
-opioid-initiated heart protection via the
2-adrenergic receptor: role of the intrinsic cardiac adrenergic cell1Department of Internal Medicine, Cardiology Division, 2Research Histopathology Core, 3Department of Neuroscience and Cell Biology, 4Department of Surgery, Division of Cardiothoracic Surgery, and 5Department of Pathology, University of Texas Medical Branch, Galveston, Texas; and 6Department of Medicine, University of Arizona, College of Medicine, Sarver Heart Center, Tucson, Arizona
Submitted 31 October 2006 ; accepted in final form 8 March 2007
| ABSTRACT |
|---|
|
|
|---|
2-adrenergic receptor (
2-AR) or
-opioid receptor (DOR) exerts a similar degree of cardioprotection against myocardial ischemia in experimental models. We hypothesized that
-opioid-initiated cardioprotection is mediated by the intrinsic cardiac adrenergic (ICA) cell via enhanced epinephrine release. Using immunohistochemical and in situ hybridization methods, we detected in situ tyrosine hydroxylase (TH) mRNA and TH immunoreactivity that was colocalized with DOR immunoreactivity in ICA cells in human and rat hearts. Western blot analysis detected DOR protein in ICA cells isolated from rat ventricular myocytes. The physiology of DOR expression was examined by determining changes of cytosolic Ca2+ concentration ([Ca2+]i) transients in isolated rat ICA cells using fluorescence spectrophotometry. Exposing the selective
-opioid agonist D-[Pen2,5]enkephalin (DPDPE) to ICA cells increased [Ca2+]i transients in a concentration-dependent manner. Such an effect was abolished by the Ca2+ channel blocker nifedipine. HPLC-electrochemical detection demonstrated a 2.4-fold increase in epinephrine release from ICA cells following DPDPE application. The significance of the ICA cell and its epinephrine release in
-opioid-initiated cardioprotection was demonstrated in the rat myocardial infarction model and ICA cell-ventricular myocyte coculture. DPDPE administered before coronary artery occlusion or simulated ischemia-reperfusion reduced left ventricular infarct size by 54 ± 15% or myocyte death by 26 ± 4%, respectively.
2-AR blockade markedly attenuated
-opioid-initiated infarct size-limiting effect and abolished
-opioid-initiated myocyte survival protection in rat ICA cell-myocyte coculture. Furthermore,
-opioid agonist exerted no myocyte survival protection in the absence of cocultured ICA cells during ischemia-reperfusion. We conclude that
-opioid-initiated myocardial infarct size reduction is primarily mediated via endogenous epinephrine/
2-AR signaling pathway as a result of ICA cell activation.
-opioid receptor; epinephrine; myocardial ischemia
2-adrenergic receptor (
2-AR) before myocardial ischemia confers cardioprotection via infarct size reduction (13, 14) and facilitated ventricular contractile recovery (25) during ischemia-reperfusion in experimental models. Numerous studies indicate that
-opioid agonists precondition the heart against ischemia (2, 7, 19, 22, 23). The extent of heart protection conferred by
-opioids is comparable with that elicited by myocardial
2-AR stimulation. It has been suggested that
-opioid-initiated cardioprotection is partially mediated by
2-AR in the murine heart (20). Although
-opioid agonists exert potent cardioprotection, it is unclear which type of cardiac cells actually express
-opioid receptor (DOR). Despite the receptor-binding study of DOR (11, 27, 33) and its gene expression in human and animal hearts (2, 28), no clear immunohistochemical evidence has demonstrated in situ DOR expression in cardiac myocytes. The intrinsic cardiac adrenergic (ICA) cell is a neuroendocrine cell that expresses genes and enzyme proteins for epinephrine biosynthesis (5, 9, 10). ICA cells possess an oxygen-sensing function, suggesting an intimate involvement in ischemia-reperfusion (10). In the present study, we have hypothesized that ICA cells express DOR mediating ICA cell function. We have also hypothesized that ICA cells participate in
-opioid-initiated cardioprotection against ischemia. We examined the following objectives: 1) ICA cells express DOR immunoreactivity in human and rat hearts, 2) DOR regulates ICA cell function via cytosolic Ca2+ concentration ([Ca2+]i) transients modulation, 3)
-opioid stimulation enhances endogenous epinephrine release from isolated ICA cells, and 4)
-opioid-initiated cardioprotection depends on ICA cell activation via enhanced epinephrine liberation and consequent myocardial
2-AR stimulation during ischemia-reperfusion in vivo and in vitro. | MATERIALS AND METHODS |
|---|
|
|
|---|
Immunohistochemical labeling of ICA cells was performed on 4-µm paraffin sections of 4% formaldehyde-fixed cardiac tissue. Human heart tissues (n = 6) were obtained from recipients' hearts during heart transplant surgery (n = 4) or autopsy (n = 2). For rat (Sprague-Dawley) immunohistochemical studies, four adult rat hearts were used. The protocols for using human and animal tissue were approved by the Institutional Review Board and the Institutional Animal Care and Use Committee of the University of Texas Medical Branch. Human tissues were taken from left ventricular (LV) free wall and the sinoatrial (SA) and atrioventricular (AV) nodal regions. Immunoperoxidase (9) and immunofluorescent labeling was performed with antibodies against tyrosine hydroxylase (TH) and phenylethanolamine-N-methyltransferase (PNMT), markers of ICA cells (5, 9). The dilutions for mouse anti-human TH (Neuromics, Northfield, MN) and mouse anti-rat TH (ImmunoStar, Hudson, WI) were 1:40. The dilution for rabbit anti-human PNMT (ImmunoStar, Hudson, WI) was 1:500. To colocalize DOR and TH immunoreactivity, immunofluorescent double-labeling methods were used. The concentrations for rabbit anti-human DOR (US Biological, Swampscott, MA) and rabbit anti-rat DOR (Calbiochem, San Diego, CA) were 1:200 and 1:250, respectively. The specificity of mouse anti-TH and rabbit anti-DOR antibodies was tested by substituting these antibodies with universal negative controls for mouse and rabbit IgG (DAKO, Carinteria, CA), respectively. Immunofluorescent double labeling was also used to determine whether ICA cells express neuronal marker protein gene product (PGP) 9.5 or muscle marker myosin heavy chain. The dilutions for PGP 9.5 (Chemicon International, Temecula, CA) and myosin heavy chain (Abcam, Cambridge, MA) were 1:3,000 and 1:500, respectively. The double staining included four steps: 1) rabbit anti-DOR served as the first primary antibody and was stained with goat anti-rabbit Alexa Fluor 594 followed by amplification with donkey anti-goat Alexa Fluor 594; 2) slides were then incubated with biotin-labeled goat anti-rabbit for 30 min to saturate unbound rabbit IgG; 3) mouse anti-TH served as the second primary antibody and was stained sequentially with rabbit anti-mouse Alexa Fluor 488 and goat anti-rabbit Alexa Fluor 488 (Signal Amplification Kit for mouse antibodies, Molecular Probes, Eugene, OR), and a control slide with omitted mouse anti-TH treatment was stained with streptavidin-Alexa Fluor 488 after step 2 to test possible cross-reaction between goat anti-rabbit biotin used in step 2 and rabbit anti-DOR antibody used in step 1; and 4) slides were counterstained with 4,6-diamidino-2-phenylindole (DAPI). Double labeling of TH with PNMT or TH with PGP 9.5 was performed in the same fashion. Image-IT FX Signal Enhancer (Molecular Probes) and autofluorescence eliminator reagent were used before and after staining to block nonspecific background or autofluorescence. Immunohistochemical colocalization of TH and DOR immunoreactivity was performed in rat hearts and in isolated rat ICA cells. Finally, to determine whether both ICA cells and ventricular myocytes express DOR, we performed simultaneous immunofluorescent double detection of immunoreactivity of DOR (rabbit anti-DOR diluted in 1:600) and myosin heavy chain (mouse anti-myosin heavy chain diluted in 1:1,000) in dissociated and mixed rat ventricular cardiocytes.
Detection of TH mRNA in Human ICA Cells by In Situ Hybridization
In situ hybridization was performed on two human LV tissue samples. TH oligonucleotide probes were synthesized (Sigma-Genosys, St. Louis, MO) per the published sequence (accession number: NM_012740). The antisense sequence was GCATAGTTCCTGAGCTTGTCCT, and sense was CGTATCAAGGACTCGAACAGGA. Both were labeled with fluorescein at 5'. Paraffin sections of LV were rehydrated and treated in a microwave oven at 100°C for 6 min and then postfixed with 2% paraformaldehyde followed by graded dehydration. FITC-labeled TH mRNA oligonucleotide probes of sense and antisense were applied at the same concentration and sealed with Hybri-Well Press-Seal Hybridization Chambers (Sigma). Hybridization was performed at 85°C for 5 min and then 2.5 h at 50°C in the Hybrite (Vysis; Downers Groove, IL). After posthybridization wash, goat anti-FITC was applied followed by donkey anti-goat IgG Alexa Fluor 594. The slides were treated with Image-IT Enhancer before applying mouse anti-human TH antibody used for labeling TH immunoreactivity. Dual detection of chicken anti-mouse Alexa Fluor 488 and rabbit anti-mouse Alexa Fluor 488 was performed.
[Ca2+]i Recording in Isolated ICA Cells
Rat ICA cell isolation was made possible by the original observation that live ICA cells but not other cardiocytes preferentially bind to iron oxide-based paramagnetic beads after they have been dissociated from myocardial tissue (9). Ventricular cardiocytes were enzymatically dissociated and resuspended in 4 ml Tyrode solution containing 50-µl paramagnetic beads that were not coated with any primary antibody (Polysciences, Warrington, PA). ICA cells attached to the beads were recovered by magnetic separation and cultured for 4872 h. The cultured ICA cells were loaded with 4 mmol/l fura-2 AM for 30 min. A ratio-based microscopic fluorescent spectrometer was used to measure the [Ca2+]i transients generated by ICA cells (10).
Western Blot Analysis and Epinephrine Assay
To determine whether both ICA cells and ventricular myocytes express DOR protein, freshly isolated rat ICA cells and ventricular myocytes with depletion of ICA cells were lysed separately to extract their protein. Protein of rat brain tissue served as a positive control. Western blot analysis was performed as described (10). The concentration for rabbit anti-DOR was 1:500. In vitro epinephrine release assay was performed in isolated rat ICA cells. ICA cells isolated from adult rat hearts were pooled and plated on 12-well culture plates (2 hearts/well) and cultured for 72 h. Epinephrine release from ICA cells in culture was determined by using a HPLC-electrochemical detection system as described (4).
Experimental Design
DOR mechanism.
We studied the effects of a potent selective
1-opioid agonist [D-Pen2,5]enkephalin (DPDPE) on [Ca2+]i transients generated by isolated ICA cells in culture. After we obtained baseline [Ca2+]i transients of ICA cells for 15 min, DPDPE at different doses (0.1, 1, 10, and 100 nmol/l) was administered in random order to the ICA cell for 15 min. Cells were then washed for 20 min with continuous recording of [Ca2+]i transients until the activity reached a plateau. The specificity of DPDPE was examined by exposing ICA cells to the DOR antagonist naltrindole (NTI, 10 µmol/l) for 10 min followed by application of DPDPE (100 nmol/l) in the continuous presence of NTI for 15 min. To determine whether the L-type Ca2+ channels were responsible for altered [Ca2+]i transients following
-opioid stimulation, the effects of DPDPE on ICA cells in the presence of the L-type Ca2+ channel blocker were tested by applying nifedipine (1 µmol/l for 15 min) to the cells when the enhancement in [Ca2+]i was elicited with DPDPE.
Effect of
-opioid agonist on epinephrine release.
After 72 h in culture, ICA cells were switched to 500 µl of Tyrode solution and incubated for 1 h. The sample solution was collected for basal epinephrine release. The culture wells were then treated for 30 min with 500 µl Tyrode solution with or without DPDPE (100 nmol/l). Conditioned solutions were collected at the end of 30 min, and the culture wells were washed three times. After wells were washed, 500 µl of Tyrode solution were reintroduced to the culture wells for 1 h (recovery phase). The samples were recollected, and the cells were lysed for protein quantification.
In vivo myocardial ischemia study.
The rat myocardial infarct model has been described previously (30). Briefly, following anesthesia and ventilation support, the chest is opened and the left coronary artery is encircled with a suture and ligated for 30 min. The snare is then released, and the myocardium is reperfused for 4 h. The left coronary artery is then reoccluded and Evans blue dye injected into the right ventricle. The LV is sliced into 6 to 7 sections. Tissue slices are incubated for 10 min in 1% 2,3,5-triphenyltetrazolium chloride (TTC), fixed in 10% formaldehyde, and photographed to identify the ischemic myocardium at risk (uncolored by the blue dye), the necrotic zone (unstained by TTC), and the nonischemic zones (colored by blue dye). The areas of ischemia and necrosis in each slice are determined by planimetry, converted into percentages of the whole for each slice, and multiplied by the weight of the slice. The examiner who analyzed infarct size was blinded to treatment assignment. To demonstrate
-opioid-initiated cardioprotection, DPDPE (100 µg/kg) was intravenously infused 30 min before the coronary artery occlusion (n = 9 rats). To determine whether the infarct size-limiting effect of DPDPE depended on endogenous epinephrine, the nonselective AR antagonist labetalol (2 mg/kg) was intravenously infused over 30 min, followed by DPDPE at 30 min before the coronary artery occlusion (n = 9 rats). To determine the relative contribution of
2-AR in
-opioid-initiated infarct size reduction, the effect of DPDPE in the presence of the
2-AR antagonist ICI-118551 (ICI, 1 mg/kg) was tested (n = 9 rats). ICI was intravenously infused over 30 min, followed by DPDPE infusion at 30 min before coronary artery occlusion. The effects of saline, labetalol, or ICI alone on infarct size were determined (n = 8 rats/group). The specificity of DPDPE was tested in the presence of the DOR antagonist NTI (200 µg/kg, n = 5 rats).
In vitro-simulated ischemia in ventricular cardiocytes.
To confirm the role of ICA cells in
-opioid-initiated cardioprotection in vitro, we utilized a simulated ischemia-reperfusion model (18) of adult rat ICA cell-ventricular myocyte coculture. This model allowed us to determine ICA cell-ventricular myocyte interactions in the absence of sympathetic nerve innervation. ICA cell-myocyte coculture was prepared by directly plating the dissociated ventricular cardiocytes to 24-well plates for 24 h without undergoing magnetic ICA cell purification. Ischemia was induced by layering mineral oil (0.5 ml for 2 h) over a thin film of hypoxic media (prebubbled with N2 gas) covering the cells, followed by 60 min of reperfusion in normal Tyrode solution. The treatments included 1) saline, 2) labetalol (1 µmol/l), 3) ICI (1 µmol/l), 4) NTI (10 µmol/l), 5) DPDPE (100 nmol/l), 6) labetalol + DPDPE, 7) ICI + DPDPE, and 8) NTI + DPDPE. Saline, labetalol, ICI, NTI, and DPDPE were applied individually to the cell culture for 30 min before ischemia. For drug combination treatment, labetalol, ICI, and NTI were added individually 10 min before the application of DPDPE. Finally, we tested whether DPDPE exerted any myocyte protection in the absence of cocultured ICA cells. The ICA cell-free myocytes were prepared by depleting the ICA cells from dissociated mixed ventricular cardiocytes with the magnetic purification method. This ICA cell depletion procedure was repeated four times to ensure maximum effect. Myocyte death was quantified by counting trypan blue-stained cells and expressed as a percentage of the total cells counted. All experiments (n = 5 rats/group) were carried out at 37°C. The examiner who counted the cells was blinded to the treatment assignment.
Data analysis.
For semiquantification of ICA cells in human LV tissue, ICA cells were defined as cells displaying TH immunofluorescence. Those cardiocytes with nuclei stained with DAPI (blue fluorescence) without TH signal were classified as non-ICA cells. The percentage of ICA/non-ICA cells was counted from 20 consecutive views (x100 lens) for each slide. At least three slides were examined for each LV sample. Data are presented as means ± SD. For quantification of [Ca2+]i transients, the firing frequency of [Ca2+]i spikes of ICA cells was determined based on an average of the last 5-min duration for the baseline and each drug treatment. The outcome measure was the number of spikes per minute. ANOVA was used for analyzing changes in [Ca2+]i transients, epinephrine release, and myocardial ischemia studies with the Bonferroni adjustment for intragroup comparisons. Paired t-test was used to determine the effects of NTI and nifedipine on DPDPE-induced [Ca2+]i changes. The significance level of
is 0.05.
| RESULTS |
|---|
|
|
|---|
ICA cells were identified in human hearts (Fig. 1). In situ expression of TH mRNA was identified in ICA cells but not in the sympathetic nerve endings (Fig. 2). ICA cells expressed TH, PNMT, and PGP 9.5 immunoreactivity (Fig. 2) and were distributed diffusely throughout the LV. Perivascular distribution was a common feature. Abundant ICA cells were also observed in the smooth muscle layer of epicardial coronary artery (Fig. 1E). The density of ICA cells varied considerably, constituting as many as 20% to as little as 0% of total cardiocytes/microscopic view (x100 lens) with an average of 7 ± 2%. ICA cells were identified in the SA (Fig. 1G) and AV nodal regions (data not shown).
|
|
DOR immunoreactivity was exclusively colocalized with TH in human and rat ICA cells (Figs. 3 and 4). Ventricular myocytes expressed myosin heavy chain immunoreactivity (Fig. 4G). Over 90% of isolated ICA cells coexpressed TH and DOR immunoreactivity, yielding extremely high ICA cell purity. DOR-positive ICA cells constituted
13 ± 4% of total rat ventricular cardiocytes based on the cell counting. No DOR immunoreactivity was identified in human and rat ventricular myocytes in situ and in vitro. No immunoreactivity was detected in IgG control slides. The control slides for double labeling that was stained with only streptavidin-Alexa Fluor 488 after step 2 showed no cross-reactivity to DOR, confirming immunohistochemical specificity of DOR expression in ICA cells. Western blot analysis detected DOR protein in rat ICA cell isolates, which was identical to that found in rat brain. No DOR protein was detected in ventricular myocytes in the absence of ICA cells following ICA cell depletion (Fig. 4H).
|
|
Application of DPDPE to ICA cells increased [Ca2+]i transient spikes (n = 11 cells) in a concentration-dependent manner (Fig. 5A). Increases in [Ca2+]i transients were sometimes preceded by a brief quiescent phase. DPDPE (100 nmol/l) did not change [Ca2+]i transient activity significantly in the presence of the DOR antagonist NTI (10 µmol/l, n = 4, P < 0.01). DPDPE-enhanced [Ca2+]i transients were abolished in the presence of nifedipine (1 µmol/l, n = 4, P < 0.01). Basal endogenous epinephrine release was detected from isolated ICA cells in culture. Application of DPDPE (100 nmol/l) increased epinephrine release 2.4-fold (P < 0.01, n = 4 duplicates from 8 rats, Fig. 5B). Norepinephrine was not detected during the baseline, treatment with DPDPE, or the recovery phase.
|
-Opioid-Initiated Myocardial and Myocyte Protection
Intravenous infusion of DPDPE before coronary artery occlusion reduced LV infarct size by 54 ± 15% compared with that in control (Fig. 6A). Infusion of labetalol before ischemia tended to increase (statistically insignificant) the infarct size compared with control. DPDPE-initiated infarct size reduction was markedly attenuated in the rats pretreated with labetalol. The
2-AR blocker ICI alone significantly increased infarct size compared with control. The infarct size following DPDPE infusion in the presence of labetalol or ICI was not significantly different than those treated with saline infusion. There was no significant difference in body and LV weight among animal groups. There was a small reduction in arterial blood pressure in the rats following labetalol infusion.
|
| DISCUSSION |
|---|
|
|
|---|
-opioid stimulation. Activation of ICA cells enhances endogenous epinephrine release and
2-AR stimulation that is essential for the
-opioid-initiated myocardial protection against ischemia. ICA Cells in the Human Heart
Human ventricular ICA cells express TH mRNA that encodes the rate-limiting enzyme for epinephrine biosynthesis. The abundant ICA cells present in the SA and AV nodes are consistent with an animal study reporting an intimate anatomic relationship between ICA cells and cardiac pacemaker and conduction systems (5), suggesting a regulatory role of ICA cells in impulse generation and conduction in human heart. The presence of ICA cells in transplanted human LV myocardium (Fig. 1H) is consistent with the concept that ICA cells may provide an alternative adrenergic supply in the compromised sympathetic innervation (8). This notion has been substantiated by the finding that the epinephrine-producing gene PNMT mRNA is upregulated in ventricular tissue of transplanted human hearts (6).
Cellular Origin of DOR
The present study has located DOR immunoreactivity exclusively to the ICA cells in human and rat hearts. Recently, Patel et al. (18) reported DOR immunoreactivity in the T-tubules of isolated rat ventricular myocytes in culture. However, the lack of corroborative immunohistochemical evidence of in situ DOR immunoreactivity in rat myocardial tissue section in that study (18) has made their claim inconclusive. The unequivocal in situ and in vitro immunohistochemical evidence of DOR expression by ICA cells (Figs. 3 and 4) is consistent with our Western blot analysis demonstrating abundant DOR protein expression by ICA cells but not myocytes (Fig. 4H).
DOR Signaling in ICA Cells
Ca2+ influx is a fundamental mechanism for neurotransmitter release from neuroendocrine cells (15). Increase in [Ca2+]i transients in ICA cells following
-opioid stimulation was mediated through Ca2+ influx via L-type Ca2+ channels, since the increase in [Ca2+]i was abolished in the presence nifedipine (Fig. 5). The cAMP-PKA pathway is the best-characterized mechanism underlying opioid signaling in catecholaminergic neurons in the locus ceruleus (12). Opioid exposure to these neurons upregulates cAMP pathway, resulting in increased Ca2+ influx (12, 16). DOR stimulation also activates cAMP pathway in olfactory bulb neurons (17) and Chinese hamster ovary cell line expressing human DOR (21). PKA phosphorylates L-type Ca2+ channels and enhances Ca2+ influx (26). The dependence of
-opioid-enhanced [Ca2+]i transients on L-type Ca2+ channels in ICA cells suggests an involvement of the cAMP-PKA pathway.
Mechanism Involved in
-Opioid-Initiated Cardioprotection
We have demonstrated that
-opioid-initiated cardioprotection depends on ICA cells activation. Unlike sympathetic nerve endings that release norepinephrine (a potent
1-AR agonist with negligible
2-AR effect), ICA cells release epinephrine that is a potent endogenous
2-AR agonist. This is of particular importance since
2-AR is essential in mediating cardioprotection against ischemia (14, 25), presumably via its antiapoptotic effect (3, 32). The increased infarct size in the presence of
2-AR blockade compared with saline or labetalol (Fig. 6A) is probably due to a fact that selective
2-AR blockade creates unopposed
1-AR stimulation as a result of sympathetic nervous activation. Myocardial
1-AR stimulation exerts detrimental proapoptotic effect (3, 32), hence, increased infarct size. It appears that
2-AR blockade did not completely abolish DPDPE-initiated infarct size-limiting effect in vivo, although this incompleteness is not statistically significant. Nevertheless, this incomplete infarct size-limiting effect is unlikely due to a direct
-opioid effect on myocytes, since DPDPE-initiated myocyte protection is lacking in the presence of
2-AR blockade in ICA cell-myocyte coculture or in myocytes in the absence of cocultured ICA cells (Fig. 6, B and C). It is well known that systemic
-opioid infusion elicits complex neuronal responses, resulting in secondary cardiovascular effects via nonadrenergic pathways. For instance,
-opioid stimulation of sensory neurons in dorsal root ganglia increases the release of calcitonin gene-related peptide (1), a neuropeptide exerting an infarct size-limiting effect during ischemia-reperfusion (29). It might also be possible that enhanced epinephrine release from ICA cells might activate
-AR located on the cardiac afferent nerve endings, eliciting cardiocardiac reflex, resulting in secondary cardiac effects (24). Such secondary effects were not present in the ICA cell-ventricular myocyte coculture model, allowing direct assessment of
-opioid signaling mechanisms in ICA cells. It is interesting to note that in the absence of cocultured ICA cells,
95% myocytes died during ischemia-reperfusion, suggesting a crucial role of ICA cells in maintaining myocyte vitality during hypoxia. This finding is consistent with a murine study that a targeted disruption of TH gene causes lethal cardiomyopathy and fetal demise in the uterus where the hypoxic distress is frequently encountered (31).
Limitations of the Study
We acknowledge several limitations in the present study. The 7% of ICA cells identified in human LV samples is relatively low compared with 13% in rat LV samples. Since the human samples were largely derived from diseased hearts with end-stage heart failure, it might not truly represent the percentage of ICA cells in the normal human heart. The cellular mechanisms underlying
-opioid regulation of ICA cell [Ca2+]i transients were not explored. Although DPDPE induces robust epinephrine release from isolated ICA cells in vitro, we cannot totally exclude the possibility that endogenous epinephrine derived from the sources other than ICA cells might also contribute, in part, to
2-AR-mediated cardioprotection in vivo. Finally, the signaling pathways of
2-AR-mediated cardioprotection by epinephrine were not further characterized. We presumed that pertussis toxin-sensitive Gi pathway was likely involved in
2-AR-mediated cardioprotection as proposed previously (3, 32).
In conclusion, we have localized DOR expression in ICA cells in human and rat hearts.
-Opioid stimulation of ICA cells enhances endogenous epinephrine liberation, resulting in myocardial
2-AR-mediated cardioprotection against ischemia. This study has demonstrated a novel
-opioid signaling and its cardioprotective mechanism that is dependent on neuroendocrine function of ICA cells.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
1- and
2-adrenergic receptors on cardiac myocyte apoptosis: role of a pertussis toxin-sensitive G protein. Circulation 100: 22102212, 1999.
1-opioid receptor agonists is mediated by iNOS. Am J Physiol Heart Circ Physiol 289: H2251H2257, 2005.
-opioid receptor agonists on infarct size reduction in swine. Am J Physiol Heart Circ Physiol 282: H1953H1960, 2002.
2-adrenergic signaling in adult mouse cardiac myocytes. Proc Natl Acad Sci USA 98: 16071612, 2001.This article has been cited by other articles:
![]() |
M.-H. Huang, V. Nguyen, Y. Wu, S. Rastogi, C. Y. Lui, Y. Birnbaum, H.-Q. Wang, D. L. Ware, M. Chauhan, N. Garg, et al. Reducing ischaemia/reperfusion injury through {delta}-opioid-regulated intrinsic cardiac adrenergic cells: adrenopeptidergic co-signalling Cardiovasc Res, December 1, 2009; 84(3): 452 - 460. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. H. Deo, M. A. Barlow, L. Gonzalez, D. Yoshishige, and J. L. Caffrey Cholinergic location of {delta}-opioid receptors in canine atria and SA node Am J Physiol Heart Circ Physiol, February 1, 2008; 294(2): H829 - H838. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |