AJP - Heart AJP: Advances in Physiology Education
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Heart Circ Physiol 293: H440-H447, 2007. First published March 16, 2007; doi:10.1152/ajpheart.01374.2006
0363-6135/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/1/H440    most recent
01374.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Corteling, R. L.
Right arrow Articles by Welsh, D. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Corteling, R. L.
Right arrow Articles by Welsh, D. G.

The functional consequence of RhoA knockdown by RNA interference in rat cerebral arteries

Randolph L. Corteling,1 Suzanne E. Brett,1 Hao Yin,2 Xi-Long Zheng,2 Michael P. Walsh,2 and Donald G. Welsh1

Departments of 1Physiology and Biophysics and 2Biochemistry and Molecular Biology, University of Calgary, Calgary, Alberta, Canada

Submitted 16 December 2006 ; accepted in final form 13 March 2007


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Uridine triphosphate (UTP) constricts cerebral arteries by activating transduction pathways that increase cytosolic [Ca2+] and myofilament Ca2+ sensitivity. The signaling proteins that comprise these pathways remain uncertain with recent studies implicating a role for several G proteins. To start clarifying which G proteins enable UTP-induced vasoconstriction, a small interfering RNA (siRNA) approach was developed to knock down specified targets in rat cerebral arteries. siRNA directed against Gq and RhoA was introduced into isolated cerebral arteries using reverse permeabilization. Following a defined period of organ culture, arteries were assayed for contractile function, mRNA levels, and protein expression. Targeted siRNA reduced RhoA or Gq mRNA expression by 60–70%, which correlated with a reduction in RhoA but not Gq protein expression. UTP-induced constriction was abolished in RhoA-depleted arteries, but this was not due to a reduction in myosin light chain phosphorylation. UTP-induced actin polymerization was attenuated in RhoA-depleted arteries, which would explain the loss of agonist-induced constriction. In summary, this study illustrates that siRNA approaches can be effectively used on intact arteries to induce targeted knockdown given that the protein turnover rate is sufficiently high. It also demonstrates that the principal role of RhoA in agonist-induced constriction is to facilitate the formation of F-actin, the physical structure to which phosphorylated myosin binds to elicit arterial constriction.

arterial tone; G proteins; F/G-actin; myosin light chain phosphorylation; small interfering ribonucleic acid

PYRIMIDINE NUCLEOTIDES, such as uridine triphosphate (UTP), are important signaling molecules released from cells that are part of, or pass through, the lumen of resistance arteries (22, 23, 31). When secreted in close proximity to arterial smooth muscle cells, these agents bind to P2Y receptors and activate a transduction sequence that elicits sustained constriction (17, 25, 27). The signaling proteins enabling pyrimidine nucleotides to increase cytosolic [Ca2+] and myofilament Ca2+ sensitivity remain unresolved (18, 25, 38). For example, based on the induction of Ca2+ waves, some have asserted that UTP-sensitive P2Y receptors must be coupled to the Gq/11 {alpha}-subunits within heteromeric G protein complexes that activate phospholipase C-beta and augment inositol 1,4,5-trisphosphate production (18, 19). Others, however, noting the attenuating effects of Rho-kinase inhibitors, suggest that UTP mobilizes RhoA, a monomeric G protein indirectly coupled to P2Y receptors via G12/13 (25). One means of assessing the importance of specified components of such signaling pathways is to develop an experimental approach in which they can be selectively downregulated within the confines of the intact artery. In theory, such downregulation could be achieved through the use of a RNA-based approach (4, 28, 39).

Previous vascular studies have shown that RNA-based approaches such as antisense oligonucleotides can substantially reduce the expression of ion channels and cytoskeletal proteins in intact resistance arteries (28, 29, 39). Although effective, off-target effects have been a consistent concern given that anti-sense constructs are typically introduced to tissues at micromolar concentrations. As such, interest has developed in alternative strategies including the use of small interfering RNA (siRNA) to decrease target protein expression (10, 11). RNA interference is a relatively new approach whereby small segments of double-stranded RNA are used to degrade the mRNA required for protein translation (5, 14). This degradation is controlled by an endogenous silencing complex, and culture studies have shown that nanomolar siRNA concentrations are sufficient to induce protein knockdown (14, 35). Although viewed as a valuable tool to manipulate culture systems, RNA interference has been rarely employed in a quantitative manner to explore the integrative basis of arterial tone development (33).

This study utilized a siRNA approach to knock down specific G proteins and to examine their role in UTP-mediated vasoconstriction. Briefly, siRNA targeted against Gq or RhoA was introduced into cerebral arteries using reverse permeabilization. Following 4 to 5 days of organ culture, real-time PCR analysis confirmed that this approach effectively reduced Gq and RhoA mRNA expression. These mRNA reductions coincided with a decrease in RhoA but not Gq protein expression. RhoA-depleted arteries did not constrict to UTP; however, myosin light chain phosphorylation was unaffected by RhoA knockdown. Subsequent experiments revealed that the nonresponsiveness to UTP resulted from the inability of RhoA-depleted vessels to polymerize actin. Cumulatively, our findings demonstrate that siRNA approaches can be effectively employed on intact arteries to knock down signaling proteins. They also demonstrate that in the cerebral circulation, the principal role of RhoA in agonist-induced constriction is to regulate the formation of F-actin, a filament structure required to support contraction.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animal procedure and tissue preparation. All procedures were approved by the University of Calgary Animal Care Committee. Briefly, female Sprague-Dawley rats (10–12 wk of age) were euthanized by CO2 asphyxiation. The brain was removed and placed in cold phosphate-buffered saline containing (in mM) 138 NaCl, 3 KCl, 10 Na2HPO4, 2 NaH2PO4, 5 glucose, 0.1 CaCl2, and 0.1 MgSO4 (pH 7.4). Posterior, middle, and anterior cerebral arteries were dissected free of the surrounding tissue and cut into 2- to 3-mm segments. All arteries were denuded of the endothelium by passing air bubbles through the lumen of the vessel for 2 min.

The introduction of siRNA. Reverse permeabilization was used to introduce siRNA into rat cerebral arteries (24, 39). In brief, isolated arteries were transferred to culture dishes and exposed to three successive solutions (4°C) containing (in mM) 1) 10 EGTA, 120 KCl, 5 ATP, 2 MgCl2, 20 TES (pH 6.8; 20 min); 2) 120 KCl, 5 ATP, 2 MgCl2, and 20 TES and 20 nM siRNA (pH 6.8; 3 h); and 3) 120 KCl, 5 ATP, 10 MgCl2, and 20 TES and 20 nM siRNA (pH 6.8; 30 min). Subsequently, cerebral arteries were bathed in a fourth solution containing (in mM) 140 NaCl, 5 KCl, 10 MgCl2, 5 glucose, and 2 MOPS (pH 7.1, 22°C) in which [Ca2+] was gradually increased from 0.01 to 0.1 to 1.8 mM every 15 min. Unpressurized vessels were then placed in DMEM/F-12 culture medium (supplemented with 1 mM L-glutamine, 50 U/ml penicillin, and 50 µg/ml streptomycin) and maintained in an incubator (37°C, 21% O2-5% CO2-74% N2) for 1–5 days (29, 39). A subconfluent population of cultured aortic smooth muscle cells was also transfected (Lipofectamine 2000), in accordance with standard working procedures, with Gq-targeted siRNA (20 nM) to address whether this RNA construct was capable of inducing protein knockdown (43).

To assess siRNA uptake, nonselective siRNA was conjugated to fluorescein isothiocyanate (FITC) and introduced into arteries isolated from two rats. Smooth muscle cells from these two groups of arteries were subsequently isolated (25) and placed on a glass slide. With the use of a fluorescence microscope, ~75 cells per group were counted and categorized according to the FITC label. Smooth muscle cells had to maintain an elongated shape to be included in the analysis.

Arterial diameter. Cerebral arteries were mounted in an arteriograph and superfused with warm (37°C) physiological salt solution containing (in mM) 119 NaCl, 4.7 KCl, 20 NaHCO3, 1.7 KH2PO4, 1.2 MgSO4, 1.6 CaCl2, and 10 glucose (pH 7.4) in 21% O2-5% CO2-74% N2. Under resting conditions, arteries were maintained in a hyperpolarized state by setting intravascular pressure to 15 mmHg (38). Arterial responsiveness to intravascular pressure, extracellular K+, UTP, and microcystin-LR (Chemicon, Temecula, CA), a cell-permeant peptide inhibitor of myosin light chain phosphatase, were monitored with an automated video dimension analyzer system (IonOptix, Milton, MA).

mRNA analysis. Real-time PCR was used to quantify Gq, RhoA, and beta-actin mRNA in cerebral arteries that are primarily but not exclusively comprised of smooth muscle cells. Briefly, arterial segments from one rat brain were isolated, exposed to siRNA, and organ cultured for 0–5 days. Two arterial segments were sampled per day and placed in RNase/DNase-free collection tubes before flash freezing in liquid N2. After total RNA extraction (RNeasy mini kit with DNase treatment; Qiagen, Valencia, CA), first-strand cDNA was synthesized using a RT-Sensiscript kit (Qiagen). One microliter of cDNA was subsequently used as a template in a real-time PC reaction containing SYBR green (Qiagen), forward and reverse primers, and water (total reaction volume, 25 µl). The PC reaction was hot started (95°C for 15 min) and underwent 40 cycles of 94°C for 15 s, 60.1°C for 30 s, and 72°C for 30 s. Samples were then exposed to a final extension period at 72°C for 10 min. Gq and RhoA mRNA levels were standardized to beta-actin and then expressed relative to freshly isolated tissue (control). Forward (F) and reverse (R) primers were as follows: Gq (F) 5'CGAGAGGTTGATGTGGAGAAGG3', (R) 5'CGAGAGGTTGATGTGGAGAAGG3'; RhoA (F) 5'AAGGACCAGTTCCCAGAGGT3', (R) 5'TGTCCAGCTGTGTCCCATAA3'; and beta-actin (F) 5'TATGAGGGTTACGCGCTCCC3', (R) 5'ACGCTCGGTCAGGATCTTCA3'. Agarose gel electrophoresis and DNA sequencing were used to confirm product purity and identity. Primer efficiency was calculated to be 92.2%, 91.0%, and 90.1% for Gq, RhoA, and beta-actin, respectively.

Protein analysis. Western blot analysis was used to detect Gq, RhoA, calponin, and caldesmon protein expression. Arterial segments from two rat brains were collected, exposed to nonselective or targeted siRNA, and organ cultured for 4 to 5 days. Arteries were then sampled, placed in 100 µl of lysis buffer [containing 0.1 M SDS, 1% Triton X-100, 10 mM Tris·HCl (pH 8), 150 mM NaCl, and 0.05% Tween 20], and centrifuged at 12,000 rpm for 10 min. The supernatant was placed in a clean tube, assayed for total protein, and stored at –20°C for up to 1 wk. Samples were prepared for electrophoresis by adding 60 µl of supernatant to 20 µl of 4x sample buffer and 10 mM DTT. After samples were heated (10 min, 90°C), 1–100 µg of protein were loaded per well and run on a 10% polyacrylamide gel. Proteins were transferred to polyvinylidene difluoride membranes and probed overnight (4°C) with rabbit anti-Gq (1:2,000; Santa Cruz Biotechnology, Santa Cruz, CA), rabbit anti-RhoA (1:2,000; Santa Cruz), rabbit anti-calponin (1:10,000), or rabbit anti-caldesmon (1:100,000) polyclonal antibodies. Membranes were then washed and probed with horseradish peroxidase (HRP)-conjugated anti-rabbit secondary antibody (1:1,000; Chemicon) for 2 h (22°C). Following a second set of washes, immunoreactive bands were detected by chemiluminescence (Pierce Biochemicals, Rockford, IL). Gq and RhoA protein levels were standardized to beta-actin and then expressed relative to freshly isolated tissue (control) or to arteries treated with nonselective siRNA. Because of the small amount of protein (1 µg) loaded per lane, calponin as well as the heavy (h) and light (l) isoforms of caldesmon were standardized to total protein and then relatively expressed.

Myosin light chain phosphorylation. Arterial segments from one rat brain were either freshly collected or exposed to nonselective or RhoA-targeted siRNA for 4 days of organ culture. Arteries were then subdivided, with one of the two groups being treated with UTP (30 µM, 10 min). Arterial segments were rapidly frozen in a slurry of solid CO2 with 10% (wt/vol) trichloroacetic acid-10 mM DTT in acetone. Tissues were subsequently washed three times (10 mM DTT in acetone), lyophilized overnight, and stored at –80°C. Protein was extracted for 2 h (22°C) in 20 µl of a buffer containing 6 M urea, 200 mM Tris, 220 mM glycine, 10 mM DTT, 10 mM EGTA, 1 mM EDTA, 1 mM PMSF, 0.6 M KI, and 0.1% (wt/vol) bromophenol blue. Entire samples were then filtered (0.45 µm spin filter) and loaded on a urea/glycerol mini gel, and myosin light chains were separated as previously described (37). Protein was transferred to nitrocellulose and probed overnight (4°C) with rabbit anti-myosin light chain 20 antibody (1:500; Santa Cruz). Membranes were washed three times and subsequently probed for 1 h (22°C) with HRP-conjugated anti-rabbit secondary antibody (1:5,000; Chemicon). Following a second set of washes, immunoreactive bands were detected by chemiluminescence.

Actin polymerization. Arterial segments from one rat brain were exposed to either nonselective or RhoA-targeted siRNA for 4 days of organ culture. Arteries were then subdivided and placed in an unpressurized state in physiological salt solution (37°C, 21% O2-5% CO2-74% N2) that did or did not contain UTP (30 µM, 10 min). G- and F-actin were detected in cerebral arteries using a commercially available kit (Cytoskeleton, Denver, CO). Briefly, arteries were homogenized in 200 µl of lysis buffer (containing 50 mM KCl, 5 mM MgCl2, 5 mM EGTA, 50 mM PIPES, 100 µM ATP, protease inhibitor cocktail, 5% glycerol, 0.1% Nonidet P-40, 0.1% Triton X-100, 0.1% Tween 20, 0.1% 2-mercaptoethanol, and 0.001% antifoam C, pH 6.9) for 30 min at 37°C. Following centrifugation (2,000 rpm, 5 min), the supernatant was transferred and centrifuged at 100,000 g (60 min, 37°C) to pellet F-actin. The supernatant containing G-actin was placed on ice, whereas the pellet containing F-actin was resuspended in 200 µl of ice-cold water containing 10 µM cytochalasin D. The supernatant and pellet samples were then diluted in 4x SDS sample buffer and heated to 95°C for 2 min. Equal volumes of each sample (40 µl) were loaded and separated on a 12% polyacrylamide gel. Proteins were transferred to polyvinylidene difluoride membranes before being probed with rabbit anti-actin polyclonal antibody and HRP-conjugated anti-rabbit secondary antibody. Proteins were visualized by chemiluminescence.

Chemicals, drugs, and enzymes. Antibodies, buffer reagents, and drugs were obtained from Sigma Biochemical (St. Louis, MO) unless otherwise stated. siRNA against Gq (sense 5'CAAUAAGGCUCAUGCACAA3', anti-sense 5'UUGUGCAUGAGCCUUAUUG3') and RhoA (sense 5'GAAGUCAAGCAUUUCUGUCTT3', anti-sense 5'GACAGAAAUGCUUGACUUCTT3') were commercially manufactured by Qiagen. Nonselective siRNA was obtained from Invitrogen (Burlington, ON, Canada).

Statistical analysis. To calculate EC50 values, data were logarithmically transformed and fitted on an individual basis to a sigmoidal concentration-response curve. To statistically compare the effects of a given treatment on mRNA, protein, or arterial diameter, a series of paired or unpaired t-tests were performed. P values ≤0.05 were considered statistically significant. Data are expressed as means ± SE, and n represents the number of vessels or times an experiment was performed. Vessels from any given animal were used only once in a specified experiment.


   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
Control experiments and siRNA. A reverse permeabilization procedure was used to introduce siRNA into cerebral arterial smooth muscle. As demonstrated in Fig. 1A, this process enabled the influx of FITC-labeled nonselective siRNA (20 nM) into smooth muscle cells isolated from permeabilized arteries. Uptake was apparent in at least 77% of smooth muscle cells sampled (108 of 139 cells). Reverse permeabilized arteries were subsequently organ cultured to provide the required time to induce protein knockdown. Functional experiments revealed that the combination of reverse permeabilization and organ culture did not alter cerebral arterial responsiveness to UTP, a potent vasoconstrictor agonist (Fig. 1B).


Figure 1
View larger version (27K):
[in this window]
[in a new window]

  		Fig. 1. Cerebral arteries and reverse permeabilization. A: uptake of FITC-labeled nonselective (NS) small interfering RNA (siRNA) into smooth muscle cells enzymatically isolated from cerebral arteries that were or were not reversibly permeabilized. Scale bar = 25 µm. B: summary data of UTP-induced constriction of cerebral arteries that were freshly isolated (control: EC50 = 1.2 ± 0.8 µM; resting and minimum diameter, 243 ± 5 and 127 ± 3 µm; n = 7 vessels) or exposed to nonselective siRNA and 4 (EC50 = 2.9 ± 0.8 µM; resting and minimum diameter, 241 ± 10 and 146 ± 7 µm; n = 6 vessels) or 5 (EC50 = 0.8 ± 0.7 µM; resting and minimum diameter, 246 ± 8 and 145 ± 5 µm; n = 6 vessels) days of organ culture. To calculate EC50 values, data were logarithmically transformed and fitted on an individual basis to a sigmoidal concentration-response curve.

 
Gq knockdown. Nonselective or Gq-targeted siRNA was introduced into cerebral arteries that are primarily but not exclusively composed of smooth muscle cells. Real-time PCR was subsequently used to monitor mRNA levels over a 5-day period of organ culture. When compared with the nonselective construct, Gq-targeted siRNA induced substantial mRNA knockdown within the first 3 days of organ culture (Fig. 2A). This ~65% reduction was maintained in organ-cultured arteries for at least 5 days. Despite the sizable mRNA knockdown, Western blot analysis revealed no significant change in Gq protein expression after 5 days of organ culture (Fig. 2B). Similar null results were obtained in arteries sampled after 4 or 6 days of organ culture (n = 2; data not shown). As expected, therefore, the UTP responsiveness of cerebral arteries treated with Gq-targeted siRNA did not decrease (Fig. 2C). Indeed, functional analysis revealed that, when compared with the nonselective construct, arteries treated with Gq-targeted siRNA showed a small but significant increase in UTP sensitivity. This slight change most likely reflects subtle animal-to-animal variability in UTP responsiveness. Control experiments confirmed that Gq-targeted siRNA could induce protein knockdown if transfected into cultured smooth muscle cells (Fig. 3).


Figure 2
View larger version (24K):
[in this window]
[in a new window]

  		Fig. 2. The introduction of NS or Gq-targeted siRNA into intact cerebral arteries. A: the effects of NS (n = 4 experiments) or Gq-targeted (n = 4 experiments) siRNA on Gq mRNA expression following 0–5 days of organ culture. mRNA values were expressed relative to freshly isolated tissue. *Significant difference from NS siRNA. B: the effect of NS (n = 3 experiments) or Gq-targeted (n = 3 experiments) siRNA on Gq protein expression following 5 days of organ culture. Protein values were expressed relative to freshly isolated tissue. C: UTP-induced constriction of cerebral arteries exposed to NS (EC50 = 1.3 ± 0.8 µM, resting and minimum diameter, 226 ± 4 and 137 ± 6 µm; n = 6 vessels) or Gq-targeted (EC50 = 0.4 ± 0.8 µM, resting and minimum diameter, 237 ± 9 and 131 ± 11 µm; n = 6 vessels) siRNA followed by 5 days of organ culture. The EC50 values for NS and Gq-targeted siRNA were significantly different from one another.

 

Figure 3
View larger version (19K):
[in this window]
[in a new window]

  		Fig. 3. Gq knockdown in cultured aortic smooth muscle cells. Western blot and densitometric analyses of Gq protein expression in cultured aortic smooth muscle cells transfected (Lipofectamine 2000) with NS (n = 3 experiments) or Gq-targeted (n = 3 experiments) siRNA are shown. Cells were sampled 2 days after transfection. Data were expressed relative to NS siRNA-treated samples. *Significant difference from NS siRNA.

 
RhoA knockdown. Despite the preceding findings, a second attempt was undertaken to induce G protein knockdown in an intact artery. Efforts focused on RhoA, a small monomeric G protein thought to be important for agonist-induced constriction and which cell culture studies have shown to be susceptible to siRNA knockdown (25, 40). When compared with the nonselective construct, siRNA targeted against RhoA substantially reduced RhoA mRNA expression by ~50% within the first 4 days of organ culture (Fig. 4A). RhoA protein expression decreased by ~80% within 4 days compared with tissues treated with nonselective siRNA (Fig. 4B). RhoA-depleted arteries did not constrict in response to UTP (Fig. 4C). Likewise, arteries exposed to RhoA-targeted siRNA but not the nonselective construct were unable to constrict to 55 mM extracellular K+ [arterial response (n = 4): RhoA-targeted siRNA, 1 ± 1 µm; nonselective siRNA, 78.9 ± 9.1 µm] or to 80 mmHg intravascular pressure [arterial response (n = 4): nonselective RhoA-targeted siRNA, 0 µm; and nonselective siRNA, 82 ± 4.9 µm].


Figure 4
View larger version (25K):
[in this window]
[in a new window]

  		Fig. 4. The introduction of NS or RhoA-targeted siRNA into intact cerebral arteries. A: the effects of NS (n = 4 experiments) or RhoA-targeted (n = 5 experiments) siRNA on RhoA mRNA expression following 0–5 days of organ culture. mRNA values were expressed relative to freshly isolated tissue. B: the effect of NS (n = 3 experiments) or RhoA-targeted (n = 3 experiments) siRNA on RhoA protein expression following 4 days of organ culture. Protein values were expressed relative to tissue exposed to NS siRNA. C: UTP-induced constriction in cerebral arteries exposed to NS (resting and minimum diameter, 226 ± 4 and 137 ± 6 µm; n = 6 vessels) or RhoA-targeted (resting and minimum diameter, 198 ± 11 and 194 ± 12 µm; n = 6 vessels) siRNA and 4 days of organ culture. *Significant difference from NS siRNA.

 
Mechanism of contractile suppression. Subsequent experiments explored the mechanism underlying the contractile loss of RhoA-depleted arteries. This monomeric G protein is known to inhibit myosin light chain phosphatase via Rho-kinase activation (21, 34, 36). Therefore, we examined the effect of RhoA depletion on UTP-induced myosin light chain phosphorylation. Irrespective of whether arteries were freshly isolated or exposed to nonselective or RhoA-targeted siRNA, UTP application (10 min) consistently phosphorylated 10–25% of the myosin light chain pool (Fig. 5, A and B). As such, the nonresponsive nature of RhoA-depleted vessels was not related to the phosphorylation status of the myosin light chains, the loss of Rho-kinase activation, or the myosin light chain phosphatase inhibition. This conclusion was further supported by functional observations showing that microcystin, an inhibitor of myosin light chain phosphatase activity, failed to induce vasoconstriction in RhoA-depleted cerebral arteries (Fig. 5C).


Figure 5
View larger version (21K):
[in this window]
[in a new window]

  		Fig. 5. Myosin light chain phosphorylation in cerebral arteries. A: UTP-induced myosin light chain phosphorylation in arteries that were freshly isolated (control) or exposed to NS or RhoA-targeted siRNA plus 4 days of organ culture. B: summary data of UTP-induced myosin light chain phosphorylation in arteries that were freshly isolated (control; n = 3 experiments) or exposed to NS (n = 3 experiments) or RhoA-targeted (n = 3 experiments) siRNA plus 4 days of organ culture. Data were expressed relative to the total myosin light chain pool. *Significant difference from non-UTP-treated arteries. C representative traces of microcystin (1 µM)-induced constriction of a cerebral artery exposed to NS or RhoA-targeted siRNA plus 4 days of organ culture. P, phosphorylated.

 
We speculated, therefore, that RhoA depletion was perhaps impairing F-actin formation, which is required to generate force (13, 16, 26, 30). In support of this mechanism, UTP application (10 min) induced F-actin formation in unpressurized arteries treated with nonselective but not RhoA-targeted siRNA (Fig. 6A). This absence of polymerization was further evident in Fig. 6B where UTP failed to augment the F-actin-to-G-actin ratio in RhoA-depleted arteries. In light of these findings, control experiments were subsequently undertaken to address whether RhoA-depleted arteries were perhaps dedifferentiating in organ culture (Fig. 7). Using h-caldesmon and calponin as markers for differentiated smooth muscle, we found that arteries treated with nonselective and RhoA-targeted siRNA expressed similar quantities of these two proteins. l-Caldesmon expression was, however, modestly higher in RhoA-depleted arteries compared with those treated with nonselective siRNA. Although relatively similar to one another from a differentiation perspective, siRNA-treated arteries did express substantially less calponin compared with freshly isolated tissue.


Figure 6
View larger version (26K):
[in this window]
[in a new window]

  		Fig. 6. Actin polymerization in cerebral arteries. A: Western blot illustrating the effect of UTP on G- and F-actin in arteries exposed to NS or RhoA-targeted siRNA plus 4 days of organ culture. B: summary data illustrating the effects of UTP on the F-actin-to-G-actin ratio in arteries exposed to NS (n = 3 experiments) or RhoA-targeted (n = 3 experiments) siRNA plus 4 days of organ culture. *Significant difference from NS siRNA. These experiments were performed on unpressurized arteries superfused with physiological salt solution.

 

Figure 7
View larger version (13K):
[in this window]
[in a new window]

  		Fig. 7. Thin filament protein expression in cerebral vessels. Densitometric analysis of caldesmon [light (l) and heavy (h) isoforms] and calponin expression in arteries that were freshly isolated (control; n = 3 experiments) or exposed to NS (n = 3 experiments) or RhoA-targeted (n = 3 experiments) siRNA plus 4 days of organ culture is shown. Data were expressed relative to freshly isolated tissue (control). *Significant difference from control. **Significant difference from NS siRNA.

 

   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
In this study, we utilized a siRNA approach to knock down signaling proteins with a view to defining their role in arterial tone development. We report that siRNA targeted against Gq or RhoA selectively reduced mRNA levels in intact cerebral arteries. These targeted reductions resulted in a decrease in RhoA but not Gq protein expression. Functional analysis revealed that RhoA-depleted arteries did not constrict to UTP, a loss of function that was not related to altered myosin light chain phosphorylation. The nonresponsive nature of RhoA-depleted arteries was found to be associated with an inability to polymerize actin. Broadly speaking, our observations highlight that siRNA approaches can induce effective protein knockdown in intact resistance arteries and that the resulting phenotype can further our understanding of how cell signaling regulates arterial tone development.

A siRNA approach for intact arteries. Pyrimidine nucleotides, such as uridine triphosphate (UTP), are important signaling molecules released from cells that are part of, or pass through, the lumen of resistance arteries (22, 23, 31). When secreted in close proximity to arterial smooth muscle cells, these agents bind to P2Y receptors and activate a transduction sequence that elicits sustained constriction (17, 25, 27). Previous studies have indirectly implicated several G protens in pyrimidine-induced vasoconstriction (18, 19, 25, 38), although a precise identification has proven difficult given the limited utility of existing pharmacological tools. It was within this context that this study considered an RNA-based approach to target and downregulate key G proteins. In intact arteries, RNA-based approaches have traditionally centered on the use of anti-sense oligodeoxynucleotides (28, 29, 39). Although effective at knocking down ion-channel subunits and cytoskeletal proteins, off-target effects have been a concern given that constructs are typically introduced at micromolar concentrations (28, 29, 39). Consequently, interest has grown in gene-silencing approaches in which nanomolar levels of siRNA could in theory induce a similar protein knockdown. Although a small number of studies have used RNA interference approaches to intact arteries, most have not provided quantitative evidence of tissue knockdown (10, 11).

This study utilized a siRNA approach to knock down key signaling proteins in intact cerebral arteries. Consistent with previous anti-sense investigations (28, 29, 39), initial control experiments confirmed that 1) reverse permeabilization facilitated siRNA uptake into cerebral arterial smooth muscle cells, and 2) nonselective siRNA treatment/organ culture did not alter cerebral arterial responsiveness to UTP (Fig. 1). siRNA targeted against Gq and RhoA was subsequently manufactured in accordance with previously established criteria (5, 14). Briefly, siRNA duplexes were 19 to 20 nucleotides in length, contained a GC content of ~50%, and retained a two nucleotide 3' overhang and a 5'-phosphate terminus. As illustrated in Figs. 2 and 4, targeted siRNA effectively diminished Gq and RhoA mRNA levels over a 5-day period of organ culture. Although real-time PCR measurements confirmed mRNA knockdown, Western blot analysis revealed that these reductions did not necessarily translate to the protein level. This is exemplified by our work with Gq, where targeted siRNA reduced mRNA levels by ~65% but had no effect on protein expression or agonist-induced constriction. Although ineffective in intact arteries, Gq-targeted siRNA did, however, reduce Gq protein expression in a proliferating line of cultured aortic smooth muscle cells (Fig. 3), suggesting that protein turnover is an important consideration with the application of a siRNA technique.

Unlike Gq, RhoA-targeted siRNA induced a reduction in both mRNA and protein expression in intact cerebral arteries (Fig. 4). The functional consequence of RhoA depletion was that these arteries no longer constricted to UTP or other vasoconstrictor stimuli. The dramatic nature of this arterial phenotype prompted further investigation of its mechanistic basis. RhoA is traditionally viewed as an important regulator of myofilament Ca2+ sensitivity. RhoA induces Ca2+ sensitization by activating Rho-kinase, which phosphorylates myosin phosphatase-targeting subunit 1 (the regulatory subunit of myosin light chain phosphatase), leading to the inhibition of phosphatase activity (21, 34, 36). If cerebral arterial phosphatase activity is tightly controlled by RhoA, then the ability of UTP to induce myosin light chain phosphorylation and elicit constriction should be reduced in RhoA-depleted arteries. In striking contrast to this expectation, UTP application phosphorylated nearly 25% of the myosin light chain pool in RhoA-depleted arteries (Fig. 5). This compares favorably to 10–20% of phosphorylation in arteries freshly isolated or treated with nonselective siRNA. These findings should not be overinterpreted to suggest that RhoA-induced Ca2+ sensitization does not play a role in the contractile response to UTP. Although depleted, the remaining RhoA may be sufficient to sustain myosin light chain phosphorylation. Furthermore, RhoA depletion may be affecting the rate of myosin light chain phosphorylation.

In addition to controlling Ca2+ sensitization, RhoA activity strongly influences actin polymerization (1, 13, 30, 41). This influence is the product of two signaling pathways that regulate the actin-binding proteins cofilin and profilin (1, 15, 41). Cofilin disassembles F-actin filaments from the pointed (–) end and is sequentially controlled by Rho-kinase and LIM-kinase (15). In contrast, profilin controls G-actin incorporation into the barbed (+) end, a process under the regulation of mDia (15). We speculated, therefore, that RhoA depletion may alter cofilin/profilin activity in a manner that promotes actin depolymerization. This would reduce the availability of actin filaments for binding of phosphorylated myosin and/or anchoring of actin filaments to the plasma membrane, leading to a reduction in force generation (16, 26). Consistent with this logic, UTP-induced actin polymerization was eliminated in arteries depleted of RhoA (Fig. 6). Notably, all siRNA-treated arteries expressed little F-actin under basal conditions. This contrasts markedly with freshly isolated arteries (2, 41, 42), suggesting that the physical/chemical environment (i.e., intravascular pressure) to which an artery is normally exposed is important for maintaining basal actin polymerization.

With RhoA-depleted arteries losing their ability to polymerize actin, it could be suggested that these vessels are susceptible to dedifferentiation (1, 15, 41). To address this possibility, we examined caldesmon and calponin, two thin filament proteins whose expression changes dramatically with the differentiation state of smooth muscle (7, 12, 20). With the exception of a modest upregulation of l-caldesmon, we found no evidence that RhoA-depleted arteries dedifferentiated more rapidly than arteries treated with nonselective siRNA (Fig. 7). Thus siRNA-treated arteries appear to share a common state of differentiation, an important consideration when comparing the functional consequences of protein knockdown. Although comparable with one another, the differentiation state of siRNA-treated arteries appeared to be modestly different from freshly isolated arteries, as evidenced by the reduced expression of calponin in siRNA-treated arteries.

Physiological implications. Our findings have important physiological implications to the general understanding of agonist-induced vasoconstriction. For example, it is routinely asserted that vasoconstrictor agonists like UTP elicit arterial constriction by activating a RhoA-dependent pathway that strongly inhibits myosin light chain phosphatase. This logic is often based on indirect measures such as the relaxing effects of Rho-kinase inhibitors (3, 6, 25, 32). Contrary to this general perception, our observations indicate that the involvement of RhoA in sensitizing the cerebral arterial myofilaments is not as clear as initially expected. This does not suggest that RhoA is unimportant in enhancing myosin light chain phosphorylation but that its principal role in agonist-induced constriction more likely centers on the formation and maintenance of actin filaments (16, 26). These findings broadly reinforce the views of Gunst and colleagues (26, 28, 42) who have stressed that cytoskeletal networks are not only dynamic but need to be carefully considered within the context of smooth muscle force generation. They are also consistent with the work of Gokina and colleagues (8, 9) who have noted that Rho-kinase inhibition and actin depolymerization elicit a similar pattern of response in myogenically active arteries.

In summary, this study implemented a siRNA approach to knock down key signaling proteins in intact resistance arteries. Findings revealed that although targeted siRNA consistently reduced mRNA levels, such changes did not necessarily translate into reduced protein expression. When the key regulatory protein RhoA did decrease, cerebral arteries lost their ability to constrict to vasoconstrictor stimuli. The noncontractile nature of RhoA-depleted arteries arose from their inability to polymerize F-actin, a finding that highlights the importance of cytoskeletal dynamics in active force development.


   GRANTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
This work was supported by an operating grant from the Canadian Institutes of Health Research.


   ACKNOWLEDGMENTS
 
We are grateful to Kevin D. Luykenaar for assistance. D. G. Welsh is a Senior Scholar with the Alberta Heritage Foundation for Medical Research (AHFMR) and holds a Canada Research Chair (tier 2) in Vascular Communication. R. L. Corteling is supported by a Scholarship from the Heart and Stroke Foundation of Canada. M. P. Walsh is an AHFMR Scientist and holds a Canada Research Chair (tier 1) in Vascular Smooth Muscle Research.


   FOOTNOTES
 

Address for reprint requests and other correspondence: D. G. Welsh, Dept. of Physiology and Biophysics, HMRB-G86, Heritage Medical Research Bldg., 3330 Hospital Dr. NW, Calgary, AL, T2N 4N1, Canada (e-mail: dwelsh{at}ucalgary.ca)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Albinsson S, Nordstrom I, Hellstrand P. Stretch of the vascular wall induces smooth muscle differentiation by promoting actin polymerization. J Biol Chem 279: 34849–34855, 2004.[Abstract/Free Full Text]
  2. Chen X, Pavlish K, Zhang HY, Benoit JN. Effects of chronic portal hypertension on agonist-induced actin polymerization in small mesenteric arteries. Am J Physiol Heart Circ Physiol 290: H1915–H1921, 2006.[Abstract/Free Full Text]
  3. Chrissobolis S, Sobey CG. Evidence that Rho-kinase activity contributes to cerebral vascular tone in vivo and is enhanced during chronic hypertension: comparison with protein kinase C. Circ Res 88: 774–779, 2001.[Abstract/Free Full Text]
  4. Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411: 494–498, 2001.[CrossRef][Medline]
  5. Elbashir SM, Martinez J, Patkaniowska A, Lendeckel W, Tuschl T. Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo lysate. EMBO J 20: 6877–6888, 2001.[CrossRef][ISI][Medline]
  6. Fu X, Gong MC, Jia T, Somlyo AV, Somlyo AP. The effects of the Rho-kinase inhibitor Y-27632 on arachidonic acid-, GTPgammaS-, and phorbol ester-induced Ca2+-sensitization of smooth muscle. FEBS Lett 440: 183–187, 1998.[CrossRef][ISI][Medline]
  7. Gimona M, Sparrow MP, Strasser P, Herzog M, Small JV. Calponin and SM 22 isoforms in avian and mammalian smooth muscle. Absence of phosphorylation in vivo. Eur J Biochem 205: 1067–1075, 1992.[ISI][Medline]
  8. Gokina NI, Osol G. Actin cytoskeletal modulation of pressure-induced depolarization and Ca2+ influx in cerebral arteries. Am J Physiol Heart Circ Physiol 282: H1410–H1420, 2002.[Abstract/Free Full Text]
  9. Gokina NI, Park KM, Elroy-Yaggy K, Osol G. Effects of Rho kinase inhibition on cerebral artery myogenic tone and reactivity. J Appl Physiol 98: 1940–1948, 2005.[Abstract/Free Full Text]
  10. Gonczi M, Szentandrassy N, Johnson IT, Heagerty AM, Weston AH. Investigation of the role of TASK-2 channels in rat pulmonary arteries; pharmacological and functional studies following RNA interference procedures. Br J Pharmacol 147: 496–505, 2006.[CrossRef][ISI][Medline]
  11. Gurney AM, Hunter E. The use of small interfering RNA to elucidate the activity and function of ion channel genes in an intact tissue. J Pharmacol Toxicol Methods 51: 253–262, 2005.[CrossRef][Medline]
  12. Halayko AJ, Salari H, Ma X, Stephens NL. Markers of airway smooth muscle cell phenotype. Am J Physiol Lung Cell Mol Physiol 270: L1040–L1051, 1996.[Abstract/Free Full Text]
  13. Hall A. G proteins and small GTPases: distant relatives keep in touch. Science 280: 2074–2075, 1998.[Free Full Text]
  14. Hall J. Unravelling the general properties of siRNAs: strength in numbers and lessons from the past. Nat Rev Genet 5: 552–557, 2004.[CrossRef][ISI][Medline]
  15. Hellstrand P, Albinsson S. Stretch-dependent growth and differentiation in vascular smooth muscle: role of the actin cytoskeleton. Can J Physiol Pharmacol 83: 869–875, 2005.[CrossRef][ISI][Medline]
  16. Hirshman CA, Emala CW. Actin reorganization in airway smooth muscle cells involves Gq and Gi-2 activation of Rho. Am J Physiol Lung Cell Mol Physiol 277: L653–L661, 1999.[Abstract/Free Full Text]
  17. Horiuchi T, Dietrich HH, Tsugane S, Dacey RG Jr. Analysis of purine- and pyrimidine-induced vascular responses in the isolated rat cerebral arteriole. Am J Physiol Heart Circ Physiol 280: H767–H776, 2001.[Abstract/Free Full Text]
  18. Jaggar JH, Nelson MT. Differential regulation of Ca2+ sparks and Ca2+ waves by UTP in rat cerebral artery smooth muscle cells. Am J Physiol Cell Physiol 279: C1528–C1539, 2000.[Abstract/Free Full Text]
  19. Jaggar JH, Porter VA, Lederer WJ, Nelson MT. Calcium sparks in smooth muscle. Am J Physiol Cell Physiol 278: C235–C256, 2000.[Abstract/Free Full Text]
  20. Kashiwada K, Nishida W, Hayashi K, Ozawa K, Yamanaka Y, Saga H, Yamashita T, Tohyama M, Shimada S, Sato K, Sobue K. Coordinate expression of alpha-tropomyosin and caldesmon isoforms in association with phenotypic modulation of smooth muscle cells. J Biol Chem 272: 15396–15404, 1997.[Abstract/Free Full Text]
  21. Kimura K, Ito M, Amano M, Chihara K, Fukata Y, Nakafuku M, Yamamori B, Feng J, Nakano T, Okawa K, Iwamatsu A, Kaibuchi K. Regulation of myosin phosphatase by Rho and Rho-associated kinase (Rho-kinase). Science 273: 245–248, 1996.[Abstract]
  22. Lazarowski ER, Boucher RC. UTP as an extracellular signaling molecule. News Physiol Sci 16: 1–5, 2001.[Abstract/Free Full Text]
  23. Lazarowski ER, Harden TK. Quantitation of extracellular UTP using a sensitive enzymatic assay. Br J Pharmacol 127: 1272–1278, 1999.[CrossRef][ISI][Medline]
  24. Lesh RE, Somlyo AP, Owens GK, Somlyo AV. Reversible permeabilization. A novel technique for the intracellular introduction of antisense oligodeoxynucleotides into intact smooth muscle. Circ Res 77: 220–230, 1995.[Abstract/Free Full Text]
  25. Luykenaar KD, Brett SE, Wu BN, Wiehler WB, Welsh DG. Pyrimidine nucleotides suppress KDR currents and depolarize rat cerebral arteries by activating Rho kinase. Am J Physiol Heart Circ Physiol 286: H1088–H1100, 2004.[Abstract/Free Full Text]
  26. Mehta D, Gunst SJ. Actin polymerization stimulated by contractile activation regulates force development in canine tracheal smooth muscle. J Physiol 519: 829–840, 1999.[Abstract/Free Full Text]
  27. Miyagi Y, Kobayashi S, Nishimura J, Fukui M, Kanaide H. Dual regulation of cerebrovascular tone by UTP: P2U receptor-mediated contraction and endothelium-dependent relaxation. Br J Pharmacol 118: 847–856, 1996.[ISI][Medline]
  28. Opazo SA, Zhang W, Wu Y, Turner CE, Tang DD, Gunst SJ. Tension development during contractile stimulation of smooth muscle requires recruitment of paxillin and vinculin to the membrane. Am J Physiol Cell Physiol 286: C433–C447, 2004.[Abstract/Free Full Text]
  29. Reading SA, Earley S, Waldron BJ, Welsh DG, Brayden JE. TRPC3 mediates pyrimidine receptor-induced depolarization of cerebral arteries. Am J Physiol Heart Circ Physiol 288: H2055–H2061, 2005.[Abstract/Free Full Text]
  30. Ridley AJ, Hall A. The small GTP-binding protein rho regulates the assembly of focal adhesions and actin stress fibers in response to growth factors. Cell 70: 389–399, 1992.[CrossRef][ISI][Medline]
  31. Saiag B, Bodin P, Shacoori V, Catheline M, Rault B, Burnstock G. Uptake and flow-induced release of uridine nucleotides from isolated vascular endothelial cells. Endothelium 2: 279–285, 2003.
  32. Shirao S, Kashiwagi S, Sato M, Miwa S, Nakao F, Kurokawa T, Todoroki-Ikeda N, Mogami K, Mizukami Y, Kuriyama S, Haze K, Suzuki M, Kobayashi S. Sphingosylphosphorylcholine is a novel messenger for Rho-kinase-mediated Ca2+ sensitization in the bovine cerebral artery: unimportant role for protein kinase C. Circ Res 91: 112–119, 2002.[Abstract/Free Full Text]
  33. Smolock EM, Wang T, Nolt JK, Moreland RS. siRNA knock down of casein kinase 2 increases force and cross-bridge cycling rates in vascular smooth muscle. Am J Physiol Cell Physiol 292: C876–C885, 2007.[Abstract/Free Full Text]
  34. Somlyo AP, Somlyo AV. Ca2+ sensitivity of smooth muscle and nonmuscle myosin II: modulated by G proteins, kinases, and myosin phosphatase. Physiol Rev 83: 1325–1358, 2003.[Abstract/Free Full Text]
  35. Sontheimer EJ. Assembly and function of RNA silencing complexes. Nat Rev Mol Cell Biol 6: 127–138, 2005.[CrossRef][ISI][Medline]
  36. Uehata M, Ishizaki T, Satoh H, Ono T, Kawahara T, Morishita T, Tamakawa H, Yamagami K, Inui J, Maekawa M, Narumiya S. Calcium sensitization of smooth muscle mediated by a Rho-associated protein kinase in hypertension. Nature 389: 990–994, 1997.[CrossRef][Medline]
  37. Weber LP, Van Lierop JE, Walsh MP. Ca2+-independent phosphorylation of myosin in rat caudal artery and chicken gizzard myofilaments. J Physiol 516: 805–824, 1999.[Abstract/Free Full Text]
  38. Welsh DG, Brayden JE. Mechanisms of coronary artery depolarization by uridine triphosphate. Am J Physiol Heart Circ Physiol 280: H2545–H2553, 2001.[Abstract/Free Full Text]
  39. Welsh DG, Morielli AD, Nelson MT, Brayden JE. Transient receptor potential channels regulate myogenic tone of resistance arteries. Circ Res 90: 248–250, 2002.[Abstract/Free Full Text]
  40. Yoneda A, Multhaupt HA, Couchman JR. The Rho kinases I and II regulate different aspects of myosin II activity. J Cell Biol 170: 443–453, 2005.[Abstract/Free Full Text]
  41. Zeidan A, Nordstrom I, Albinsson S, Malmqvist U, Sward K, Hellstrand P. Stretch-induced contractile differentiation of vascular smooth muscle: sensitivity to actin polymerization inhibitors. Am J Physiol Cell Physiol 284: C1387–C1396, 2003.[Abstract/Free Full Text]
  42. Zhang W, Gunst SJ. Dynamic association between alpha-actinin and beta-integrin regulates contraction of canine tracheal smooth muscle. J Physiol 572: 659–676, 2006.[Abstract/Free Full Text]
  43. Zheng XL, Gui Y, Du G, Frohman MA, Peng DQ. Calphostin-C induction of vascular smooth muscle cell apoptosis proceeds through phospholipase D and microtubule inhibition. J Biol Chem 279: 7112–7118, 2004.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Am. J. Physiol. Cell Physiol.Home page
S. J. Gunst and W. Zhang
Actin cytoskeletal dynamics in smooth muscle: a new paradigm for the regulation of smooth muscle contraction
Am J Physiol Cell Physiol, September 1, 2008; 295(3): C576 - C587.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
H. Hlawaty, A. San Juan, M.-P. Jacob, R. Vranckx, D. Letourneur, and L. J. Feldman
Inhibition of MMP-2 gene expression with small interfering RNA in rabbit vascular smooth muscle cells
Am J Physiol Heart Circ Physiol, December 1, 2007; 293(6): H3593 - H3601.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/1/H440    most recent
01374.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Corteling, R. L.
Right arrow Articles by Welsh, D. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Corteling, R. L.
Right arrow Articles by Welsh, D. G.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.