AJP - Heart Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Heart Circ Physiol 293: H482-H488, 2007. First published March 16, 2007; doi:10.1152/ajpheart.01372.2006
0363-6135/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/1/H482    most recent
01372.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jiang, Z.
Right arrow Articles by Berceli, S. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jiang, Z.
Right arrow Articles by Berceli, S. A.

TGF-beta- and CTGF-mediated fibroblast recruitment influences early outward vein graft remodeling

Zhihua Jiang,1 Peng Yu,1 Ming Tao,1 Chessy Fernandez,1 Cristos Ifantides,1 Olajompo Moloye,2 Gregory S. Schultz,2 C. Keith Ozaki,1 and Scott A. Berceli1

1University of Florida College of Medicine and the Malcom Randall Veterans Affairs Medical Center, and 2Department of Obstetrics and Gynecology University of Florida College of Medicine, Gainesville, Florida

Submitted 15 December 2006 ; accepted in final form 16 March 2007


   ABSTRACT
TOP
 ABSTRACT
METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Luminal shearing forces have been shown to impact both geometric remodeling and the development of intimal hyperplasia. Less well studied is the influence of intramural wall stresses on vessel growth and adaptation. Using a vein graft-fistula configuration to isolate the impact of circumferential wall stress, we identify the reorganization of adventitial myofibroblasts as the dominant histological event that limits early outward remodeling of vein grafts in response to elevated wall stress. We hypothesize that increased production of transforming growth factor-beta (TGF-beta) and connective tissue growth factor (CTGF) induces recruitment of myofibroblasts, promotes adventitial reorganization, and limits early outward remodeling in response to increased intramural wall stress. Vein grafts with a distal arteriovenous fistula in the neck of rabbits were constructed, resulting in a fourfold differential in circumferential wall stress. Using this model, we demonstrate 1) elevated wall stress augments the production of TGF-beta and CTGF, 2) increased TGF-beta expression and CTGF expression are correlated with the enhanced differentiation from fibroblasts to myofibroblasts, as evidenced by the significant increase in the {alpha}-actin-positive cells in adventitia, and 3) the levels of TGF-beta, CTGF, and {alpha}-actin are inversely correlated with the magnitude of outward remodeling of the graft wall. Increased wall stress after vein graft implantation appears to induce a TGF-beta- and CTGF-mediated recruitment of adventitial fibroblasts and a conversion to a myofibroblast phenotype. Although important in the maintenance of wall stability in the face of an increased mechanical load, this adventitial adaptation limits early outward remodeling of the vein conduit and may prove deleterious in maintaining long-term vein graft patency.

connective tissue growth factor; transforming growth factor-beta; vascular remodeling; hemodynamics; wall stress

THE LINK BETWEEN VASCULAR adaptations and the local hemodynamic environment has been firmly established (11, 12). After vascular injury, luminal shearing forces have been shown to impact both geometric remodeling and the development of intimal hyperplasia. An important application of these concepts has been in the clinical area of vein graft adaptation. Placement of a venous conduit to the arterial system leads to an acute alteration in the surface shear stress. Work from our group (8, 17), as well as from other investigators (26, 36), has demonstrated that the nature and magnitude of the shear influence both the rate of intimal growth and morphology of the graft wall.

Less well studied is the influence of wall stresses within the vascular wall on vessel growth and adaptation. The pioneering works of Wolinsky and Glagov (43) and others (25) serve as a foundation for understanding the vascular wall response to mechanical forces, although the transferability of these concepts to the vein graft scenario remains to be defined. Although in vitro systems have demonstrated that alterations in tensile forces induce marked changes in arterial smooth muscle cell structure and metabolism (1, 28), intact vein grafts in an in vivo environment offer significant complexity to these simple concepts. Influenced simultaneously by intraluminal pressure, wall thickness, and luminal diameter (6), defined experiments to estimate intramural wall stress and understand its impact on the remodeling process have been limited.

Unique in the vascular system is the acute physiological perturbations that result from implantation of a vein graft into the arterial circulation. Although increased wall shear promotes luminal expansion, elevated circumferential wall stress supports wall thickening and stabilization of the lumen size. These competitive processes within the remodeling vein graft have been examined by several investigators, and limited outward expansion and wall thickening in response to the intramural forces are suggested to be the dominant factors (7, 35, 44). Yet to be explored are the structural changes within the vein graft that stabilize the wall to these elevated intramural wall stresses and the underlying mechanistic pathways that drive these adaptations. Characterization of these events holds substantial clinical relevance, since vein graft failure is now recognized as the result of not only neointimal hyperplasia but also unchecked negative remodeling by the entire conduit wall (29).

Using a vein graft-fistula configuration to isolate the impact of wall stress (independent of shear), we identify the reorganization of adventitial myofibroblasts as the dominant histological event that limits outward remodeling of vein grafts in response to elevated circumferential wall stress. Recent investigations have suggested that the transforming growth factor (TGF)-connective tissue growth factor (CTGF) axes are important regulators of adventitial remodeling. As such, we hypothesize that increased production of TGF-beta and CTGF induces recruitment of myofibroblasts, promotes adventitial reorganization, and limits outward remodeling in response to increased intramural wall stress.


   METHODS
TOP
 ABSTRACT
 METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animal model. This study was performed after securing approval from the Institutional Animal Care and Use Committee and conforms to the Guide for the Care and Use of Laboratory Animals (National Institutes of Health publication no. 85-23, revised 1996).

Male New Zealand White rabbits (3.0–3.5 kg; n = 28) were anesthetized with ketamine hydrochloride (30 mg/kg) and inhaled isoflurane (2.5~3.0%). Heparin (1000 units) was given intravenously, and the contralateral jugular vein was harvested and implanted into the common carotid artery, as previously described (17). An arteriovenous fistula was created 2-cm distal to the vein graft using the ipsilateral jugular vein. Distal carotid ligation was then performed to equalize the flow rates within the vein graft and fistula vein segments (Fig. 1).


Figure 1
View larger version (17K):
[in this window]
[in a new window]

  		Fig. 1. Experimental model. With the use of the cuffed anastomotic technique, external jugular vein was interpositioned into the contralateral common carotid artery. The ipsilateral jugular vein was then connected to the distal common carotid artery in an end-to-side anastomotic fashion. A ligature placed distal to the fistula directs equivalent amounts of blood flow from vein graft to the fistula vein. As demonstrated by the recorded pressure waveform, the fistula anastomosis causes marked pressure drop and consequently creates a differential pressure load between the vein graft and fistula vein.

 
Graft and fistula veins were harvested at 1 (n = 10), 3 (n = 6), and 7 days (n = 6) after implantation, with 50 mg/kg bromodeoxyuridine (BrdU) administered 24 h before harvest. Normal jugular veins (n = 4) were harvested for histological controls, and sham-operated vein segments (n = 4) were used for RNA and protein assay controls. Flow rates were recorded at the time of graft implantation and harvest by an ultrasonic flow meter (2.0-mm flow probe, T106; Transonic Systems). High-resolution video images (model DXC-151A; Sony) were obtained at both graft placement and harvest and used to determine external graft dimensions. At the time of harvest, pressure waveforms in the ascending aorta, midvein graft, fistula hood (near to anastomosis), middle fistula, and proximal fistula (near bifurcation) were recorded with a micro-tip catheter transducer (1.4-Fr SPR-671; Millar Instruments). All hemodynamic measurements were obtained with the animals under general anesthesia, a potential source of deviation from awake physiological values.

Morphological analyses (Axiovision version 3.1; Zeiss) were completed with in vivo external graft diameter and cross-sectional measurements on Masson- and van Gieson's elastin-stained specimens, as previously described (8). To minimize the influence of flow disturbances around the anastomoses, tissue segments within 5 mm of the anastomoses were excluded from analyses. Mean circumferential wall stress (S) was estimated, neglecting the time-dependent component of the intraluminal pressure waveform, using the equation S = PR/h, where P is the mean intraluminal pressure, R is the lumen radius, and h is the wall thickness.

Immunohistochemical and TUNEL analyses. Proliferating and apoptotic cells were identified by use of an antibody to BrdU (Zymed) and an in situ cell death detection kit [transferase-mediated dUTP nick end labeling (TUNEL); Roche] on formalin-fixed sections. Nuclear counting was performed in six high-power fields, evenly divided along the circumference of the lumen. Propidium iodide staining was used to obtain total nuclear density, and data were expressed as the ratio of stained to total nuclei within the intima/media or adventitial regions. Adventitial thickness was defined as 50 µm from the external elastic lamina. Samples were stained for {alpha}-actin as previously described (17). The area of {alpha}-actin staining within the adventitia was evaluated in six high-power fields by computer-aided morphometry and expressed as a percentage of total area. Antibodies utilized for TGF-beta1 detection were mouse anti-human TGF-beta1 (1:80; R&D) and biotinylated goat anti-mouse (1:200; Caltag Laboratory). Avidin-biotin complex and diaminobenzidine kits (Vector) were applied to visualize the specific staining, with hematoxylin counterstain.

Real-time PCR and ELISA assay. Total RNA was isolated, and TaqMan RT-PCR was performed as previously described (16), using the following primers: for TGF-beta1, AAGGGCTACCACGCCAACT (forward), CCGGGTTGTGCTGGTTGT (reverse), and AGTACAGCAAGGTCCTGGCCCTG (6-FAM-labeled probe); for CTGF, TCCAAGCCGGTCAAGTTTG (forward), TGCATACTCCGCAGAACTTAGC (reverse), and TGGCTGCACCAGCGTGAAGACG (6-FAM-labeled probe). RT-PCR was simultaneously run for 18S RNA on all samples to normalize sample loading. The comparative cycle threshold method was used for analysis (with results expressed as relative fold change vs. that shown in sham-operated jugular vein).

Protein extraction from frozen specimens was performed in 0.05 M Tris (pH 7.5) and 0.2% Triton X-100 using a mortar and pestle. A TGF-beta1 immunoassay ELISA kit (R&D) was used to determine total TGF-beta1 protein content.

Cell migration. Rabbit aortic smooth muscle cells (passages 2–4) were serum starved for 24 h, and migration assays were performed with a modified Boyden chamber assay (HTS Transwell, Corning). Cells (250,000/well) were added to the upper chamber, and chemoattractants (TGF-beta1: 5, 10, and 20 ng/ml; CTGF: 10, 25, and 50 ng/ml) and FCS or serum-free medium were added to the lower chamber. After 5 h, cells were scraped from the upper surface, the membrane was fixed with methanol, migrated cell nuclei were stained with hematoxylin, and cell counts were performed (x1,000, 5 fields for each condition). Each assay was performed in quadruplicate.

Statistical analysis. All data are expressed as means ± SE. Comparisons were done with the use of Student's t-test or ANOVA and Tukey's post hoc analysis, with P < 0.05 considered significant.


   RESULTS
TOP
 ABSTRACT
 METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
Hemodynamics and morphology. Implantation of a vein graft in series with an arteriovenous fistula resulted in an approximately fourfold differential in mean intraluminal pressure between the two venous conduits (Table 1). Influenced predominately by the difference in pressure, intramural wall stress within the vein graft was significantly elevated over those stresses within the fistula vein. After implantation, both the vein graft and fistula vein demonstrated an increase in luminal diameter; however, significant attenuation in outward remodeling was noted in the vein graft by day 7 (P = 0.02, Table 1). After distal carotid artery ligation, flow rates were identical through both conduits, averaging 80 ± 20 ml/min over the 7-day experiment. Among the strengths of this model is the ability to expose vein segments to divergent intramural wall stresses, while maintaining a uniform shear environment (day 1: 38.4 ± 8.9 vs. 36.3 ± 5.3 dyn/cm2, vein graft vs. fistula; P = not significant).


View this table:
[in this window]
[in a new window]

  		Table 1. Differential wall stress between the vein graft and fistula vein and the resultant adaptive changes in lumen diameter

 
Histological evaluation of vein grafts and fistula veins demonstrated notable differences in their adaptive remodeling (Fig. 2). In response to the elevated wall stress, vein grafts exhibited a prominent reduction in medial cellularity, which was not observed in the low-stress, fistula vein segments. TUNEL analysis supported enhanced apoptotic cell death within the intima/media of vein grafts as the underlying mechanism for this difference (day 1: 53 ± 6% vs. 24 ± 4%, vein graft vs. fistula; P = 0.02). This was further confirmed with {alpha}-actin immunostaining, demonstrating a decellularized {alpha}-actin-negative space between the layers of intima and media in the day 7 vein grafts (Fig. 2).


Figure 2
View larger version (97K):
[in this window]
[in a new window]

  		Fig. 2. Adaptive remodeling of vein grafts and fistula veins exposed to the differential wall stress for 7 days. Although the fistula vein wall remained structurally similar to normal vein, vein grafts demonstrated a marked reduction of {alpha}-actin-positive cells within the media. Coincident with this, a marked increase in {alpha}-actin-positive cells within the vein graft adventitia was observed. M, media; A, adventitia. Original magnification = x400.

 
Exposure to differential wall stress resulted in a marked difference in the distribution and density of {alpha}-actin-positive cells (Fig. 2). Vein grafts demonstrated substantial {alpha}-actin-positive cells in the adventitia, whereas normal jugular vein and fistula vein segments displayed {alpha}-actin staining exclusively within the media. Computer-aided morphometry confirmed this finding, with a significant increase in the fraction of {alpha}-actin staining within the adventitia after 7-day exposure to elevated wall stress (3.8 ± 1.1% and 0.6 ± 0.3%, vein graft vs. fistula; P = 0.03). Cell death and proliferation (Fig. 3), as identified by BrdU- and TUNEL-labeled cells, were modest and not significantly influenced by the magnitude of wall stress. However, a modest increase in cellularity was observed in vein grafts at day 7. Quantitatively, elevated wall stress resulted in a 36% increase in the nuclear density in the adventitia of vein grafts compared with the fistula veins (P = 0.04).


Figure 3
View larger version (15K):
[in this window]
[in a new window]

  		Fig. 3. Early cell death and delayed cell proliferation was observed in the adventitia of both vein grafts and fistula veins. Despite similar apoptotic and proliferation rates, the adventitia of vein grafts demonstrated significantly higher cellularity than that of fistula veins, indicating cell recruitment from the paravascular tissues. BrdU, bromodeoxyuridine; D, day; TUNEL, transferase-mediated dUTP nick end labeling.

 
Expression of the profibrotic growth factors. Recent investigations have suggested that TGF-beta1-induced CTGF production by medial smooth muscle cells is critical in the recruitment of adventitial cells and conversion to myofibroblasts (19, 22, 31, 34). In response to increased wall stress, vein grafts demonstrate a significant, early increase in TGF-beta1 mRNA expression (Fig. 4A; P = 0.01), followed by a delayed rise in TGF-beta1 protein production (Fig. 4B; P = 0.05). Conversely, with changes in TGF-beta1 expression and protein content within the low wall stress, fistula vein segments are limited. Consistent with the established role of TGF-beta in CTGF production, CTGF mRNA expression mirrors TGF-beta1 protein production, demonstrating an increase at day 7 in the vein grafts specimens (Fig. 4C; P = 0.03). Immunohistochemistry (Fig. 5) demonstrates positive immunogenic reaction of TGF-beta1 in the adventitia of vein grafts, supporting higher TGF-beta1 protein production in the vein grafts by cells in the adventitia. A similar immunohistochemical staining pattern was observed for CTGF, with localization primarily in the vein graft adventitia.


Figure 4
View larger version (15K):
[in this window]
[in a new window]

  		Fig. 4. Wall tension regulated expression of profibrotic growth factor transforming growth factor (TGF)-beta1 (A and B) and connective tissue growth factor (CTGF; C), demonstrating enhanced TGF-beta1 and CTGF production in vein grafts, compared with fistula veins. Conc, concentration.

 

Figure 5
View larger version (117K):
[in this window]
[in a new window]

  		Fig. 5. Immunohistochemistry assay for TGF-beta1 and CTGF. Positive staining for both TGF-beta1 and CTGF is noted in the adventitia of vein grafts, the predominant site of myofibroblast recruitment and active remodeling.

 
Cell migration. A modified Boyden chamber assay was used, establishing a role for TGF-beta and CTGF in {alpha}-actin-positive cell migration (Fig. 6). TGF-beta1 and CTGF independently induced cell migration to a level equivalent to 10% FCS. The chemoattractant effect of CTGF was dose dependent. The combination of TGF-beta1 and CTGF demonstrated no additive or synergistic effect within the dosing range tested.


Figure 6
View larger version (17K):
[in this window]
[in a new window]

  		Fig. 6. Chemoattractant effects of TGF-beta1 and CTGF. TGF-beta1 and CTGF independently induced cell migration to a level equivalent to 10% FCS, with a CTGF dose-dependent response. The combination of TGF-beta1 and CTGF demonstrated no additive or synergistic effect within the dosing range tested.

 

   DISCUSSION
TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
Observations on vein graft remodeling have identified that hemodynamic forces (wall shear and tensile stresses) are the primary stimuli that induce active reorganization of the graft wall, leading to permanent changes in vascular mass and/or dimension (5, 24). Although significant progress has been made in the understanding of shear stress-regulated vein graft adaptations (2, 10, 16, 27), insights into how wall stress modulates the remodeling process remain limited. Several models, including flexible membrane cell culture systems (40), ex vivo perfusion culture (23, 30), and external sleeve support (14, 37), have been created in an attempt to address these questions. However, the application of these models is restricted by the inability to study the complex interaction among various components that comprise the intact vessel wall or creation of a nonphysiological system that deviates substantially from clinical reality. To this aim, we developed a vascular reconstruction that used a vein bypass graft placed in series with a distal fistula, with distal ligation to equalize the flow environment (and thus wall shear) in the presence of a fourfold differential in intramural wall stress within each conduit vein.

In our seeking to understand the potential mechanisms of the impeded outward remodeling in the vein grafts loaded with high wall stress, we explored the adaptive process of the early graft wall. Specifically, we examined how wall stress regulates the expression of the profibrotic growth factors and the responses of the adventitial cells to these molecular signals. Our data demonstrated that 1) elevated wall stress augments the production of TGF-beta and CTGF, 2) increased TGF-beta and CTGF expression is correlated with the enhanced differentiation from fibroblasts to myofibroblasts, as evidenced by the significant increase in the {alpha}-actin-positive cells in adventitia, and 3) the levels of TGF-beta, CTGF, and {alpha}-actin are inversely correlated with the magnitude of outward remodeling of the graft wall.

A shortcoming of the present study is the focus exclusively on the early event in vein graft adaptation, a result of an important limitation in our present animal model. Whereas other investigators have published longer-term studies that used a similar fistula-graft configuration, our experience with this construct when used with a rigid, cuffed anastomosis reveals substantial neointimal hyperplasia at these anastomoses and limited long-term graft durability. Although this "cuffed" technique offers a rapid method for creation of an anastomosis, limiting ischemia and injury to the graft and producing a very reproducible model (17), our present observations present a recently recognized limitation of this approach (15). Although altered intramural wall stress and turbulent flow across narrow anastomoses are possible etiologies underlying this aggressive hyperplastic response within these cuffs, further experimentation is required to clearly define these mechanisms. As such, this temporal variation in shear at these later time points negatively impacts the utility of this model for longer-term studies.

Recent insights into arterial wall remodeling have led to the emerging concept that the "adventitia acts as a biological process center for the retrieval, integration, storage, and release of key regulators of vessel wall function" (38). The resident fibroblasts play a key role in these processes through sensing the stimuli, initiating the changes in their function and phenotype, and reorganizing the adventitial structure (39). This concept has been addressed in pathogenesis of both pulmonary hypertension (38) and postangioplasty restenosis (20, 21, 33). An apparatus composed of intracellular actin microfilaments, adaptor proteins (such as transmembrane integrins), and extracellular fibrils acts as a biomechanical sensor to initiate the propagation of several intracellular signaling pathways, resulting in biological adaptation to the perceived stimulus (41). This is of particular importance in the response to increased stress and strain within the vascular wall. Several in vitro studies have demonstrated that tensile force is a sufficient and necessary factor that induces the differentiation from fibroblast to myofibroblast and the synthesis of the contractile protein {alpha}-actin (4, 18, 42). Under physiological conditions, the matrix network protects fibroblasts from the loaded stretching, called "stress shielding" (41). Increased wall stress disrupts the "stress-shielding homeostasis," therefore causing the conformational changes of integrin-ligand pairs and activating intracellular signaling pathways, such as NF-{kappa}B, ERK, and JNK, (13, 37), which lead to the proliferation, differentiation, and synthesis of contractile proteins. Coupled with matrix reorganization and attachment to the migrating cell, the newly assembled structure provides a mechanism to accommodate this increased mechanical load (9, 41). A component of this stress-shielding concept is the inherently different intrinsic mechanical properties (e.g., elastic modulus) that characterize the media and adventitia of the vein graft and the resulting differential in mechanical loading within these two adjacent regions. It is interesting to speculate that this differential in wall stress influences the local cell kinetics for each of these compartments and, similar to the observations of other investigators within arterial beds, contributes to the dissimilar rates of medial and adventitial apoptosis and proliferation identified in our study.

Similar to what has been reported in other systems, the present study identifies adventitial myofibroblast accumulation and {alpha}-actin production as a critical component of adaptation to increased intramural stress. Associated with the adventitial reorganization is an impaired ability for the vein graft to outwardly remodel. Recent clinical investigations have identified this outward expansion of vein grafts, in response to increased surface shear stress, to be important in maintenance of luminal cross-sectional area in the face of a developing neointima (29). Wall stress-induced recruitment of myofibroblasts may impede this process and predispose these conduits to early vein graft failure.

A central role for CTGF has been established in the process of wound healing and tissue remodeling (3). Although TGF-beta has been recognized as one of the dominant regulators of CTGF expression, mounting evidence suggests that mechanical stimuli are important and independent mediators of CTGF. Recent investigations utilizing gene array approaches to define the fibroblast response to a mechanical load have identified CTGF as among the most highly responsive genes (19, 34). Examination of the CTGF promoter region has identified an element homologous to a core sequence, termed the stretch-responsive element (GAGACC) (32), which may be involved in a direct regulation of CTGF expression by the application of increased intramural wall stress in our model. These observations interface nicely with recent data examining the influence of CTGF on adventitial fibroblast phenotype (22). After exposure to CTGF, fibroblasts demonstrated a TGF-independent increase in the myofibroblast marker, {alpha}-actin content. Our data demonstrate that upregulated TGF-beta1 and CTGF are accompanied by significantly higher adventitial cellularity but similar cell death and proliferation in vein grafts compared with fistula veins, supporting the concept that TGF-beta1 and CTGF produced by adventitial cells facilitate the recruitment of perivascular fibroblasts to the graft wall. This in vivo study not only confirms the in vitro findings described above but it also suggests a novel mechanism by which the loaded wall stress regulates vein graft remodeling through modulation of profibrotic growth factor-mediated cellular events and structural reorganization in the adventitia. Coupled with our data establishing a positive effect of these growth factors on {alpha}-actin-positive cell migration, CTGF and TGF-beta1 appear central to the process of adventitial adaptation after vein graft implantation and may provide a suitable target for inhibition of stenosis and subsequent failure.

In summary, we provide direct evidence that levels of TGF-beta, CTGF (mRNA), and {alpha}-actin in the adventitia correlate inversely with outward remodeling in the graft, supporting the concept that increased intramural wall stress following vein graft implantation induces a CTGF- and TGF-beta-mediated recruitment of adventitial fibroblasts and a conversion to myofibroblast phenotype. Although important in the maintenance of wall stability in the face of an increased mechanical load, this adventitial adaptation limits outward remodeling of the vein conduit and, if unchecked, may prove deleterious in maintaining long-term vein graft patency.


   GRANTS
TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
The work was supported by National Heart, Lung, and Blood Institute Grants 1R01 HL-079135-01 and K08 HL-04070-01A1, American Heart Association Grant 0635354N, the Lifeline Foundation, and The William J. von Liebig Foundation.


   FOOTNOTES
 

Address for reprint requests and other correspondence: S. A. Berceli, PO Box 100286, Gainesville, FL 32610-0286 (e-mail: bercesa{at}surgery.ufl.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Awolesi MA, Sessa WC, Sumpio BE. Cyclic strain upregulates nitric oxide synthase in cultured bovine aortic endothelial cells. J Clin Invest 96: 1449–1454, 1995.[Web of Science][Medline]
  2. Baldwin ZK, Chandiwal A, Huang W, Vosicky JE, Balasubramanian V, Curi MA, Schwartz LB. Slower onset of low shear stress leads to less neointimal thickening in experimental vein grafts. Ann Vasc Surg 20: 106–113, 2006.[CrossRef][Web of Science][Medline]
  3. Blom IE, Goldschmeding R, Leask A. Gene regulation of connective tissue growth factor: new targets for antifibrotic therapy? Matrix Biol 21: 473–482, 2002.[CrossRef][Web of Science][Medline]
  4. D'Addario M, Arora PD, Ellen RP, McCulloch CA. Regulation of tension-induced mechanotranscriptional signals by the microtubule network in fibroblasts. J Biol Chem 278: 53090–53097, 2003.[Abstract/Free Full Text]
  5. Davies MG, Hagen PO. Pathophysiology of vein graft failure: a review. Eur J Vasc Endovasc Surg 9: 7–18, 1995.[CrossRef][Web of Science][Medline]
  6. Dobrin PB. Mechanical factors associated with the development of intimal and medial thickening in vein grafts subjected to arterial pressure. A model of arteries exposed to hypertension. Hypertension 26: 38–43, 1995.[Abstract/Free Full Text]
  7. Dobrin PB, Littooy FN, Endean ED. Mechanical factors predisposing to intimal hyperplasia and medial thickening in autogenous vein grafts. Surgery 105: 393–400, 1989.[Web of Science][Medline]
  8. Fernandez CM, Goldman DR, Jiang Z, Ozaki CK, Tran-Son-Tay R, Berceli SA. Impact of shear stress on early vein graft remodeling: a biomechanical analysis. Ann Biomed Eng 32: 1484–1493, 2004.[CrossRef][Web of Science][Medline]
  9. Gabbiani G. The myofibroblast in wound healing and fibrocontractive diseases. J Pathol 200: 500–503, 2003.[CrossRef][Web of Science][Medline]
  10. Galt SW, Zwolak RM, Wagner RJ, Gilbertson JJ. Differential response of arteries and vein grafts to blood flow reduction. J Vasc Surg 17: 563–570, 1993.[CrossRef][Web of Science][Medline]
  11. Glagov S. Intimal hyperplasia, vascular modeling, and the restenosis problem. Circulation 89: 2888–2891, 1994.[Free Full Text]
  12. Glagov S, Bassiouny HS, Giddens DP, Zarins CK. Pathobiology of plaque modeling and complication. Surg Clin North Am 75: 545–556, 1995.[Web of Science][Medline]
  13. Hellstrand P, Albinsson S. Stretch-dependent growth and differentiation in vascular smooth muscle: role of the actin cytoskeleton. Can J Physiol Pharmacol 83: 869–875, 2005.[CrossRef][Web of Science][Medline]
  14. Huynh TT, Davies MG, Trovato MJ, Svendsen E, Hagen PO. Alterations in wall tension and shear stress modulate tyrosine kinase signaling and wall remodeling in experimental vein grafts. J Vasc Surg 29: 334–344, 1999.[CrossRef][Web of Science][Medline]
  15. Jiang Z, Frase C, Abouhamze Wu L ZS, Ozaki CK, Berceli SA. The temporal impact of flow on vein graft remodeling. J Surg Res 107: 301, 2002.
  16. Jiang Z, Berceli SA, Pfahnl CL, Wu L, Goldman D, Tao M, Kagayama M, Matsukawa A, Ozaki CK. Wall shear modulation of cytokines in early vein grafts. J Vasc Surg 40: 345–350, 2004.[CrossRef][Web of Science][Medline]
  17. Jiang Z, Wu L, Miller BL, Goldman DR, Fernandez CM, Abouhamze ZS, Ozaki CK, Berceli SA. A novel vein graft model: adaptation to differential flow environments. Am J Physiol Heart Circ Physiol 286: H240–H245, 2004.[Abstract/Free Full Text]
  18. Kainulainen T, Pender A, D'Addario M, Feng Y, Lekic P, McCulloch CA. Cell death and mechanoprotection by filamin a in connective tissues after challenge by applied tensile forces. J Biol Chem 277: 21998–22009, 2002.[Abstract/Free Full Text]
  19. Kessler D, Dethlefsen S, Haase I, Plomann M, Hirche F, Krieg T, Eckes B. Fibroblasts in mechanically stressed collagen lattices assume a "synthetic" phenotype. J Biol Chem 276: 36575–36585, 2001.[Abstract/Free Full Text]
  20. Kingston PA, Sinha S, Appleby CE, David A, Verakis T, Castro MG, Lowenstein PR, Heagerty AM. Adenovirus-mediated gene transfer of transforming growth factor-beta3, but not transforming growth factor-beta1, inhibits constrictive remodeling and reduces luminal loss after coronary angioplasty. Circulation 108: 2819–2825, 2003.[Abstract/Free Full Text]
  21. Kingston PA, Sinha S, David A, Castro MG, Lowenstein PR, Heagerty AM. Adenovirus-mediated gene transfer of a secreted transforming growth factor-beta type II receptor inhibits luminal loss and constrictive remodeling after coronary angioplasty and enhances adventitial collagen deposition. Circulation 104: 2595–2601, 2001.[Abstract/Free Full Text]
  22. Kundi R, Ryer E, Kentaro K, Liu B, Kent KC. TGF-beta/Smad3-induced production of CTGF by medial smooth muscle cells mediates remodeling behavior in adventitial fibroblasts. J Am Coll Surg 203: S99, 2006 (Surg Forum, :335–337, 2006).
  23. Lauth M, Berger MM, Cattaruzza M, Hecker M. Pressure-induced upregulation of preproendothelin-1 and endothelin B receptor expression in rabbit jugular vein in situ: implications for vein graft failure? Arterioscler Thromb Vasc Biol 20: 96–103, 2000.[Abstract/Free Full Text]
  24. Lehoux S, Castier Y, Tedgui A. Molecular mechanisms of the vascular responses to haemodynamic forces. J Intern Med 259: 381–392, 2006.[CrossRef][Web of Science][Medline]
  25. Lehoux S, Tedgui A. Signal transduction of mechanical stresses in the vascular wall. Hypertension 32: 338–345, 1998.[Abstract/Free Full Text]
  26. Meyerson SL, Moawad J, Loth F, Skelly CL, Bassiouny HS, McKinsey JF, Gewertz BL, Schwartz LB. Effective hemodynamic diameter: an intrinsic property of vein grafts with predictive value for patency. J Vasc Surg 31: 910–917, 2000.[CrossRef][Web of Science][Medline]
  27. Meyerson SL, Skelly CL, Curi MA, Shakur UM, Vosicky JE, Glagov S, Schwartz LB, Christen T, Gabbiani G. The effects of extremely low shear stress on cellular proliferation and neointimal thickening in the failing bypass graft. J Vasc Surg 34: 90–97, 2001.[CrossRef][Web of Science][Medline]
  28. Mills I, Murata K, Packer CS, Sumpio BE. Cyclic strain stimulates dephosphorylation of the 20kDa regulatory myosin light chain in vascular smooth muscle cells. Biochem Biophys Res Commun 205: 79–84, 1994.[CrossRef][Web of Science][Medline]
  29. Owens CD, Wake N, Jacot JG, Gerhard-Herman M, Gaccione P, Belkin M, Creager MA, Conte MS. Early biomechanical changes in lower extremity vein grafts—distinct temporal phases of remodeling and wall stiffness. J Vasc Surg 44: 740–746, 2006.[CrossRef][Web of Science][Medline]
  30. Patterson MA, Leville CD, Hower CD, Jean-Claude JM, Seabrook GR, Towne JB, Cambria RA. Shear force regulates matrix metalloproteinase activity in human saphenous vein organ culture. J Surg Res 95: 67–72, 2001.[CrossRef][Web of Science][Medline]
  31. Prado CM, Ramos SG, Alves-Filho JC, Elias J Jr, Cunha FQ, Rossi MA. Turbulent flow/low wall shear stress and stretch differentially affect aorta remodeling in rats. J Hypertens 24: 503–515, 2006.[Web of Science][Medline]
  32. Resnick N, Collins T, Atkinson W, Bonthron DT, Dewey CF Jr, Gimbrone MA Jr. Platelet-derived growth factor B chain promoter contains a cis-acting fluid shear-stress-responsive element. Proc Natl Acad Sci USA 90: 4591–4595, 1993.[Abstract/Free Full Text]
  33. Sartore S, Chiavegato A, Faggin E, Franch R, Puato M, Ausoni S, Pauletto P. Contribution of adventitial fibroblasts to neointima formation and vascular remodeling: from innocent bystander to active participant. Circ Res 89: 1111–1121, 2001.[Abstract/Free Full Text]
  34. Schild C, Trueb B. Mechanical stress is required for high-level expression of connective tissue growth factor. Exp Cell Res 274: 83–91, 2002.[CrossRef][Web of Science][Medline]
  35. Schwartz LB, O'Donohoe MK, Purut CM, Mikat EM, Hagen PO, McCann RL. Myointimal thickening in experimental vein grafts is dependent on wall tension. J Vasc Surg 15: 176–186, 1992.[CrossRef][Web of Science][Medline]
  36. Skelly CL, Meyerson SL, Curi MA, Loth F, Schwartz LB. The hemodynamics of vein grafts: measurement and meaning. Ann Vasc Surg 15: 110–122, 2001.[Web of Science][Medline]
  37. Sperry JL, Deming CB, Bian C, Walinsky PL, Kass DA, Kolodgie FD, Virmani R, Kim AY, Rade JJ. Wall tension is a potent negative regulator of in vivo thrombomodulin expression. Circ Res 92: 41–47, 2003.[Abstract/Free Full Text]
  38. Stenmark KR, Davie N, Frid M, Gerasimovskaya E, Das M. Role of the adventitia in pulmonary vascular remodeling. Physiology Bethesda 21: 134–145, 2006.[CrossRef][Medline]
  39. Strauss BH, Rabinovitch M. Adventitial fibroblasts: defining a role in vessel wall remodeling. Am J Respir Cell Mol Biol 22: 1–3, 2000.[Free Full Text]
  40. Sumpio BE, Banes AJ, Buckley M, Johnson G Jr. Alterations in aortic endothelial cell morphology and cytoskeletal protein synthesis during cyclic tensional deformation. J Vasc Surg 7: 130–138, 1988.[CrossRef][Web of Science][Medline]
  41. Tomasek JJ, Gabbiani G, Hinz B, Chaponnier C, Brown RA. Myofibroblasts and mechano-regulation of connective tissue remodelling. Nat Rev Mol Cell Biol 3: 349–363, 2002.[CrossRef][Web of Science][Medline]
  42. Wang J, Chen H, Seth A, McCulloch CA. Mechanical force regulation of myofibroblast differentiation in cardiac fibroblasts. Am J Physiol Heart Circ Physiol 285: H1871–H1881, 2003.[Abstract/Free Full Text]
  43. Wolinsky H, Glagov S. Structural basis for the static mechanical properties of the aortic media. Circ Res 14: 400–413, 1964.[Abstract/Free Full Text]
  44. Zwolak RM, Adams MC, Clowes AW. Kinetics of vein graft hyperplasia: association with tangential stress. J Vasc Surg 5: 126–136, 1987.[CrossRef][Web of Science][Medline]



This article has been cited by other articles:


Home page
 Cardiovasc ResHome page
R. Kundi, S. T. Hollenbeck, D. Yamanouchi, B. C. Herman, R. Edlin, E. J. Ryer, C. Wang, S. Tsai, B. Liu, and K. C. Kent
Arterial gene transfer of the TGF-{beta} signalling protein Smad3 induces adaptive remodelling following angioplasty: a role for CTGF
Cardiovasc Res, November 1, 2009; 84(2): 326 - 335.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
Z. Jiang, M. Tao, K. A. Omalley, D. Wang, C. K. Ozaki, and S. A. Berceli
Established neointimal hyperplasia in vein grafts expands via TGF-{beta}-mediated progressive fibrosis
Am J Physiol Heart Circ Physiol, October 1, 2009; 297(4): H1200 - H1207.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
J. Wu and C. Zhang
Neointimal hyperplasia, vein graft remodeling, and long-term patency
Am J Physiol Heart Circ Physiol, October 1, 2009; 297(4): H1194 - H1195.
[Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/1/H482    most recent
01372.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jiang, Z.
Right arrow Articles by Berceli, S. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jiang, Z.
Right arrow Articles by Berceli, S. A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.