AJP - Heart Watch the video to see how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 293: H2508-H2515, 2007. First published July 20, 2007; doi:10.1152/ajpheart.00352.2007
0363-6135/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/4/H2508    most recent
00352.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gendron, M.-E.
Right arrow Articles by Thorin, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gendron, M.-E.
Right arrow Articles by Thorin, E.

A change in the redox environment and thromboxane A2 production precede endothelial dysfunction in mice

Marie-Ève Gendron1 and Eric Thorin2

Departments of 1Physiology and 2Surgery, Faculty of Medicine, Université de Montréal, Montreal Heart Institute, Montreal, Quebec, Canada

Submitted 20 March 2007 ; accepted in final form 16 July 2007


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
We reported that the endothelial dysfunction that develops with age was associated with a proinflammatory phenotype. In this study, we hypothesized that an increased production of proinflammatory cyclooxygenase (COX) products occurs before endothelial dysfunction. Dilations to acetylcholine (ACh) were recorded from pressurized renal arteries isolated from 3- and 6-mo-old C57Bl/6 male mice treated or not with the polyphenol catechin (30 mg·kg–1·day–1) in drinking water for 3 mo. Release of thromboxane (TX) B2, the metabolite of TXA2, was measured by using immunoenzymatic assays, and free radical production was measured by using the fluorescent dye CM-H2DCFDA. Endothelial nitric oxide synthase (eNOS) and COX-1/2 mRNA expression were quantified by quantitative PCR. NG-nitro-L-arginine (L-NNA) reduced (P < 0.05) ACh-induced dilation in vessels isolated from 3- and 6-mo-old mice. In the presence of L-NNA, indomethacin normalized (P < 0.05) the dilation in vessels from 6-mo-old mice only. SQ-29548 (PGH2/TXA2 receptor antagonist) and furegrelate (TXA2 synthase inhibitor), in the presence of L-NNA, also improved (P < 0.05) dilation. L-NNA increased TXA2 release and free radical-associated fluorescence, the latter being prevented by SQ-29548. In vessels from 6-mo-old mice treated with catechin for 3 mo, L-NNA-dependent reduction in ACh-mediated dilation was insensitive to indomethacin, whereas TXA2 release and free radical-associated fluorescence were prevented. eNOS mRNA expression was significantly increased by catechin treatment. Our results suggest that an augmented production of TXA2 and the associated change in redox regulation precede the development of the endothelial dysfunction.

nitric oxide; cyclooxygenase; reactive oxygen species


NORMAL VASCULAR ENDOTHELIAL function depends on a controlled balance between the production and the release of endothelium-derived relaxing and contracting factors. The contribution to the dilation of endothelium-derived nitric oxide (NO), prostacyclin (PGI2), and the endothelium-derived hyperpolarizing factor (EDHF) is in harmony with the release of constrictors such as endothelin, prostaglandins (PGs), and thromboxane (TX) A2 (13, 20). The imbalance toward an increased release and/or functional impact of endothelium-derived contracting factors on the vascular function, however, is associated with an established endothelial dysfunction (2, 16), a hallmark of cardiovascular diseases and aging (13).

Cyclooxygenase (COX)-derived contracting factors are released from intact rat aorta (22) under circumstances where NO production is reduced (4, 8, 15, 22, 31, 32). In the aorta of hypertensive rats, the release of a COX-derived contracting factor limits the endothelium-dependent relaxation induced by acetylcholine (ACh) (5, 19). Likewise, impaired vasodilation to ACh in the forearm of hypertensive patients can be restored by a COX inhibitor (25).

Some studies suggest, however, that COX-derived contracting factors could act in concert with reactive oxygen species (ROS) to induce vasoconstriction. ROS cause the contraction of rings of the thoracic aorta isolated from spontaneously hypertensive rats, which can be prevented by indomethacin (3). Tesfamariam (26) showed that activation of PGH2 receptors causes contraction and impairment of endothelium-dependent relaxations in intact rat aorta by a mechanism involving the generation of ROS.

Recently, we reported (13, 18) that the endothelial pathways responsible for the dilation of mouse isolated vessels evolve during maturation and aging, demonstrating that the endothelial biology is dynamic with time, most likely as a result of time-dependent injuries and repairs. We observed that in C57Bl/6 mice, these intrinsic changes were not associated with an endothelial dysfunction between the ages of 3 and 6 mo but only at 12 mo of age. Intriguingly, similar changes in endothelial biology occurred earlier in dyslipidemic mice, with a significant increase in oxidative stress and impaired endothelial dilatory function at the age of 6 mo (13, 18). We therefore speculated that the changes in the contribution of the various endothelium-derived vasoactive factors observed with maturation (up to 6 mo of age) in C57Bl/6 mice may be adaptive to maintain function and may therefore be a reflection of the upcoming endothelial dysfunction in aging mice.

In the present study, we assessed the potential role of a COX-derived factor in the reduced dilation of the mouse renal artery during pharmacological inhibition of NO synthesis and studied the role of ROS generation in this process. We propose that the increased contribution of TXA2 in the regulation of the vascular tone is a precursor of the future endothelial dysfunction associated with aging.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Renal arteries were isolated from 3- and 6-mo-old male C57Bl/6 mice (Charles River, St-Constant, QC, Canada). Endothelial dysfunction is noticeable at 12 mo (13). In a separate set of experiments, 3-mo-old mice were treated with the antioxidant polyphenol catechin (30 mg·kg–1·day–1) in drinking water for 3 mo before study. At this time, animals were anesthetized with isoflurane (2.5%) in O2 (0.5 l/min), and blood pressure was measured by using a Millar catheter inserted in the carotid artery. The procedures and protocols were approved by the Animal Care and Use Committee of the Montreal Heart Institute and performed in accordance with our institutional guidelines and the Guide for the Care and Use of Laboratory Animals of Canada.

Vascular reactivity studies. Experiments were conducted in isolated and pressurized (100 mmHg) mouse renal arteries (external diameter {approx} 400 µm) as previously described (13). After 50 min of equilibration, myogenic tone, i.e., the reduction in diameter induced by the intraluminal pressure, had developed. Arterial segments were then preconstricted with phenylephrine (PE; 30 µmol/l), and concentration-response curves to ACh (0.001–30 µmol/l) were constructed. Inhibition of NO production was achieved by using NG-nitro-L-arginine (L-NNA; 10 µmol/l). PGI2 and TXA2 production were inhibited by indomethacin (Indo; 10 µmol/l), a nonselective inhibitor of COX; NS-398 (10 µmol/l), a selective COX-2 inhibitor; or valeryl salicylate (VS; 1 mmol/l), a selective COX-1 inhibitor (13). In addition, selective TXA2 production was inhibited by using furegrelate (10 µmol/l), a TXA2 synthase inhibitor (7). PGH2/TXA2 (TP) receptor was antagonized by using SQ-29548 (10 µmol/l). The effects of endogenous free radicals were inhibited by acute pretreatment of the vessel with N-acetyl-L-cysteine (NAC; 1 µmol/l) or catalase (Cat; 100 U/ml) for 30 min before the beginning of the dose-response curve (10, 13). Only one concentration-response curve was performed on each vessel.

Free radical measurement. Isolated and pressurized renal arteries were incubated in the presence of 5-(and-6)-chloromethyl-2',7'-dichlorodihydrofluorescein diacetate acetyl ester (CM-H2DCFDA; 5 µmol/l) added to the bath 30 min before the beginning of the experiment as previously described (10). Arteries were then washed with fresh physiological salt solution (PSS). Basal level of fluorescence was set at the same level for every artery at the beginning of the experiment. Changes in fluorescence were then measured: fluorescence intensity was assayed in vessels exposed to L-NNA alone or in combination with SQ-29548 and to U-46619 (an analog of TXA2; 0.1 µmol/l) alone. Specificity of the probe for free radicals was achieved by using H2O2 (500 µmol/l), as previously demonstrated by our group (10). Addition of H2O2 in the bath increased by 30-fold the fluorescence intensity compared with the basal condition (data not shown).

Quantification of the vasoconstrictor TXA2 and its stable end product TXB2 released by renal arteries. Vessels were pressurized in a 2-ml chamber. Drugs were added to the bath during the equilibration period and before the experiment (30 min). PE-contracted vessels were then dilated with a single dose of ACh (30 µmol/l). The PSS was collected from the chamber and was frozen at –80°C. The level of the stable end product of TXA2 (TXB2) was assayed by ELISA following the protocols provided by the manufacturer (Cayman Chemical, Ann Arbor, MI).

eNOS, COX-1, and COX-2 mRNA quantification by quantitative PCR. Total RNA was extracted from aorta by using an RNeasy mini kit (Qiagen). Efficient extraction was made possible by performing additional steps of digestion with proteinase K (Qiagen) and by eliminating DNA with a treatment with DNase I (Qiagen). The reverse transcriptase reaction contained 5 ng/µl total RNA (each sample), Moloney murine leukemia virus reverse transcriptase (200 units; Invitrogen), pd(N)6 (5 ng/ µl; Invitrogen), oligo(dT) (25 ng/µl; Invitrogen), dNTPs (0.5 mmol/l; MBI Fermentas), and supplied optimal buffers. The reaction protocol consisted of three successive incubation steps: 1) 25°C for 10 min, 2) 37°C for 50 min, and 3) 70°C for 15 min.

Quantitative PCR was performed with 1 or 2 ng of cDNA template, depending on the gene studied, and containing the appropriate primer concentration [eNOS (300 nM), COX-1 (300 nM), COX-2 (300 nM), cyclophilin A (300 nM)] and SYBR Green PCR master mix (Stratagene). Primers for each gene were obtained from distinct exons that spanned an intron by using the Ensembl genome browser (http://www.ensembl.org). The sequence specificity of each primer was verified with the BLAST program derived from the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov). The primers used were as follows (5' -> 3'): mouse eNOS, forward CACGAGGCACTGGTGTTGGT, reverse CTTGCGCCGCCAAGAGGATA; mouse COX-1, forward ACTCAGCGCATGACTACATC, reverse CTTCTCAGCAGCAGCTGTTG; mouse COX-2, forward GAACATGGACTCACTCAGTTTGTTG, reverse CAAAGATAGCATCTGGACGAGGT; and mouse cyclophilin A, forward CCGATGACGAGCCCTTGG, reverse GCCGCCAGTGCCATTATG. PCR products were purified, sequenced, and confirmed to be the genes of interest.

Statistical analysis. In every case, n refers to the number of animals used in each protocol. Continuous variables are expressed as means ± SE. Half-maximum effective concentration (EC50) of ACh was measured from individual concentration-response curves only when a maximal response was obtained. The vascular sensitivity (pD2) value, the negative log of the EC50, was obtained. At the end of the protocol, the maximal diameter (Dmax) was determined by changing the PSS to a Ca2+-free PSS containing sodium nitroprusside (10 µmol/l) and EGTA (1 mmol/l). Myogenic tone was measured at 100 mmHg and was expressed as percentage of the Dmax. ACh-induced dilation is expressed as a percentage of the Dmax. ANOVA studies followed by a Scheffé's F-test were performed to compare maximal dilation (Emax) and pD2 of dose-response curves. Unpaired t-tests were performed for prostanoids and free radical measurements. Differences were considered to be statistically significant for a P value <0.05.

Drugs. ACh, phenylephrine, L-NNA, Indo, SQ-29548, furegrelate, Cat, NAC, sodium nitroprusside, EGTA, and U-46619 were purchased from Sigma (St. Louis, MO). NS-398 and VS were purchased from Cayman Chemical. CM-H2DCFDA was obtained from Molecular Probes/Invitrogen (Burlington, ON, Canada) and was diluted daily in DMSO. All drugs were prepared daily and were diluted in Ultrapure water, except for Indo, U-46619, and VS, which were prepared in ethanol. NS-398 was prepared in DMSO. All drugs were then directly inserted in the bath chamber, and the final concentrations of ethanol or DMSO never exceeded 0.1%.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Effect of L-NNA and Indo. Myogenic tone was insensitive to Indo in vessels isolated from 3- and 6-mo-old mice, whereas L-NNA increased basal tone; in both groups, addition of Indo prevented the constrictor effects of L-NNA (Table 1). The endothelium-dependent dilation to ACh of renal artery isolated from 6-mo-old mice was maximal (83 ± 3% of Dmax) and was similar to the dilation of renal arteries isolated from 3-mo-old mice (90 ± 5%). At 3 mo, L-NNA reduced (P < 0.05) both the dilation (68 ± 4%) and the pD2 (5.8 ± 0.2) to ACh compared with the control conditions (90 ± 5% and 6.7 ± 0.1, respectively). Indo did not alter the inhibitory effect of L-NNA on the Emax induced by ACh (67 ± 5% and 5.9 ± 0.2; Fig. 1A).


View this table:
[in this window]
[in a new window]

 
Table 1. Levels of myogenic tone and phenylephrine-induced preconstriction of renal arteries isolated from 3- and 6-mo-old mice and 6-mo-old mice treated with catechin for 3 mo

 

Figure 1
View larger version (13K):
[in this window]
[in a new window]

 
Fig. 1. Acetylcholine (ACh)-induced dilation of renal arteries isolated from 3-mo-old (A) and 6-mo-old (B) mice. Responses were obtained either under control conditions or in the presence of nitric oxide synthase (NOS) inhibition [NG-nitro-L-arginine (L-NNA), 10 µM] alone or combined with the cyclooxygenase (COX) inhibitor indomethacin (L-NNA + Indo, 10 µM). Data are means ± SE; n = 6–15. *P < 0.05 compared with control.

 
Likewise, at 6 mo, inhibition of NO synthesis by L-NNA reduced (P < 0.05) the Emax to ACh (58 ± 8%; Fig. 1B) as well as the pD2 (5.9 ± 0.1) to ACh, compared with the control conditions (83 ± 3% and 6.4 ± 0.2; Table 2 and Fig. 1B). Addition of Indo in the presence of L-NNA, however, normalized (P < 0.05) the Emax and pD2 to ACh (Table 2 and Fig. 1B). Indo alone had no effect on the Emax and pD2 to ACh of vessels isolated from mice of 3 (Emax, 88 ± 3% and pD2, 6.5 ± 0.2) and 6 mo of age (Emax, 95 ± 8% and pD2, 6.6 ± 0.2). None of the experimental conditions affected the contraction induced by PE (Table 1).


View this table:
[in this window]
[in a new window]

 
Table 2. Vascular sensitivity and maximal dilation of renal arteries isolated from 6-mo-old mice

 
Effect of the preferential COX-1 and COX-2 inhibitors VS and NS-398. In the presence of L-NNA, addition of either NS-398, a selective inhibitor for COX-2, or VS, a selective inhibitor for COX-1, mimicked the effect of Indo: both inhibitors restored (P < 0.05) the Emax and the pD2 to ACh of vessels isolated from 6-mo-old mice (Table 2 and Fig. 2A). Likewise, both selective inhibitors prevented L-NNA-induced rise in basal tone (Table 1).


Figure 2
View larger version (12K):
[in this window]
[in a new window]

 
Fig. 2. ACh-induced dilation of renal arteries isolated from 6-mo-old mice. Responses were obtained under control conditions and in the presence of NOS inhibition (L-NNA, 10 µM). L-NNA was combined with NS-398 (NS, 10 µM) or valeryl salicylate (VS, 1 mM) (A), the prostaglandin (PG) H2/thromboxane (TX) A2 (TP) receptor antagonist SQ-29548 (SQ, 10 µM; B), or furegrelate (10 µM; C). Data are means ± SE; n = 8–15. *P < 0.05 compared with control.

 
Effect of the TXA2 synthase inhibitor furegrelate and TP receptor antagonist SQ-29548. To evaluate the potential contribution of TXA2 to the reduced dilation induced by ACh in the presence of L-NNA, we tested the effects of furegrelate, a TXA2 synthase inhibitor, and SQ-29548, a TP receptor antagonist. Both pharmacological agents prevented (P < 0.05) the inhibitory effects of L-NNA on the dilation induced by ACh in arteries isolated from 6-mo-old mice (Table 2 and Fig. 2, B and C). In contrast, neither furegrelate nor SQ-29548 prevented L-NNA-induced basal contraction, suggesting that TXA2 is not involved in this basal mechanism (Table 1).

Production of TXA2 metabolite TXB2 by renal arteries. During the experimentation using vessels isolated from 6-mo-old mice, the production of TXB2, the metabolite of TXA2, was quantified. TXB2 levels only increased (P < 0.05) when the arteries were incubated in the presence of L-NNA (Fig. 3). The increase in TXB2 release was prevented (P < 0.05) by addition of either Indo or furegrelate (Fig. 3).


Figure 3
View larger version (17K):
[in this window]
[in a new window]

 
Fig. 3. Quantification of the release of TXA2 stable metabolite TXB2 in the bathing physiological solution of renal arteries isolated from 6-mo-old mice and during ACh-induced dilation. Levels of TXB2 were obtained either under control conditions, in the presence of L-NNA (10 µM) alone, or in combination with Indo (10 µM) or furegrelate (Fur, 10 µM). Data are means ± SE; n = 4–5. *P < 0.05 compared with control.

 
Free radical measurement. To test the relationship between NOS activity, TXA2, and oxidative stress, free radicals were measured by using the fluorescent dye CM-H2DCFDA (10) in pressurized renal arteries exposed to L-NNA, SQ-29548, and U-46619, a synthetic analog of TXA2. In renal arteries isolated from 6-mo-old mice, addition of L-NNA increased (P < 0.05) free radical-associated fluorescence compared with the basal condition (Fig. 4). The effect of L-NNA was prevented (P < 0.05) by SQ-29548. Addition of U-46619 strongly increased (P < 0.05) the production of free radicals from isolated and pressurized mouse renal arteries (Fig. 4).


Figure 4
View larger version (10K):
[in this window]
[in a new window]

 
Fig. 4. Measure of free radical production using the reactive oxygen species-sensitive dye CM-H2DCFDA in pressurized renal arteries isolated from 6-mo-old mice. Changes in fluorescence were collected in the presence of L-NNA (10 µM) alone or in combination with SQ (10 µM) and during stimulation with the TXA2 analog U-46619 (100 nM). Data are means ± SE; n = 5–7. *P < 0.05 compared with basal.

 
Effect of NAC and Cat on ACh-induced dilation. To validate the functional importance of TXA2-dependent free radical production on the dilatory response induced by ACh in isolated vessels, we pretreated the arterial segments either with the antioxidant NAC or with Cat. Both acute interventions prevented (P < 0.05) the diminution of the dilation induced by ACh in the presence of L-NNA. Only NAC, however, normalized (P < 0.05) the pD2 to ACh (Table 2 and Fig. 5). Furthermore, both antioxidants prevented the rise in tone induced by L-NNA (Table 1), demonstrating that the redox equilibrium contributes to basal tone regulation.


Figure 5
View larger version (13K):
[in this window]
[in a new window]

 
Fig. 5. ACh-induced dilation of renal arteries isolated from 6-mo-old mice under control conditions and in the presence of NOS inhibition either alone (L-NNA, 10 µM) or combined with N-acetyl-L-cysteine (NAC, 1 µM; A) or catalase (100 U/ml; B). Data are means ± SE; n = 4–15. *P < 0.05 compared with control.

 
Effects of L-NNA and Indo, quantification of TXA2/TXB2, and free radical measurement in renal arteries isolated from 6-mo-old mice treated with catechin. To test the hypothesis that a change in the redox environment contributes to TXA2-mediated reduction in dilation to ACh observed in the presence of L-NNA, we used renal arteries isolated from 6-mo-old mice previously treated for 3 mo with the polyphenol catechin.

Blood pressure and heart rate were not significantly different between 3-mo-old mice (367 ± 40 mmHg and 72 ± 4 bpm; n = 5) and 6-mo-old mice treated for 3 mo with catechin (334 ± 20 mmHg and 70 ± 3 bpm; n = 5). In isolated renal vessels, however, the basal myogenic tone was increased (Table 1). It was, however, reduced to normal control values by Indo. Addition of L-NNA doubled myogenic tone, but this rise was not sensitive to Indo, revealing a significant change in vascular physiology after 3-mo catechin treatment.

In renal arteries isolated from these mice, L-NNA decreased (P < 0.05) the dilation induced by ACh (Fig. 6A). Addition of Indo, however, did not normalize this response (Fig. 6A), in contrast to what was observed in arteries isolated from untreated 6-mo-old mice (Fig. 1B). In agreement with these functional data, the 3-mo treatment period with catechin strongly reduced (P < 0.05) TXA2 release by renal arteries under control conditions (Fig. 6B) compared with TXA2 release from vessels of untreated animals (Fig. 3). Furthermore, the addition of L-NNA neither stimulated the production of TXA2 (Fig. 6B) nor increased free radical-associated fluorescence (Fig. 6C), whereas U-46619 still increased free radical production (Fig. 6C).


Figure 6
View larger version (8K):
[in this window]
[in a new window]

 
Fig. 6. ACh-induced dilation of renal arteries isolated from 6-mo-old mice treated for 3 mo with catechin (A), quantification of TXA2 (TXB2) released in bathing solution (B), and measurement of free radical production using ROS-sensitive dye CM-H2DCFDA (C). A: dilatory responses were obtained under control conditions and in the presence of L-NNA (10 µM) alone or in combination with Indo (10 µM). Data are means ± SE; n = 7–8. *P < 0.05 compared with control. B: levels of TXB2 were quantified either under control conditions, in the presence of L-NNA (10 µM) alone, or in combination with Indo (10 µM) or furegrelate (10 µM). Data are means ± SE; n = 4–5. C: changes in fluorescence were collected in the presence of L-NNA (10 µM) alone or in combination with SQ (10 µM) and during stimulation with the TXA2 analog U-46619 (100 nM). Data are means ± SE; n = 4–5. *P < 0.05 compared with basal.

 
COX-1/-2 and eNOS mRNA expression in the aorta of catechin-treated mice. As shown in Fig. 7, 3-mo therapy with catechin significantly increased eNOS and COX-2 mRNA expression. In contrast, COX-1 mRNA expression did not change.


Figure 7
View larger version (12K):
[in this window]
[in a new window]

 
Fig. 7. Expression of endothelial NOS (eNOS; A), COX-1 (B), and COX-2 (C) mRNA in the aorta quantified by quantitative PCR. Data are means ± SE; n = 5–6. *P < 0.05 compared with 3-mo-old; #P < 0.05 compared with 6-mo-old.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
In the present study, we show that in the absence of NO, ROS production induced by COX-derived TXA2 functionally limits endothelial dilation in renal arteries isolated from 6-mo-old mice by decreasing EDHF release and/or efficacy (see Fig. 8). In addition, we have evidence that a change in the redox environment between the ages of 3 and 6 mo is responsible for the expression of TXA2-dependent ROS production. We propose, therefore, that TXA2 production is indicative of the endothelial dysfunction that will develop later with normal aging.


Figure 8
View larger version (23K):
[in this window]
[in a new window]

 
Fig. 8. Proposed mechanism. PLC, phospholipase C; EDHF, endothelium-derived hyperpolarizing factor; IP, PGI2 prostanoid receptor.

 
In renal arteries isolated from 3- and 6-mo-old mice, inhibition of NO production similarly reduced ACh-induced dilation. L-NNA reduced dilation by 25% in 3-mo-old and by 30% in 6-mo-old mice, demonstrating that NO production is not altered between the two groups. Cyclooxygenase inhibition (irrespective of the isoform), however, reestablished the normal dilation only in 6-mo-old mice. This confirms that maturation and aging are associated with changes in the mechanisms involved in the regulation of the vascular reactivity (13). We have previously reported that the P-450 epoxygenase/EDHF pathway was functionally expressed at 12 but not 3 mo of age in the gracilis artery of C57Bl/6 mice (18). In our experiments, in the presence of L-NNA and Indo the dilation at 6 mo old is normal, demonstrating that, in contrast to what we observed at 3 mo, the EDHF pathway is most likely activated and compensates in the absence of NO; Indo, however, needs to be present to reveal the full dilatory potential of the endothelium. Inhibition of NO indeed unmasks the production of TXA2 and ROS-associated production, which limits ACh-induced dilation. Others (4, 12, 14) have reported this phenomenon in vessels isolated from spontaneously hypertensive rats. Addition of Indo alone tended to increase the Emax induced by ACh without altering pD2 (Table 2), suggesting that inhibition of NO stimulates TXA2 production rather than facilitating an already augmented TXA2 production.

Inhibition of either COX-1 or COX-2 maintained the dilation in the presence of L-NNA at 6 mo. We previously showed (13) by Western blot and confocal microscopy that both isoforms are expressed and that the expression of COX-2 is upregulated at 6 mo. Our present data showing that COX-2 mRNA expression is increased at 6 mo compared with 3 mo and that COX-1 is present but stable (Fig. 7) is therefore consistent. Nonetheless, the augmented expression of the COX-2 isoform may be responsible for the functional change in reactivity observed at 6 mo. Both isoforms contribute to the production of TXA2 (6, 21, 27, 28), and recently TXA2 has been associated to atherogenicity in low-density lipoprotein receptor knockout mice (9).

Both TXA2 receptor antagonism and TXA2 synthase inhibition restored the dilation induced by ACh in the presence of L-NNA in renal arteries isolated from 6-mo-old mice. L-NNA leads to an increase in the production and release of TXA2 measured by ELISA in the bathing solution, an effect that was prevented by furegrelate and Indo. Several groups have suggested that an unidentified endothelium-derived constricting factor induced vasoconstriction by acting on the TP receptor (5, 12, 17, 19, 29, 30, 33). Our data extend these earlier findings and demonstrate that TXA2 limits the dilation induced by ACh by acting on its TP receptor, which leads to the production of free radicals. NAC and Cat normalized the dilatory response, mimicking the effects of furegrelate, Indo, and SQ-29548. NAC, a broad ROS scavenger and precursor of glutathione, was more effective in preventing L-NNA-dependent vasoconstriction than Cat; this suggests that binding of TXA2 to its TP receptor induces the release of a precursor of H2O2, likely superoxide. Works by Gao and Lee (11) showed that H2O2 is an endothelium-dependent contracting factor in the rat renal artery. This group also demonstrated that exogenous H2O2-induced contraction was attenuated by antagonism of TP receptors and inhibition of TXA2 synthase, suggesting that H2O2 stimulates TXA2 release. In our experimental conditions, this sequence of events is, however, unlikely, because the TXA2 analog U-46619 induced free radical production, and TP receptor antagonism prevented L-NNA-induced free radical production as well. Others have shown that free radicals are involved in COX-dependent contractions, but in most studies, the contacting factor was not identified and was only observed in pathological models (1, 5, 29, 30, 33). We have no indication that the rise in TXA2-dependent free radical production limits ACh-induced dilation in the presence of L-NNA by constricting the vessels. We previously reported that the P-450 epoxygenase/EDHF pathway was highly sensitive to oxidative stress, which inhibited its dilatory role (18). It is therefore more likely that in our experimental conditions, the increase in TXA2 production stimulates free radical production, inactivating EDHF, which is fully functional after inhibition of the TXA2 pathway (Fig. 8). In support of this proposal, we observed that the increase in basal tone (myogenic response) induced by L-NNA was normalized by Indo but not furegrelate and SQ-29548 (Table 1), demonstrating that other prostaglandins, such as PGH2, constrict the renal artery on NO inhibition but not TXA2 which effect is associated with the rise in free radical production.

To test the hypothesis that a change in the redox environment contributes to TXA2-mediated reduction in dilation to ACh observed in the presence of L-NNA, we treated 3-mo-old mice with the antioxidant catechin for 3 mo. At 6 mo of age, renal arteries isolated from catechin-treated mice responded to ACh by a dilatory response similar to those isolated from untreated mice, both in control conditions and in the presence of L-NNA. Indo, however, did not restore the normal dilatory response to ACh, whereas L-NNA neither increased TXA2 nor free radical production. Hence, catechin prevented the evolutionary change that normally takes place at 6 mo and maintained the profile of dilation observed at 3 mo. The redox environment is therefore changed by catechin, and this has a significant impact on the basal physiology of the renal artery. It has been demonstrated that polyphenols can inhibit superoxide-producing enzymes such as NADPH oxidase (23). Catechin produces similar effects to NAC; because catechin is not known to contribute to the glutathione pathway, the beneficial effects of catechin are likely due to scavenging of ROS (more specifically superoxide) that will reduce H2O2 formation. Polyphenols can improve endothelial function by increasing the production of NO, EDHF, and PGI2 and by inhibiting the production of vasoconstrictors (24). Thus the mechanisms by which catechin improves endothelial function are complex and may involve several vasoprotective pathways, the increase in eNOS expression being one of them.

Myogenic tone was increased but reduced to normal control values by Indo, whereas this latter had no influence on tone in control vessels isolated from untreated mice (Table 1). In addition, L-NNA induced a very potent constriction, which was insensitive to Indo. We do not know the significance of these changes because they were not associated with a change in blood pressure and heart rate. They highlight, however, the fundamental role of free radicals in cellular function: on the one hand, catechin promotes contractile prostanoid production (basal tone), while on the other hand it prevents TXA2 release. The increase in basal tone may be related to the increased expression of COX-2 induced by catechin. Hence, catechin promotes the isomerase/reductase synthase pathway but limits the TXA2 synthase pathway (Fig. 8). We do not know, however, if this is a direct effect of catechin or if it is secondary to the rise in NO production.

The latter experiments suggest also that a change in the redox environment (that is prevented by catechin) appears to increase NO inhibition of TXA2 synthesis. It is paradoxical that this pathway is subsequently responsible for the rise in oxidative stress that will limit the impact of a dilatory pathway (potentially the P-450/EDHF pathway) that itself is expressed in 6- but not 3-mo-old mice. We propose therefore that the increase in TXA2 production revealed by NO synthase inhibition is an early precursor of the future endothelial dysfunction. Endothelial dysfunction of the renal artery appears at the age of 12 mo in C57Bl/6 mice (13). It is important to highlight that these data were collected in the absence of NO synthase activity: under in vivo conditions, changes in dilatory function cannot be observed, demonstrating that the underlying mechanism leading to TXA2 production and oxidative stress through maturation is subtle. The mechanisms sensitive to redox regulation and leading to these changes in the endothelial pathways are, however, unknown.

In conclusion, our data demonstrate that TXA2-induced ROS production functionally limits endothelial dilation in the absence of NO in renal arteries isolated from 6- but not 3-mo-old mice. We propose that a change in the redox environment that can be prevented by catechin increases TXA2 production, which could be indicative of the endothelial dysfunction that develops later with age.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work has been supported in part by the Foundation of the Montreal Heart Institute, the Heart and Stroke Foundation of Quebec, and the Canadian Institute for Health Research (MOP 14496). E. Thorin is a senior scholar of the Fonds de la Recherche en Santé du Québec. M. E. Gendron is supported by a scholarship from the Canadian Institute for Health Research.


    ACKNOWLEDGMENTS
 
We are grateful for the technical assistance of Marc-Antoine Gillis (blood pressure recordings) and Maya Mamarbachi (quantitative PCR).


    FOOTNOTES
 

Address for reprint requests and other correspondence: E. Thorin, Institut de Cardiologie de Montréal, centre de recherche, 5000 rue Bélanger, Montréal, Québec, H1T 1C8, Canada (e-mail: eric.thorin{at}umontreal.ca)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Akamine EH, Urakawa TA, de Oliveira MA, Nigro D, de Carvalho MH, de Cassia ATR, Fortes ZB. Decreased endothelium-dependent vasodilation in diabetic female rats: role of prostanoids. J Vasc Res 43: 401–410, 2006.[CrossRef][Web of Science][Medline]
  2. Angulo J, Cuevas P, Fernandez A, Gabancho S, Allona A, Martin-Morales A, Moncada I, Videla S, Saenz de Tejada I. Diabetes impairs endothelium-dependent relaxation of human penile vascular tissues mediated by NO and EDHF. Biochem Biophys Res Commun 312: 1202–1208, 2003.[CrossRef][Web of Science][Medline]
  3. Auch-Schwelk W, Katusic ZS, Vanhoutte PM. Contractions to oxygen-derived free radicals are augmented in aorta of the spontaneously hypertensive rat. Hypertension 13: 859–864, 1989.[Abstract/Free Full Text]
  4. Auch-Schwelk W, Katusic ZS, Vanhoutte PM. Nitric oxide inactivates endothelium-derived contracting factor in the rat aorta. Hypertension 19: 442–445, 1992.[Abstract/Free Full Text]
  5. Auch-Schwelk W, Katusic ZS, Vanhoutte PM. Thromboxane A2 receptor antagonists inhibit endothelium-dependent contractions. Hypertension 15: 699–703, 1990.[Abstract/Free Full Text]
  6. Bagi Z, Erdei N, Toth A, Li W, Hintze TH, Koller A, Kaley G. Type 2 diabetic mice have increased arteriolar tone and blood pressure: enhanced release of COX-2-derived constrictor prostaglandins. Arterioscler Thromb Vasc Biol 25: 1610–1616, 2005.[Abstract/Free Full Text]
  7. Bolla M, You D, Loufrani L, Levy BI, Levy-Toledano S, Habib A, Henrion D. Cyclooxygenase involvement in thromboxane-dependent contraction in rat mesenteric resistance arteries. Hypertension 43: 1264–1269, 2004.[Abstract/Free Full Text]
  8. Bratz IN, Kanagy NL. Nitric oxide synthase inhibition hypertension is associated with altered endothelial cyclooxygenase function. Am J Physiol Heart Circ Physiol 287: H2394–H2401, 2004.[Abstract/Free Full Text]
  9. Cyrus T, Yao Y, Ding T, Dogne JM, Pratico D. Thromboxane receptor blockade improves the antiatherogenic effect of thromboxane A2 suppression in LDLR KO mice. Blood 109: 3291–3296, 2007.[Abstract/Free Full Text]
  10. Drouin A, Thorin-Trescases N, Hamel E, Falck JR, Thorin E. Endothelial nitric oxide synthase activation leads to dilatory H(2)O(2) production in mouse cerebral arteries. Cardiovasc Res 73: 73–81, 2007.[Abstract/Free Full Text]
  11. Gao YJ, Lee RM. Hydrogen peroxide is an endothelium-dependent contracting factor in rat renal artery. Br J Pharmacol 146: 1061–1068, 2005.[CrossRef][Web of Science][Medline]
  12. Ge T, Hughes H, Junquero DC, Wu KK, Vanhoutte PM, Boulanger CM. Endothelium-dependent contractions are associated with both augmented expression of prostaglandin H synthase-1 and hypersensitivity to prostaglandin H2 in the SHR aorta. Circ Res 76: 1003–1010, 1995.[Abstract/Free Full Text]
  13. Gendron ME, Thorin-Trescases N, Villeneuve L, Thorin E. Aging associated with mild dyslipidemia reveals that COX-2 preserves dilation despite endothelial dysfunction. Am J Physiol Heart Circ Physiol 292: H451–H458, 2007.[Abstract/Free Full Text]
  14. Gluais P, Lonchampt M, Morrow JD, Vanhoutte PM, Feletou M. Acetylcholine-induced endothelium-dependent contractions in the SHR aorta: the Janus face of prostacyclin. Br J Pharmacol 146: 834–845, 2005.[CrossRef][Web of Science][Medline]
  15. Ito T, Kato T, Iwama Y, Muramatsu M, Shimizu K, Asano H, Okumura K, Hashimoto H, Satake T. Prostaglandin H2 as an endothelium-derived contracting factor and its interaction with endothelium-derived nitric oxide. J Hypertens 9: 729–736, 1991.[CrossRef][Web of Science][Medline]
  16. John S, Schmieder RE. Impaired endothelial function in arterial hypertension and hypercholesterolemia: potential mechanisms and differences. J Hypertens 18: 363–374, 2000.[CrossRef][Web of Science][Medline]
  17. Kato T, Iwama Y, Okumura K, Hashimoto H, Ito T, Satake T. Prostaglandin H2 may be the endothelium-derived contracting factor released by acetylcholine in the aorta of the rat. Hypertension 15: 475–481, 1990.[Abstract/Free Full Text]
  18. Krummen S, Drouin A, Gendron ME, Falck JR, Thorin E. ROS-sensitive cytochrome P450 activity maintains endothelial dilatation in ageing but is transitory in dyslipidaemic mice. Br J Pharmacol 147: 897–904, 2006.[CrossRef][Web of Science][Medline]
  19. Luscher TF, Vanhoutte PM. Endothelium-dependent contractions to acetylcholine in the aorta of the spontaneously hypertensive rat. Hypertension 8: 344–348, 1986.[Abstract/Free Full Text]
  20. Nguyen TD, Vequaud P, Thorin E. Effects of endothelin receptor antagonists and nitric oxide on myogenic tone and alpha-adrenergic-dependent contractions of rabbit resistance arteries. Cardiovascular research 43: 755–761, 1999.[Abstract/Free Full Text]
  21. Qi Z, Cai H, Morrow JD, Breyer MD. Differentiation of cyclooxygenase 1- and 2-derived prostanoids in mouse kidney and aorta. Hypertension 48: 323–328, 2006.[Abstract/Free Full Text]
  22. Rapoport RM, Williams SP. Role of prostaglandins in acetylcholine-induced contraction of aorta from spontaneously hypertensive and Wistar-Kyoto rats. Hypertension 28: 64–75, 1996.[Abstract/Free Full Text]
  23. Sarr M, Chataigneau M, Martins S, Schott C, El Bedoui J, Oak MH, Muller B, Chataigneau T, Schini-Kerth VB. Red wine polyphenols prevent angiotensin II-induced hypertension and endothelial dysfunction in rats: role of NADPH oxidase. Cardiovasc Res 71: 794–802, 2006.[Abstract/Free Full Text]
  24. Stoclet JC, Chataigneau T, Ndiaye M, Oak MH, El Bedoui J, Chataigneau M, Schini-Kerth VB. Vascular protection by dietary polyphenols. Eur J Pharmacol 500: 299–313, 2004.[CrossRef][Web of Science][Medline]
  25. Taddei S, Virdis A, Mattei P, Salvetti A. Vasodilation to acetylcholine in primary and secondary forms of human hypertension. Hypertension 21: 929–933, 1993.[Abstract/Free Full Text]
  26. Tesfamariam B. Selective impairment of endothelium-dependent relaxations by prostaglandin endoperoxide. J Hypertens 12: 41–47, 1994.[Web of Science][Medline]
  27. Virdis A, Colucci R, Fornai M, Duranti E, Giannarelli C, Bernardini N, Segnani C, Ippolito C, Antonioli L, Blandizzi C, Taddei S, Salvetti A, Del Tacca M. Cyclooxygenase-1 is involved in endothelial dysfunction of mesenteric small arteries from angiotensin II-infused mice. Hypertension 49: 679–686, 2007.[Abstract/Free Full Text]
  28. Wang D, Chabrashvili T, Wilcox CS. Enhanced contractility of renal afferent arterioles from angiotensin-infused rabbits: roles of oxidative stress, thromboxane prostanoid receptors, and endothelium. Circ Res 94: 1436–1442, 2004.[Abstract/Free Full Text]
  29. Yang D, Feletou M, Boulanger CM, Wu HF, Levens N, Zhang JN, Vanhoutte PM. Oxygen-derived free radicals mediate endothelium-dependent contractions to acetylcholine in aortas from spontaneously hypertensive rats. Br J Pharmacol 136: 104–110, 2002.[CrossRef][Web of Science][Medline]
  30. Yang D, Feletou M, Levens N, Zhang JN, Vanhoutte PM. A diffusible substance(s) mediates endothelium-dependent contractions in the aorta of SHR. Hypertension 41: 143–148, 2003.[Abstract/Free Full Text]
  31. Yang D, Gluais P, Zhang JN, Vanhoutte PM, Feletou M. Endothelium-dependent contractions to acetylcholine, ATP and the calcium ionophore A 23187 in aortas from spontaneously hypertensive and normotensive rats. Fundam Clin Pharmacol 18: 321–326, 2004.[CrossRef][Web of Science][Medline]
  32. Yang D, Gluais P, Zhang JN, Vanhoutte PM, Feletou M. Nitric oxide and inactivation of the endothelium-dependent contracting factor released by acetylcholine in spontaneously hypertensive rat. J Cardiovasc Pharmacol 43: 815–820, 2004.[CrossRef][Web of Science][Medline]
  33. Yang D, Levens N, Zhang JN, Vanhoutte PM, Feletou M. Specific potentiation of endothelium-dependent contractions in SHR by tetrahydrobiopterin. Hypertension 41: 136–142, 2003.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
StrokeHome page
A. Drouin and E. Thorin
Flow-Induced Dilation Is Mediated by Akt-Dependent Activation of Endothelial Nitric Oxide Synthase-Derived Hydrogen Peroxide in Mouse Cerebral Arteries
Stroke, May 1, 2009; 40(5): 1827 - 1833.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/4/H2508    most recent
00352.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gendron, M.-E.
Right arrow Articles by Thorin, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gendron, M.-E.
Right arrow Articles by Thorin, E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.