Am J Physiol Heart Circ Physiol 293: H2719-H2725, 2007.
First published July 27, 2007; doi:10.1152/ajpheart.00637.2007
0363-6135/07 $8.00
Kv1.5 potassium channel gene regulation by Sp1 transcription factor and oxidative stress
Samuel J. Fountain,
Alex Cheong,*
Jing Li,*
Naciye Y. Dondas,
Fanning Zeng,
Ian C. Wood, and
David J. Beech
Institute of Membrane and Systems Biology, University of Leeds, Leeds, United Kingdom
Submitted 3 June 2007
; accepted in final form 23 July 2007
 |
ABSTRACT
|
|---|
KV1.5, a voltage-gated potassium channel, has functional importance in regulating blood vessel tone and cardiac action potentials and is a target for numerous therapeutic drug development programs. Despite the importance of KV1.5, there is little knowledge of the mechanisms controlling expression of its underlying gene, Kcna5. We identified a 5' flanking region of the murine Kcna5 gene that drives expression of a luciferase reporter gene in primary smooth muscle cells and a smooth muscle cell line. The promoter contained CACCC nucleotide motifs, which we have shown to bind the Sp1 transcription factor in the aorta under physiological conditions in vivo. Inhibition of Sp1-Kcna5 promoter interactions using mithramycin A, a dominant-negative Sp1 mutant, or disruption of the CACCC boxes by mutagenesis inhibited promoter activity. Conversely, expression of exogenous Sp1 augmented promoter activity. Sp1 has known sensitivity to oxidative stress and, consistent with this property, Kcna5 promoter activity was suppressed by hydrogen peroxide-induced oxidative stress. Our results show that Kcna5 promoter activity in vascular smooth muscle is critically dependent on Sp1 regulation via CACCC box motifs and identify mechanisms that potentially influence the expression of KV1.5 channel expression in physiological or pathological conditions.
Kcna5; vascular smooth muscle
OVER THE PAST TWENTY YEARS, many mammalian voltage-gated potassium (KV) channel genes have been identified, functionally expressed, and ascribed physiological and pathological roles (30). A KV channel attracting particular attention has been KV1.5, which switches on in response to depolarization past about –40 mV, has moderate-to-slow inactivation, and is regulated by factors, including acid and hydrogen peroxide (9, 48). KV1.5 is perhaps best known in relation to vascular smooth muscle and cardiac muscle (32, 33, 36, 37, 42), but it also occurs in GH3 pituitary cells, tumors, oligodendrocyte precursor cells, macrophages, and somato dendritic Purkinje cells of the cerebellum (12, 14, 38, 41, 52).
Along with other KV1 subunits, KV1.5 has emerged as a regulator of vascular tone, as a tonic hyperpolarizing influence against voltage-dependent Ca2+ entry (3, 4, 10, 11, 33). It shows differentially regulated expression in conduit compared with resistance arteries and in normotensive vs. hypertensive rats (16, 24). Overexpression of KV1.5 induces apoptosis of pulmonary artery smooth muscle cells in culture and reduces pulmonary hypertension in rats (8, 40). KV1.5 expression in vascular smooth muscle cells is inhibited by hypoxia or Bcl-2 (21, 39). In the heart, KV1.5 underlies the ultrarapid delayed rectifier potassium current and has a primary role in controlling action potential repolarization in humans at physiological heart rates (22, 23). Block of KV1.5 has been proposed as a treatment for atrial arrhythmias, and drug development programs are in progress (17). Ventricular KV1.5 expression is dependent on thyroid hormone and suppressed after myocardial infarction (29, 46). Despite the importance of KV1.5, there is little known of the mechanisms regulating expression of the underlying gene, Kcna5. In this study, we focused on mechanisms underlying expression, uncovering a regulatory role for the transcription factor Sp1, and identifying a potential mechanistic link for Kcna5 responses to oxidative stress. Such mechanisms are likely to play important roles in physiological regulation and cardiovascular disease.
Sp1 was identified as a protein factor required for transcription of the simian virus 40 promoter and was the first mammalian transcription factor to be cloned (7, 20). Sp1 clearly has functional importance, because gene disruption in mice is lethal at embryonic day E10.5–11.1 (31). It is a triple zinc finger protein that binds G/C-rich nucleotide sequences, including GC and CACCC boxes (5, 28). Identification of GC/CACCC boxes in many so-called housekeeping genes led to the initial hypothesis that Sp1 is a basal transcription factor. This diffuse concept has, however, been contradicted by subsequent and extensive studies suggesting that Sp1 plays multiple and sophisticated roles as a modulator of tissue-specific transcription (5, 7). Activity of Sp1 shows complex regulation by glycosylation, phosphorylation, oxidative stress, proteolytic cleavage, and other transcription factors, including NF-
B (1, 13).
 |
METHODS
|
|---|
Source of blood vessels.
Experiments were carried out on cell lines and on tissue dissected from animals only after euthanization, according to agreed national procedures within the University's facility. Eight-week-old male C57/BL6 mice were euthanized by CO2 asphyxiation and cervical dissociation carried out in accordance with the Code of Practice UK Animals Scientific Procedures Act 1986, as approved by the University Ethical Review Committee. The thoracic aorta and mesenteric artery (
0.75 and 0.2 mm external diameter, respectively) were removed and placed in ice-cold Hanks' solution. Fat was removed completely by dissection, and blood was flushed from the lumen with Hanks' solution (24).
DNA constructs and mutagenesis.
A 2.5-kb insert containing 5' flanking and UTR sequence was amplified by PCR from a murine BAC clone template using Pfu turbo (Stratagene) and the following primers: forward 5'-TAAGGTACCGGAGGCCTGACTAATGTGC-3' and reverse 5'-GCACTGCCGTTCTCCATGG-3' (the underlined sequence is a linker region with engineered KpnI site). The insert was subcloned into pGL3 basic luciferase vector (Promega) at KpnI/SmaI sites. The insert corresponds to positions –2,299 to +226 bp relative to the Kcna5 transcriptional start site denoted as +1. Truncation to position –1,982 bp was achieved by restriction of an endogenous AseI site followed by blunting and vector religation. Disruption of CACCC box motifs was achieved by triple mutation (CACCC to CAAAA) using mutagenic primers and Quick-Change PCR (Stratagene). Oligonucleotide primers for truncation of insert to positions –1,797 and –1,295 bp and mutagenesis of CACCC box motifs are available on request. Rat Sp1 was in pcDNA3.1. To create Sp1DN (dominant-negative Sp1), Sp1 plasmid was restricted with BamHI followed by religation of the vector (18). All mutations were confirmed by sequencing (Lark).
Cell culture and transfection.
Embryonic rat aortic smooth muscle cells (A7r5, ATCC) and primary unpassaged murine aortic smooth muscle cells were cultured in 10% (vol/vol) FCS DMEM containing 1% (vol/vol) penicillin-streptamycin in a humidified 5% CO2 incubator at 37°C. A7r5 cells were used in passages 2–10. Primary aortic smooth muscle cells were enzymatically isolated from strips of aortic medial layer (24) and cultured for 14 days in six-well plates. Smooth muscle purity was confirmed by immunoreactivity with anti-smooth muscle
-actin. Cells were growth arrested before transfection by complete removal of serum for 24 h. Plasmid DNA was transfected using FuGENE 6 reagent (Roche). One-microgram Kcna5 luciferase construct or empty vector plus 10 ng pCMV-RhL renilla vector (Promega) were transfected per well. Where Sp1 constructs were overexpressed, Sp1 DNA was titrated against empty pcDNA3.1 vector to keep total DNA per transfection constant. Mithramycin A (Sigma) was administered 6 h posttransfection.
Luciferase assay.
Luciferase activity was measured in total cell lysates 48 h posttransfection using PhL Mediators Luminometer and Dual-Luciferase Reporter Assay System (Promega). Luciferase activity was normalized to renilla activity or to total protein, as determined by Bradford assay, where Sp1/Sp1DN were overexpressed.
RT-PCR.
Total RNA extraction and real-time quantitative PCR were performed using methods previously described (19). Total RNA (1 µg) was reverse transcribed using Transcriptor (Roche) and gene-specific priming. PCR primers for detection of mRNA encoding Sp1 were 5' AACCCCACAAGCCCAGAC (forward) and 5' CATGCTTCCCGACGAGT (reverse). PCR product identity was confirmed by sequencing (Lark).
EMSA.
Nuclear extracts were prepared from A7r5 cells using the method described (2). A double-stranded DNA probe containing a generic Sp1-binding sequence (sense strand 5'-3' GATCCCGATCGGGGCGGGGCG) was radioactively labeled and incubated with protein extracts before electrophoresis through a 4% non-denaturing acrylamide gel. Specificity of DNA/protein binding was assessed by including 1 µM double-stranded cold oligonucleotide containing the Sp1 binding sequence, and this was compared with 5 µM of 20-mer oligonucleotides containing each of the three Kcna5 CACCC boxes in turn (see
Fig. 2). The presence of Sp1 protein was determined using anti-Sp1 antibody (Santa Cruz).

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 1. Identification and deletion analysis of Kcna5 promoter element (–2,299 to +226 bp) with constitutive activity. A: Luciferase activity measured from A7r5 or primary aortic smooth cell lysates transfected with luciferase vector containing Kcna5 genomic insert (n = 5). B: effect of genomic insert truncation on constitutive promoter activity in A7r5 and primary aortic smooth muscle cells (n = 4). Luciferase activity is normalized to cells transfected with empty vector. ***P < 0.01 vs. empty vector (A) and vs. full-length promoter (B).
|
|

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 2. Partial murine Kcna5 nucleotide sequence showing three CACCC box motifs (1, 2, and 3) 5' of the transcriptional start site. Nos. refer to the distance, in nucleotides, from the transcriptional start site.
|
|
Chromatin immunoprecipitation.
Mouse aorta smooth muscle cells were isolated and then fixed immediately with 0.37% formaldehyde for 10 min. Chromatin was isolated and sheared by sonication to a median length of 600 bp. Aliquots of chromatin were incubated with either anti-Sp1 antibody (Santa Cruz) or normal goat IgG (Sigma), and immune complexes were precipitated using protein G-Sepharose beads (Pharmacia). After de-cross-linking, proteinase digestion, and purification, the precipitated DNA was analyzed using PCR with specific primer sequences flanking each CACCC box (Fig. 1B). PCR primers for detection of CACCC box 3 were (5'-3') ATGTCACCTGTCACATCC (forward) and GTACAAGAAGGTTGCTGG (reverse).
Data analysis.
Quantified data are means ± SE from three to four independent transfections or cell samples. Statistical analysis was performed by ANOVA and Student's t-test, and differences are indicated for P < 0.05 and P < 0.01. Transcription factor binding sites in nucleotide sequence were predicted using AliBaba2 software and the TRANSFAC database.
 |
RESULTS
|
|---|
Kcna5 promoter activity in vascular smooth muscle cells.
An approximate 2.5-kb section upstream of the mouse Kcna5 gene coding region was isolated. To test for promoter activity in vascular smooth muscle cells, the section was cloned upstream of a firefly luciferase reporter gene and expressed in A7r5 or mouse primary aorta smooth muscle cells. Cells expressing luciferase reporter containing the Kcna5 insert showed four- to fivefold higher luciferase activity compared with cells expressing empty reporter (Fig. 1A), indicating the insert had promoter activity in vascular smooth muscle cells. To ascertain the sections of the promoter important for constitutive activity, a series of truncated promoters were generated. Deletion mutants of the region –2,299 to –1,797 bp caused significant decreases in promoter activity, with removal of the region –2,299 to –1,796 bp causing complete loss of promoter activity in A7r5 and primary smooth muscle cells (Fig. 1B).
Identification of transcription factor binding sites.
In a bioinformatics search for potential transcription factor binding sites, we identified three CACCC box motifs within this critical region at positions –2,105 (site 1), –1,926 (site 2), and –1,826 bp (site 3) (Fig. 2). CACCC boxes are also evident in this region of human and rat Kcna5 (data not shown). To test whether the CACCC boxes in the upstream region contributed to promoter activity, we systematically introduced mutations (CACCC to CAAAA) to disrupt each motif. Disruption of individual motifs lead to significant decreases in promoter activity (Fig. 3); furthermore, disruption of all three CACCC boxes abolished promoter activity in A7r5 cells (see 
Fig. 6D). These data suggest the presence of all three motifs is required for Kcna5 full promoter activity in vascular smooth muscle cells.

View larger version (8K):
[in this window]
[in a new window]
|
Fig. 3. Effect of CACCC box disruption on constitutive promoter activity in A7r5 cells. CACCC boxes were disrupted by mutagenesis to CAAAA (X). Luciferase activity is normalized to cells transfected with empty vector (n = 4). ***P < 0.01 vs. wild-type promoter.
|
|

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 4. Endogenous Sp1 is bound in vivo to the Kcna5 CACCC box domain. A: Sp1 is expressed by A7r5 cells and native arteries. RT-PCR analysis of Sp1 mRNA expression in A7r5, murine aorta, and mesenteric arteries (predicted size 382 bp). Gels show reactions performed in the presence (+) or absence (–) of reverse transcriptase to control for amplification from genomic DNA. B: representative data from an EMSA showing radioactivity of the generic Sp1 oligonucleotide when bound to Sp1 protein in the absence of a competitor probe ("0"), indicated by arrow (i). Confirmation that the bound protein was Sp1 is shown by the supershift in the presence of anti-Sp1 antibody (Ab), indicated by arrow (ii). Cold generic probe competed off the radioactive probe ("Sp1"), as did the Kcna5 CACCC box oligonucleotides in rank order: 3 > 2 > 1 (nos. refer to Fig 2). C: chromatin immunoprecipitation (ChIP) data from freshly isolated murine aortic smooth muscle cells without culture. PCR products were separated by gel electrophoresis and are representative of three PCR reactions for specific primers flanking Kcna5 CACCC box 3 (expected size, 119 bp). The lanes show a paired experiment showing the amount of DNA precipitated by Sp1 Ab compared with the nonspecific effect of control IgG Ab. DNA markers are indicated on the left.
|
|

View larger version (8K):
[in this window]
[in a new window]
|
Fig. 5. Sp1 drives constitutive Kcna5 promoter activity in A7r5 cells. A: concentration-dependent inhibition of full-length, wild-type constitutive Kcna5 promoter activity by mithramycin A. Luciferase activity was measured following mithramycin A treatment and compared with control cells without treatment. Curve was fitted with Hill equation with an IC50 of 47.2 ± 2.5 nM and slope of 3.19 (n = 4). B: effect of dominant-negative Sp1 (Sp1DN) overexpression on constitutive promoter activity. Cells were transfected with full-length, wild-type constitutive Kcna5 promoter construct, with or without 10, 50, or 100 ng Sp1DN (n = 4). ***P < 0.01 vs. empty vector.
|
|

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 6. Exogenous Sp1 enhances Kcna5 promoter activity via CACCC boxes. A: Luciferase activity measured in A7r5 cells transfected with full-length, wild-type Kcna5 genomic insert luciferase construct alone or cotransfected with 10, 50, or 100 ng Sp1 construct (n = 4). Luciferase activity was normalized to promoter activity in the absence of exogenous Sp1. B: mithramycin A inhibits Sp1-evoked promoter activity. Luciferase activity was measured in A7r5 cells cotransfected with wild-type Kcna5 luciferase and 100 ng Sp1 expression plasmid, with or without 100 nM mithramycin A (n = 4). Luciferase was normalized to activity in the absence of mithramycin A and exogenous Sp1. C: overexpression of Sp1DN inhibits Sp1-evoked promoter activity in A7r5 cells. Luciferase activity was measured in cells cotransfected with wild-type Kcna5 genomic insert luciferase construct, 100 ng Sp1, and 10, 50, or 100 ng Sp1DN (n = 4). Luciferase was normalized to cells in the absence of Sp1DN. D: effect of triple CACCC box disruption on Sp1-evoked promoter activity. Luciferase activity was measured in cells cotransfected with wild-type promoter, with or without 100 ng Sp1, and triple CACCC box mutant promoter with 100 ng Sp1 (n = 4). Luciferase was normalized to activity of wild-type promoter in absence of exogenous Sp1. ***P < 0.01 vs. empty vector (A and C), vs. without drug (B), vs. wild-type vector cotransfection (D).
|
|
Sp1 binds CACCC boxes in Kcna5 promoter.
To address whether Sp1 bound to CACCC boxes underlies the Kcna5 promoter activity observed in vascular smooth muscle cells, we first tested whether Sp1 could bind the Kcna5 promoter. Sp1 mRNA expression was detectable in A7r5 and native blood vessels by RT-PCR (Fig. 4A). Endogenous Sp1, from A7r5 nuclear extracts, bound a radioactively labeled DNA probe containing a generic Sp1-binding motif, and the Sp1-probe interaction was confirmed by using anti-Sp1 to supershift the complex (Fig. 4B). The interaction was abolished by competition with unlabeled DNA probe and by probes containing each Kcna5 promoter CACCC box site, revealing an apparent rank order of affinity (site 3 > site 2 > site 1). These data suggest endogenous Sp1 is able to bind the CACCC motifs in the Kcna5 promoter. In addition to this, chromatin immunoprecipitation performed on smooth muscle cells freshly isolated from mouse aorta revealed enrichment of site 3 CACCC box with anti-Sp1 antibody (Fig. 4C), demonstrating that Sp1 is bound at this site in the Kcna5 promoter in aorta under physiological conditions in vivo.
Sp1 drives Kcna5 promoter activity.
We next tested the effect of manipulating Sp1 binding on Kcna5 promoter activity in vascular smooth muscle cells. Mithramycin A, an inhibitor of transcription factor binding to G and/or C-rich motifs, had a concentration-dependent inhibitory effect on Kcna5 promoter activity (IC50 47.2 ± 2.5 nM, n = 4; Fig. 5A). The slope of the mithramycin A concentration-response curve of 3.2 suggested positive cooperativity, consistent with multiple Sp1 binding sites. Furthermore, promoter activity was inhibited by overexpression of Sp1DN, containing the DNA binding but not transactivation domain (Fig. 5B). Overexpression of wild-type Sp1 enhanced promoter activity in a dose-dependent fashion in A7r5 cells (Fig. 6A). Consistent with the mithramycin effect on constitutive promoter activity, mithramycin A also inhibited promoter activity induced by overexpression of wild-type Sp1 (Fig. 6B); methanol vehicle was without effect (data not shown). Sp1-evoked activity was also inhibited by overexpression of Sp1DN (Fig. 6C). Hence, both constitutive and overexpressed Sp1-evoked promoter activity share the same promoter activity and share the same pharmacology, suggesting that constitutive Kcna5 promoter activity in A7r5 cells is driven by Sp1. Most strikingly, Sp1 failed to evoke activity in the CACCC box null promoter, indicating the CACCC boxes are required for Sp1-dependent activity (Fig. 6D).
Oxidative stress attenuates Kcna5 promoter activity.
Finally, we examined the effect of exogenous stimuli of known vascular importance on Sp1-dependent constitutive Kcna5 promoter activity in vascular smooth muscle. The activity of Sp1 is sensitive to oxidative stress, a factor important for vascular physiology. To this end, we tested the effect of hydrogen peroxide on constitutive promoter activity in A7r5 cells. Luciferase activity measured in A7r5 cells expressing the Kcna5 promoter construct was reduced by
50% following treatment with hydrogen peroxide (200 µM, 24 h; n = 4; Fig. 7). Combined with the observation that Sp1 is bound in vivo to Kcna5 promoter, oxidative stress may regulate expression of Kcna5 in native arteries.

View larger version (7K):
[in this window]
[in a new window]
|
Fig. 7. Effect of oxidative stress on Kcna5 promoter activity. Luciferase activity was measured in A7r5 cells expressing wild-type Kcna5 promoter luciferase construct in control cells and cells exposed to hydrogen peroxide (200 µM, 24 h; n = 4, ***P < 0.05). Luciferase activity was normalized to control cells.
|
|
 |
DISCUSSION
|
|---|
Understanding mechanisms that regulate KV1.5 expression in the vasculature is important, because KV1.5 influences smooth muscle tone, has heightened expression in resistance vessels, and is regulated by physiological factors such as hypoxia. Transcriptional regulation of vascular K+ channel genes has been implicated in several physiological and pathological situations, e.g., regulation by oxygen tension (35, 43, 51) and differential expression of KV mRNAs in normotensive vs. hypertensive arteries (15). Experimental manipulation of KV channel expression can also have significant effects on blood vessel physiology (40). These data presented here identify promoter/transcription factor interactions important in regulation of the KV1.5 potassium channel gene Kcna5. Combined deletion, site-directed mutagenesis, and pharmacological approaches lead us to conclude that a CACCC box cluster is a critical element driving Kcna5 expression. We show the cluster is a target for Sp1 transcription factor, which enhances the promoter activity in a CACCC box-dependent manner. Furthermore, a Sp1DN mutant inhibits constitutive activity, and endogenous Sp1 binds the Kcna5 CACCC box cluster. Therefore, a molecular component underlying constitutive Kcna5 gene expression is suggested. Furthermore, the interaction may be a mechanism for regulated expression, because constitutive activity is modest but enhanced by addition of exogenous Sp1, Sp1 is bound to Kcna5 physiologically, and promoter activity is inhibited by oxidative stress evoked by hydrogen peroxide.
Our mutagenesis data indicate all three CACCC boxes within the cluster contribute to constitutive promoter activity, a conclusion strengthened by the Hill coefficient of >1 in the mithramycin A concentration-response curve. Nevertheless, gradation of binding efficiency is also evident, with the site 3 CACCC box having the strongest association. Therefore, we hypothesize that elevation of Sp1 activity will progressively increase binding to all three boxes, further increasing expression of Kcna5. This raises the possibility that Sp1 regulation of Kcna5 is, physiologically, in a constitutive but not maximal state of activation, i.e., it is in a state suitable for dynamic regulation. Activity of Sp1 is regulated by a range of factors (1, 13), and a clear candidate for regulation of the Sp1-dependent promoter of Kcna5 is oxidative stress, because promoter activity is sensitive to hydrogen peroxide. Hydrogen peroxide is a physiological vasodilator that enhances KV currents in both conduit and resistance arteries (25, 44). It is, therefore, interesting that hydrogen peroxide can also regulate KV activity at the transcriptional level, which may have vascular implications during prolonged states of oxidative stress, e.g., hypoxia. The concentration of hydrogen peroxide used in this study (200 µM) reflects the concentration required to produce maximal vasodilatation in several arterial preparations (19, 27, 45). Unfortunately, we were unable to test the effects of oxidative stress on Kcna5 expression in the aorta, because there is rapid, spontaneous downregulation of Kcna5 expression once the vessel is dissected from the animal (J. Li and D. J. Beech, unpublished observations). It should be recognized that there are other potential regulators of Kcna5 expression. KV1.5 mRNA abundance is known to be regulated by thyrotropin-releasing hormone, insulin-like growth factor-1, Bcl-2 oncoprotein, c-Jun immediate early gene, chronic hypoxia, cyclic AMP, and glucocorticoids (21, 34, 39; for further references, see Ref. 24).
We have focused on Sp1, but it is premature to exclude the possibility that other related factors also interact with the CACCC boxes of the Kcna5 promoter. Sp1 is part of a large family of proteins, including other Sp factors and the extensive set of Kruppel-like factors (5, 7, 47, 49). Some of these other factors, Kruppel-like factor 5, for example, are expressed and functionally important in the cardiovascular system (47). These factors might have a greater influence than Sp1 on Kcna5 CACCC boxes, either as coactivators, or dominant-negative competitors with Sp1. To the best of our knowledge, identification of the CACCC box motif as a functional determinant of ion channel expression is novel in the field of ion channel research and should provide a foundation for future studies with a wider scope involving other Sp1-like factors.
A few studies have previously explored Kcna5 gene regulation in cardiac myocytes and GH3 pituitary cells, showing that expression also involves a novel silencing element and binding factor (50). This site is distinct and downstream from the CACCC box cluster. Kcna5 mRNA levels are also known to be regulated by cyclic AMP and tyrosine phosphorylation (26, 34).
In summary, we propose a mechanism whereby endogenous Sp1 factor is functionally involved in conferring constitutive expression of Kcna5 gene. Sp1 was once regarded as a simple basal transcription factor, underlying constitutive expression of many genes. However, it is emerging as a factor with intrinsic specificity, as well as highly dynamic regulation. It has the potential to be a focal point for understanding the physiological control of KV1.5 potassium channel gene expression in the cardiovascular system.
 |
GRANTS
|
|---|
This work was supported by the Medical Research Council (UK), British Heart Foundation, and the Wellcome Trust.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: D. J. Beech, Institute of Membrane & Systems Biology, Garstang Bldg., Faculty of Biological Sciences, Univ. of Leeds, Leeds, LS2 9JT UK (e-mail: d.j.beech{at}leeds.ac.uk)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
* A. Cheong and J. Li contributed equally to this work. 
 |
REFERENCES
|
|---|
- Ammendola R, Mesuraca M, Russo T, Cimino F. The DNA-binding efficiency of Sp1 is affected by redox changes. Eur J Biochem 225: 483–489, 1994.[Web of Science][Medline]
- Andrews NC, Faller DV. A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res 19: 2499, 1991.[Free Full Text]
- Archer SL, Souil E, Dinh-Xuan AT, Schremmer B, Mercier JC, El Yaagoubi A, Nguyen-Huu L, Reeve HL, Hampl V. Molecular identification of the role of voltage-gated K+ channels, Kv1.5 and Kv2.1, in hypoxic pulmonary vasoconstriction and control of resting membrane potential in rat pulmonary artery myocytes. J Clin Invest 101: 2319–2330, 1998.[Web of Science][Medline]
- Beech DJ, Cheong A, Rusch NJ. Regulation of arterial tone by KV1 potassium channels. Circ Res 96: e58, 2005.[Free Full Text]
- Black AR, Black JD, Azizkhan-Clifford J. Sp1 and kruppel-like factor family of transcription factors in cell growth regulation and cancer. J Cell Physiol 188: 143–160, 2001.[CrossRef][Web of Science][Medline]
- Blume SW, Snyder RC, Ray R, Thomas S, Koller CA, Miller DM. Mithramycin inhibits SP1 binding and selectively inhibits transcriptional activity of the dihydrofolate reductase gene in vitro and in vivo. J Clin Invest 88: 1613–1621, 1991.[Web of Science][Medline]
- Bouwman P, Philipsen S. Regulation of the activity of Sp1-related transcription factors. Mol Cell Endocrinol 195: 27–38, 2002.[CrossRef][Web of Science][Medline]
- Brevnova EE, Platoshyn O, Zhang S, Yuan JX. Overexpression of human Kcna5 increases IK V and enhances apoptosis. Am J Physiol Cell Physiol 287: C715–C722, 2004.[Abstract/Free Full Text]
- Caouette D, Dongmo C, Berube J, Fournier D, Daleau P. Hydrogen peroxide modulates the Kv1.5 channel expressed in a mammalian cell line. Naunyn Schmiedebergs Arch Pharmacol 368: 479–486, 2003.[CrossRef][Web of Science][Medline]
- Chen TT, Luykenaar KD, Walsh EJ, Cole WC. Key role of Kv1 channels in vasoregulation. Circ Res 99: 53–60, 2006.[Abstract/Free Full Text]
- Cheong A, Dedman AM, Beech DJ. Expression and function of native potassium channel KV1 subunits in terminal arterioles of rabbit
. J Physiol 534: 691–700, 2001.[Abstract/Free Full Text] - Chittajallu R, Chen Y, Wang H, Yuan X, Ghiani CA, Heckman T, McBain CJ, Gallo V. Regulation of Kv1 subunit expression in oligodendrocyte progenitor cells and their role in G1/S phase progression of the cell cycle. Proc Natl Acad Sci USA 99: 2350–2355, 2002.[Abstract/Free Full Text]
- Chu S, Ferro TJ. Identification of a hydrogen peroxide-induced PP1-JNK1-Sp1 signaling pathway for gene regulation. Am J Physiol Lung Cell Mol Physiol 291: L983–L992, 2006.[Abstract/Free Full Text]
- Chung YH, Shin C, Kim MJ, Lee BK, Cha CI. Immunohistochemical study on the distribution of six members of the Kv1 channel subunits in the rat cerebellum. Brain Res 895: 173–177, 2001.[CrossRef][Web of Science][Medline]
- Cox RH, Folander K, Swanson R. Differential expression of voltage-gated K(+) channel genes in arteries from spontaneously hypertensive and Wistar-Kyoto rats. Hypertension 37: 1315–1322, 2001.[Abstract/Free Full Text]
- Cox RH, Rusch NJ. New expression profiles of voltage-gated ion channels in arteries exposed to high blood pressure. Microcirculation 9: 243–257, 2002.[CrossRef][Web of Science][Medline]
- Decher N, Kumar P, Gonzalez T, Pirard B, Sanguinetti MC. Binding site of a novel Kv1.5 blocker: a "foot in the door" against atrial fibrillation. Mol Pharmacol 70: 1204–1211, 2006.[Abstract/Free Full Text]
- Doetzlhofer A, Rotheneder H, Lagger G, Koranda M, Kurtev V, Brosch G, Wintersberger E, Seiser C. Histone deacetylase 1 can repress transcription by binding to Sp1. Mol Cell Biol 19: 5504–5511, 1999.[Abstract/Free Full Text]
- Drouin A, Thorin-Trescases N, Hamel E, Falck J, Thorin E. Endothelial nitric oxide synthase activation leads to dilatory H2O2 production in mouse cerebral arteries. Cardiovasc Res 73: 73–81, 2007.[Abstract/Free Full Text]
- Dynan WS, Tjian R. Isolation of transcription factors that discriminate between different promoters recognized by RNA polymerase II. Cell 32: 669–680, 1983.[CrossRef][Web of Science][Medline]
- Ekhterae D, Platoshyn O, Krick S, Yu Y, McDaniel SS, Yuan JXJ. Bcl-2 decreases voltage-gated K+ channel activity and enhances survival in vascular smooth muscle cells. Am J Physiol Cell Physiol 281: C157–C165, 2001.[Abstract/Free Full Text]
- Fedida D, Chen FS, Zhang X. The 1997 Stevenson Award Lecture. Cardiac K+ channel gating: cloned delayed rectifier mechanisms and drug modulation. Can J Physiol Pharmacol 76: 77–89, 1998.[CrossRef][Web of Science][Medline]
- Feng J, Wible B, Li GR, Wang Z, Nattel S. Antisense oligodeoxynucleotides directed against Kv1.5 mRNA specifically inhibit ultrarapid delayed rectifier K+ current in cultured adult human atrial myocytes. Circ Res 80: 572–579, 1997.[Abstract/Free Full Text]
- Fountain SJ, Cheong A, Flemming R, Mair L, Sivaprasadarao A, Beech DJ. Functional up-regulation of KCNA gene family expression in murine mesenteric resistance artery smooth muscle. J Physiol 556: 29–42, 2004.[Abstract/Free Full Text]
- Gao YJ, Hirota S, Zhang DW, Janssen LJ, Lee RMKW. Mechanisms of hydrogen-peroxide-induced biphasic response in rat mesenteric artery. Br J Pharmacol 138: 1085–1092, 2003.[CrossRef][Web of Science][Medline]
- Hershman KM, Levitan ES. RPTPmu and protein tyrosine phosphorylation regulate K+ channel mRNA expression in adult cardiac myocytes. Am J Physiol Cell Physiol 278: C397–C403, 2000.[Abstract/Free Full Text]
- Iida Y, Katusic ZS. Mechanisms of cerebral arterial relaxations to hydrogen peroxide. Stroke 31: 2224–2230, 2000.[Abstract/Free Full Text]
- Kadonaga JT, Carner KR, Masiarz FR, Tjian R. Isolation of cDNA encoding transcription factor Sp1 and functional analysis of the DNA binding domain. Cell 51: 1079–1090, 1987.[CrossRef][Web of Science][Medline]
- Le Bouter S, Demolombe S, Chambellan A, Bellocq C, Aimond F, Toumaniantz G, Lande G, Siavoshian S, Baró I, Pond AL, Nerbonne JM, Léger JJ, Escande D, Charpentier F. Microarray analysis reveals complex remodeling of cardiac ion channel expression with altered thyroid status: relation to cellular and integrated electrophysiology. Circ Res 92: 234–242, 2003.[Abstract/Free Full Text]
- Li B, Gallin WJ. VKCDB: voltage-gated potassium channel database. BMC Bioinformatics 5: 3, 2004.[CrossRef][Medline]
- Marin M, Karis A, Visser P, Grosveld F, Philipsen S. Transcription factor Sp1 is essential for early embryonic development but dispensable for cell growth and differentiation. Cell 89: 619–628, 1997.[CrossRef][Web of Science][Medline]
- Mays DJ, Foose JM, Philipson LH, Tamkun MM. Localization of the Kv1.5 K+ channel protein in explanted cardiac tissue. J Clin Invest 96: 282–292, 1995.[Web of Science][Medline]
- McGahon MK, Dawicki JM, Arora A, Simpson DA, Gardiner TA, Stitt AW, Scholfield CN, McGeown JG, Curtis TM. Kv1.5 is a major component underlying the A-type potassium current in retinal arteriolar smooth muscle. Am J Physiol Heart Circ Physiol 292: H1001–H1008, 2007.[Abstract/Free Full Text]
- Mori Y, Matsubara H, Folco E, Siegel A, Koren G. The transcription of a mammalian voltage-gated potassium channel is regulated by cAMP in a cell-specific manner. J Biol Chem 268: 26482–26493, 1993.[Abstract/Free Full Text]
- Navarro-Antolin J, Levitsky KL, Ordóñez CEA, López-Barneo J. Decreased expression of maxi-K+ channel beta1-subunit and altered vasoregulation in hypoxia. Circulation 112: 1309–1315, 2005.[Abstract/Free Full Text]
- Nielsen NH, Winkel BG, Kanters JK, Schmitt N, Hofman-Bang J, Jensen HS, Bentzen BH, Sigurd B, Larsen LA, Andersen PS, Haunsø S, Kjeldsen K, Grunnet M, Christiansen M, Olesen SP. Mutations in the Kv1.5 channel gene Kcna5 in cardiac arrest patients. Biochem Biophys Res Commun 354: 776–782, 2007.[CrossRef][Web of Science][Medline]
- Olson TM, Alekseev AE, Liu XK, Park S, Zingman LV, Bienengraeber M, Sattiraju S, Ballew JD, Jahangir A, Terzic A. Kv1.5 channelopathy due to Kcna5 loss-of-function mutation causes human atrial fibrillation. Hum Mol Genet 15: 2185–2191, 2006.[Abstract/Free Full Text]
- Park SA, Lee YC, Ma TZ, Park JA, Han MK, Lee HH, Kim HG, Kwak YG. hKv1.5 channels play a pivotal role in the functions of human alveolar macrophages. Biochem Biophys Res Commun 346: 567–571, 2006.[CrossRef][Web of Science][Medline]
- Platoshyn O, Brevnova EE, Burg ED, Yu Y, Remillard CV, Yuan JXJ. Acute hypoxia selectively inhibits Kcna5 channels in pulmonary artery smooth muscle cells. Am J Physiol Cell Physiol 290: C907–C916, 2006.[Abstract/Free Full Text]
- Pozeg ZI, Michelakis ED, McMurtry MS, Thébaud B, Wu XC, Dyck JRB, Hashimoto K, Wang S, Moudgil R, Harry G, Sultanian R, Koshal A, Archer SL. In vivo gene transfer of the O2-sensitive potassium channel Kv1.5 reduces pulmonary hypertension and restores hypoxic pulmonary vasoconstriction in chronically hypoxic rats. Circulation 107: 2037–2044, 2003.[Abstract/Free Full Text]
- Preussat K, Beetz C, Schrey M, Kraft R, Wölfl S, Kalff R, Patt S. Expression of voltage-gated potassium channels Kv1.3 and Kv15 in human gliomas. Neurosci Lett 346: 33–36, 2003.[CrossRef][Web of Science][Medline]
- Remillard CV, Tigno DD, Platoshyn O, Burg ED, Brevnova EE, Conger D, Nicholson A, Rana BK, Channick RN, Rubin LJ, O'Connor DT, Yuan JXJ. Function of Kv1.5 channels and genetic variations in Kcna5 in patients with idiopathic pulmonary arterial hypertension. Am J Physiol Cell Physiol 292: C1837–C1853, 2007.[Abstract/Free Full Text]
- Resnik E, Herron J, Fu R, Ivy DD, Cornfield DN. Oxygen tension modulates the expression of pulmonary vascular BKCa channel alpha- and beta-subunits. Am J Physiol Lung Cell Mol Physiol 290: L761–L768, 2006.[Abstract/Free Full Text]
- Rogers PA, Chilian WM, Bratz IN, Bryan RM Jr, Dick GM. H2O2 activates redox- and 4-aminopyridine-sensitive Kv channels in coronary vascular smooth muscle. Am J Physiol Heart Circ Physiol 292: H1404–H1411, 2007.[Abstract/Free Full Text]
- Rogers PA, Dick GM, Knudson JD, Focardi M, Bratz IN, Swafford AN Jr, Saitoh S, Tune JD, Chilian WM. H2O2-induced redox-sensitive coronary vasodilation is mediated by 4-aminopyridine-sensitive K+ channels. Am J Physiol Heart Circ Physiol 291: H2473–H2482, 2006.[Abstract/Free Full Text]
- Rossow CF, Minami E, Chase EG, Murry CE, Santana LF. NFATc3-induced reductions in voltage-gated K+ currents after myocardial infarction. Circ Res 94: 1340–1350, 2004.[Abstract/Free Full Text]
- Shindo T, Manabe I, Fukushima Y, Tobe K, Aizawa K, Miyamoto S, Kowase KK, Moriyama N, Imai Y, Kawakami H, Nishimatsu H, Ishikawa T, Suzuki T, Morita H, Maemura K, Sata M, Hirata Y, Komukai M, Kagechika H, Kadowaki T, Kurabayashi M, Nagai R. Kruppel-like zinc-finger transcription factor KLF5/BTEB2 is a target for angiotensin II signaling and an essential regulator of cardiovascular remodeling. Nat Med 8: 856–863, 2002.[Web of Science][Medline]
- Steidl JV, Yool AJ. Differential sensitivity of voltage-gated potassium channels Kv1.5 and Kv1.2 to acidic pH and molecular identification of pH sensor. Mol Pharmacol 55: 812–820, 1999.[Abstract/Free Full Text]
- Turner J, Crossley M. Mammalian Kruppel-like transcription factors: more than just a pretty finger. Trends Biochem Sci 24: 236–240, 1999.[CrossRef][Web of Science][Medline]
- Valverde P, Koren G. Purification and preliminary characterization of a cardiac Kv1.5 repressor element binding factor. Circ Res 84: 937–944, 1999.[Abstract/Free Full Text]
- Wang J, Weigand L, Wang W, Sylvester JT, Shimoda LA. Chronic hypoxia inhibits Kv channel gene expression in rat distal pulmonary artery. Am J Physiol Lung Cell Mol Physiol 288: L1049–L1058, 2005.[Abstract/Free Full Text]
- Wulfsen I, Hauber HP, Schiemann D, Bauer CK, Schwarz JR. Expression of mRNA for voltage-dependent and inward-rectifying K channels in GH3/B6 cells and rat pituitary. J Neuroendocrinol 12: 263–272, 2000.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
A. A. Tobin, B. K. Joseph, H. N. Al-Kindi, S. Albarwani, J. A. Madden, L. T. Nemetz, N. J. Rusch, and S. W. Rhee
Loss of cerebrovascular Shaker-type K+ channels: a shared vasodilator defect of genetic and renal hypertensive rats
Am J Physiol Heart Circ Physiol,
July 1, 2009;
297(1):
H293 - H303.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2007 by the American Physiological Society.