AJP - Heart Calcium Transients and Cell-Sarcomere
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 293: H2836-H2844, 2007. First published August 17, 2007; doi:10.1152/ajpheart.00472.2007 Free Article
0363-6135/07 $8.00
This Article
Free upon publication Free Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/5/H2836    most recent
00472.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via ISI Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, W. Q.
Right arrow Articles by Zhang, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, W. Q.
Right arrow Articles by Zhang, Y.

Prediction of atherosclerotic plaque ruptures with high-frequency ultrasound imaging and serum inflammatory markers

Wen Qiang Chen,1,* Lei Zhang,1,* Yun Fang Liu,1,* Liang Chen,1 Xiao Ping Ji,1 Mei Zhang,1 Yu Xia Zhao,1 Gui Hua Yao,1 Cheng Zhang,1 Xing Li Wang,2 and Yun Zhang1

1The Key Laboratory of Cardiovascular Remodeling and Function Research, Chinese Ministry of Education and Chinese Ministry of Health, Shandong University Qilu Hospital, Jinan, Shandong, China; and 2Texas Heart Institute at St Luke's Episcopal Hospital, Division of Cardiothoracic Surgery, Michael E. DeBakey Department of Surgery, Baylor College of Medicine, Houston, Texas

Submitted 19 April 2007 ; accepted in final form 8 August 2007


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Atherosclerotic plaque rupture and thrombosis are the main causes of acute coronary syndrome. In the present study, we investigated whether ultrasound imaging and inflammatory parameters are predictive of plaque rupture in a newly established animal model. We developed a rabbit model for plaque rupture by locally delivering recombinant p53 adenovirus to plaques in rabbits fed a high-cholesterol diet for 10 wk, and plaque rupture was triggered using Chinese Russell's viper venom and histamine. We found that 81.1% of rabbits transfected with p53 (n = 37) had the ruptured plaques, which was significantly higher than results in rabbits transfected with the control vector (26.3%, n = 38; P < 0.001). Among measured biomarkers, high-sensitive C-reactive protein, soluble intercellular adhesion molecule-1, and soluble vascular cell adhesion molecule-1 were significantly different between rabbits with and without ruptured plaques. Using high-frequency duplex and intravascular ultrasound imaging techniques, we obtained a list of parameters. With the multivariate logistic regression model, we identified that plaque eccentric index, plaque area, high-sensitive C-reactive protein, and corrected integrated backscatter intensity were significant predictors of plaque rupture, with odds ratios of 7.056 [95% confidence interval (CI): 1.958, ~25.430], 1.942 (95% CI: 1.058, ~3.564), 1.025 (95% CI: 1.007, ~1.043), and 0.856 (95% CI: 0.775, ~0.946), respectively. Localized p53 overexpression technique induces plaque rupture, and the combined measurement of ultrasound and biochemical markers is a valuable tool in predicting plaque rupture.

atherosclerosis; vulnerable plaque; p53; biomarkers


ATHEROSCLEROTIC PLAQUE RUPTURE is the major cause of acute coronary syndrome (ACS) (4, 9).A plaque with a thin cap, a large lipid core, and abundant activated macrophages has been generally regarded as unstable and vulnerable to rupture. Although early detection or prevention would be the only way to reduce the risk of this catastrophic life-threatening event, there is frustratingly little progress in either. Lack of suitable animal models has considerably hampered the research progress in understanding molecular events occurring in the development of plaque rupture. It remains unclear what morphological and biochemical features will best predict plaque rupture and which in vivo diagnostic technologies would reliably predict the pathological and clinical courses of an unstable plaque. Currently, most factors found to be associated with plaque rupture and ensuing thrombosis in ACS are derived from cross-sectional retrospective rather than prospective studies (3, 22, 29).

Recently, a variety of imaging techniques, including high-frequency duplex ultrasound, intravascular ultrasound (IVUS), IVUS elastography, coronary angioscopy, magnetic resonance imaging, and optical coherence tomography, have been reported to potentially detect vulnerable plaques (10, 17, 21, 24, 3032). Among these techniques, ultrasound imaging has the advantages of being widely available and capable of displaying morphology of plaques, as well as the entire vessel. In addition to the imaging information, certain biomarkers, such as inflammatory markers, have also been suggested to be associated with ACS. However, whether these markers can prospectively predict plaque rupture is still unknown.

In the present study, we developed a novel animal model using the localized p53 overexpression technique in rabbits fed atherogenic diet. Using this animal model, we investigated circulating biochemical markers that might be predictive of the unstable plaque that ruptures under stimulation and the ultrasound-based imaging technology and hemodynamic parameters that may predict such progression. Using a multivariate logistic regression model, we evaluated the factors that could best predict the dynamic process.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animal Model

Although the apolipoprotein E–/– mouse model has been used to successfully generate ruptured plaque in the laboratory setting (15), it is unsuitable for IVUS diagnosis because of the small size of the blood vessels. Therefore, we developed the unstable plaque model in rabbits.

Ninety male New Zealand White rabbits weighing ~1.5–2.5 kg were divided into an intervention group (group A, n = 80) and a control group (group B, n = 10). The aortic wall injuries were induced by an intravascular balloon in group A rabbits before they were fed an atherogenic diet containing 1% cholesterol (~120–140 g/day) for 8 wk. At the end of the 8th wk, balloon-induced aortic wall injury was performed with a 4-Fr balloon catheter (3.5 x 15 mm2) introduced through the right femoral artery to the thoracic aorta after rabbits had been anesthetized with an intravenous injection of pentobarbital sodium (30 mg/kg). The balloon was inflated with saline to obtain 8 atm, and the catheter was retracted down to the iliofemoral artery. This process was repeated three times in each rabbit to ensure denudation of the endothelium of the abdominal aorta. Half of these rabbits (group A1, n = 40, selected randomly) were injected with adenoviral vector containing recombinant p53, and the other half (group A2, as the vehicle control) were injected with adenoviral vector containing recombinant beta-galactosidase, as described previously (6). In brief, 10 µl of recombinant adenovirus suspension (1.5 x 1010 pfu/ml replication-defective adenovirus vector Ad5-p53 and 1.5 x 1010 pfu/ml Ad5-LacZ) were injected through a catheter into the abdominal aortic segments rich in atheromatic plaques, which were mainly located between the right renal and the common iliac arteries. The suspension was left in situ for 10 min after the temporary ligation of the aortic segment. The site of injection was marked with a nesis, and the abdominal cavity was closed. These rabbits were maintained on high-cholesterol diet for an additional 2 wk. In contrast, rabbits in group B were only fed atherogenic diet containing 1% cholesterol (~120–140 g/day) for 10 wk.

At the end of the total 10-wk dietary challenge, plaque rupture was induced in all rabbits by pharmacological triggers using the method described by Constantinides and Chakravarti (8). In brief, 0.15 mg/kg Chinese Russell's viper venom (Snake Venom Institute of Guangzhou) was injected intraperitoneally. Thirty minutes after the injection, 0.02 mg/kg histamine (Sigma) was given intravenously. Rabbits were euthanized 24–48 h after the above procedure.

All animal care and experimental protocols complied with the Animal Management Rule of the Ministry of Public Health, People's Republic of China (documentation 55, 2001), and were approved by the Animal Care Committee of Shandong University.

Biochemical Studies

At the beginning of the experiment and the end of week 10, blood samples were collected from all rabbits. Serum samples were stored at –80°C for 10 wk before assay. Serum levels of total cholesterol (TC), triglyceride (TG), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C) were measured by enzymatic assays, and the level of fibrinogen was measured by the immunonephelometry method. C-reactive protein was assayed with a highly sensitive ELISA kit (Diagnostic System Laboratory). Measurements of soluble vascular cell adhesion molecule-1 (sVCAM-1) and intercellular adhesion molecule-1 (sICAM-1) were performed with ELISA kits (Bionewtrans Pharmaceutical Biotechnology).

Ultrasonographic Studies

Aortic ultrasonography and Doppler measurements. The abdominal aorta was scanned with a high-frequency duplex ultrasonographic system (HP SONOS 5500) and a 7.5-MHz transducer before and after the pharmacological triggering. The aortic longitudinal and transversal axis views were obtained; aortic end-diastolic diameter, end-systolic diameter, and intima-media thickness (IMT) were measured. Doppler flow measurement was performed to derive the aortic peak velocity, mean velocity, and velocity-time integral.

Ultrasonic integrated backscatter analysis. Ultrasonic integrated backscatters (IBS) from the aortic wall and atherosclerotic plaques were analyzed by the acoustic densitometry technique. The average ultrasonic intensities (AII) of aortic intima and adventitia in normal segments and atherosclerotic plaques were measured, and the corrected AII (AIIc%) was derived by calculating the ratio of AII of the intima to AII of the adventitia.

IVUS studies. IVUS studies were performed three times: at the end of week 8 before gene transfer and at the end of week 10 before and after pharmacological triggering using a 3.2-Fr catheter containing a single rotating element transducer of 40 MHz connected to an IVUS system (Galaxy, Boston Scientific). After the aortic arch was reached, the catheter was withdrawn by a motorized pullback device at a constant speed of 0.5 mm/s. The following parameters were measured from cross-sectional images: external elastic membrane area (EEMA), lumen area (LA), plaque area (PA = EEMA – LA), plaque burden (PB% = PA/EEMA x 100%), lumen eccentricity index [EI = (TmaxTmin)/Tmax, where Tmax is the maximal thickness of plaques and Tmin is the minimal thickness of plaques], and, finally, remodeling index (RI), which was calculated as EEMA at the lesion segment/EEMA at the reference segment. The segments proximal and distal to the plaque with the least lesion and the largest LA within a 10-mm distance from the plaque were regarded as the reference segments, and the mean EEMA derived from both reference segments was calculated. In the present study, plaques with EI >0.5 were regarded as eccentric plaques, otherwise as concentric plaques. Similarly, RI >1.05 was regarded as positive remodeling, RI = ~0.95–1.05 as no remodeling, and RI <0.95 as negative remodeling (13). Plaque rupture was diagnosed by visualizing an echolucent zone within a plaque, separated from the lumen by a thin echo-reflecting structure representing the fibrous cap. Intraluminal thrombus depicted intense granular or finely speckling echo reflections that scintillate during real-time imaging and appear mobile with blood flow (11). The IVUS images were reviewed by two independent observers, and the values were averaged for data analyses.

Interobserver and Intraobserver Variabilities

To assess the interobserver and intraobserver variabilities in measurements of ultrasound and IVUS imaging and biochemical assays, 10 rabbits were randomly chosen for determining the variability of AIIc%, EEMA, LA, EI, TC, TG, HDL-C, LDL-C, sVCAM-1, sICAM-1, and high-sensitive C-reactive protein (hsCRP). The interobserver variability was calculated from repeated measurements by two independent observers, and the intraobserver variability was calculated from repeated measurements by one observer who measured twice, 1 wk apart. Variability was expressed as the percentage of the absolute difference between two measurements divided by the mean value of the two measurements.

Histopathological Analysis

Histopathology. Euthanasia was conducted via an overdose of intravenous pentobarbital. The abdominal aorta was dissected and excised to observe the occurrence of plaque rupture and thrombosis. A gauge was used to measure the length and cross-sectional area of the thrombus. Tissue samples (1 cm in length) were taken from the Ad5-LacZ-injected and Ad5-p53-injected segments and corresponding aortic segments in group B and were fixed overnight in 10% formalin. Serial 5-µm-thick tissue sections were processed for hematoxylin and eosin staining and Masson trichrome staining. Plaque rupture was defined as fibrous cap disruption with overlying thrombus based on histopathological observations.

Immunohistochemistry. After being fixed in formalin and embedded in paraffin, tissue samples from the abdominal aorta were cut into serial 5-µm-thick sections and reacted with mouse anti-human p53 monoclonal antibody (PAb1801; Sigma), mouse anti-rabbit {alpha}-smooth muscle cell actin monoclonal antibody (Sigma), mouse anti-human matrix metalloproteinases-1 (MMP-1) (Santa Cruz), and mouse anti-rabbit macrophage RAM11 monoclonal antibody (Dako). beta-Galactosidase was revealed by incubation with x-gal at 37°C for 4 h. Positive staining was counted and expressed as mean percentage of the PA in at least 10 high-power fields (x400 magnification) by use of an automated image analysis system (Image-Pro Plus 5.0, Media Cybernetics).

Real-Time RT-PCR

Tissue samples were frozen with liquid nitrogen. Total RNA was extracted, and mRNA expression of p53 in plaques was examined by quantitative real-time RT-PCR with use of LightCycler (Roche Applied Science), per the manufacturer's instructions. The mRNA sequences were obtained from GenBank. Quantitative values were obtained from the threshold cycle value, the point at which a significant increase of fluorescence is first detected. The transcript number of GAPDH was quantified as an internal control. Experiments were performed in triplicate for each data point. The data were analyzed with the method as described by Livak and Schmittgen (19). The results of RT-PCR were confirmed by gel electrophoresis. The forward and reverse primer sequences used were GCGCACAGAGGAAGAGAATC and GGCCAACTTGTTCAGTGGAG, respectively. The size was 501 bp.

Quantification of Apoptosis

Terminal deoxynucleotidyl transferase end-labeling staining. Apoptosis was assessed by terminal deoxynucleotidyl transferase end-labeling (TUNEL; Calbiochem) staining. Only TUNEL-positive nuclei with morphological features of apoptosis, including cell shrinkage, nuclear pyknosis, chromatin condensation, and nuclear fragmentation, were included. Counterstaining of the nucleus involved methyl green. The apoptosis rate was calculated as the proportion of apoptotic cells to total number of cells in a given area.

Flow cytometry analysis. Vascular smooth muscle cells (VSMCs) were harvested by trypsinization, washed with PBS, resuspended in 500 µl of PBS, and fixed by the addition of 500 µl of ice-cold absolute ethanol at –20°C. After being incubated for 30 min, cell pellets were collected by centrifugation and resuspended in 0.5 ml of PBS containing 100 µg/ml RNase for incubation at 37°C for 30 min. Then, 0.5 ml of propidium iodide solution (100 µg/ml in PBS) was added, and the mixture was allowed to stand on ice for 30 min. The cells (1 x 106/ml) were analyzed with use of a FACScan flow cytometer (Becton Dickinson, San Jose, CA). Distribution of cell cycle phases was analyzed by ModFit LT software. The population of apoptotic cells was quantified by annexing V-FITC staining (Bender Medsystems, Boehringer-Mannheim), and the apoptosis rate was calculated.

Statistical Analysis

Values are expressed as means ± SD. Independent sample t-tests were used to compare continuous data for between-group differences and paired t-tests were applied to within-animal comparisons at different time points. We used {chi}2-test to compare the categorical variables. All parameters before pharmacological triggering in rabbits with and without plaque ruptures were entered into a multivariate logistic regression model to screen risk factors that are predictive of plaque ruptures. P < 0.05 was considered statistically significant. All analyses were performed with a SPSSv13.0 software package (SPSS, Chicago, IL).


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Biochemical Studies

Five rabbits (3 in the Ad5-p53 and 2 in the Ad5-LacZ treatment groups) died of ileus, urine retention, and cerebral or myocardial infarction during the experiment. Among 85 surviving rabbits, 30 rabbits in the Ad5-p53 treatment group (30/37 = 81.1%) developed plaque rupture after pharmacological triggering, which was significantly higher than that in the Ad5-LacZ treatment group (10/38 = 26.3%; P < 0.001). There was no plaque rupture in rabbits of group B. In total, there were 40 rabbits with plaque rupture and 45 rabbits without plaque rupture after pharmacological triggering.

Body Weights

The body weights of rabbits at baseline were 2.42 ± 0.19 kg and increased to 3.36 ± 0.27 kg (P < 0.001) at the end of 10 wk of high-lipid diet. As shown in Tables 1 and 2, there were no significant differences in the body weights of the rabbits among group A1, group A2, and group B and between the rabbits with and without plaque rupture.


View this table:
[in this window]
[in a new window]

 
Table 1. Differences in pretriggering biomarkers and ultrasound parameters in rabbits on high-cholesterol diet

 

View this table:
[in this window]
[in a new window]

 
Table 2. Differences in pretriggering biomarkers and ultrasound parameters in rabbits with or without plaque rupture

 
Lipid Profile

The baseline levels of TC, LDL-C, HDL-C, and TG were 2.0 ± 0.5, 0.7 ± 0.3, 0.9 ± 0.3, and 0.9 ± 0.3 mmol/l, respectively. After 10 wk on the 1% cholesterol diet, the levels of TC, LDL-C, HDL-C, and TG increased to 25.3 ± 7.9, 21.2 ± 7.0, 2.0 ± 1.3, and 2.0 ± 1.0 mmol/l, respectively (all P<0.001). However, there were no significant differences in any of these measured lipoprotein levels among rabbits in group A1, group A2, and group B (Table 1) and between the rabbits with or without plaque rupture (Table 2).

Fibrinogen Levels

Before pharmacological triggering, fibrinogen levels were not significantly different among rabbits in groups A1, A2, and B (Table 1) and between the rabbits with or without plaque rupture (Table 2). However, after pharmacological triggering, fibrinogen levels were significantly increased in rabbits with ruptured plaque compared with the rabbits without ruptured plaque (5.17 ± 1.23 vs. 4.06 ± 1.36 mmol/l; P < 0.001).

Inflammatory and Vascular Functional Markers

As shown in Table 1, levels of hsCRP, sVCAM-1, and sICAM-1 were not significantly different among rabbits in groups A1, A2, and B before pharmacological triggering. However, the three biomarkers were significantly higher in rabbits with ruptured plaque compared with the rabbits without ruptured plaque before triggering (P < 0.001, P = 0.011, P = 0.027, respectively; Table 2). After pharmacological triggering, concentrations of hsCRP, sVCAM-1, and sICAM-1 were all significantly higher in plaque-ruptured group than in nonruptured group (157.8 ± 60.7 vs. 123.6 ± 49.4 ng/ml, P = 0.010; 15.05 ± 4.61 vs. 11.40 ± 4.42 nmol/l, P = 0.001; and 404.57 ± 90.49 vs. 350.11 ± 82.15 pmol/l, P = 0.008, respectively).

Ultrasound and Doppler Measurements

Before pharmacological triggering, ultrasound and Doppler measurements were not significantly different among rabbits in groups A1, A2, and B (Table 1) and between rabbits with or without ruptured plaques, except for the IMT values, which were significantly higher in rabbits with ruptured plaques (Table 2).

IBS Analysis

Before pharmacological triggering, there were no significant differences in IBS measurements among rabbits in groups A1, A2, and B (Table 1) and between rabbits with or without ruptured plaques, except that values of AIIc% in rabbits that developed ruptured plaque were significantly lower than those in rabbits without plaque rupture (Table 2).

IVUS Measurements

Lesions formed after a high-lipid diet generally appeared as poorly echo-reflective, characteristic of lipid-rich, noncalcified and nonfibrotic plaques. IVUS measurements were not significantly different among rabbits in groups A1, A2, and B (Table 1). The differences between IVUS measurements at the end of week 8 before gene transfer and at the end of week 10 before pharmacological triggering (EEMA: 11.10 ± 1.56 vs. 11.22 ± 1.78 mm2; LA: 6.24 ± 1.10 vs. 6.29 ± 1.05 mm2; PA: 4.86 ± 0.89 vs. 4.93 ± 0.91 mm2; PB%: 43.8 ± 6.22 vs. 44.0 ± 6.51; RI: 1.07 ± 0.11 vs. 1.08 ± 0.13) in both group A1 and group A2 were not significant. There were more eccentric plaques in rabbits with ruptured plaques than in those without (P < 0.001), and the levels of EEMA, PA, and PB% in the ruptured group were also significantly larger than those without rupture (P = 0.001, P < 0.001, P = 0.009, respectively). Positive remodeling pattern was observed more frequently in rabbits with ruptured plaques, whereas normal and negative remodeling patterns were more common in rabbits without plaque rupture (Table 2, Fig. 1). Compared with histopathological findings, the sensitivity and specificity results of IVUS in detecting plaque rupture were 80% and 90%, respectively.


Figure 1
View larger version (48K):
[in this window]
[in a new window]

 
Fig. 1. Intravascular ultrasound imaging. A: an eccentric atherosclerotic plaque in the abdominal aorta in rabbits with plaque rupture before pharmacological triggering. B: ruptured plaque and thrombosis in the abdominal aorta in rabbits with plaque rupture after pharmacological triggering. C: small plaque in rabbits without plaque rupture before pharmacological triggering.

 
Interobserver and Intraobserver Variability

Inter- and intraobserver variabilities for AII% were 5.9 ± 1.8% and 5.0 ± 2.0%, respectively. The interobserver variabilities for EEMA, LA, and EI were 6.5 ± 1.6%, 2.4 ± 1.4%, and 5.5 ± 2.3%, respectively, and the intraobserver variabilities were 6.1 ± 1.7%, 2.5 ± 1.2%, and 5.0 ± 2.0%, respectively. The interobserver variabilities for TC, TG, HDL-C, LDL-C, sVCAM-1, sICAM-1, and hsCRP were 2.7 ± 1.4%, 2.2 ± 1.1%, 2.3 ± 1.2%, 2.4 ± 1.3%, 7.5 ± 2.0%, 5.4 ± 1.8%, and 6.0 ± 2.4%, respectively, and the intraobserver variabilities were 2.2 ± 1.1%, 2.6 ± 1.5%, 2.5 ± 1.8%, 2.2 ± 1.3%, 5.4 ± 1.5%, 5.7 ± 1.7%, and 7.4 ± 1.9%, respectively. Paired t-test demonstrated no significant difference between any intra- or interobserver measurements of aforementioned parameters.

Histopathology and Immunohistochemistry

Pathological analysis confirmed that plaque disruption and thrombosis occurred in 30 rabbits involving a total of 40 lesions in rabbits treated with Ad5-p53 adenovirus. In rabbits treated with Ad5-LacZ adenovirus, 10 rabbits involving a total of 14 lesions suffered from disruption and thrombosis after triggering. There was no plaque rupture in rabbits from group B. Together, plaque disruption and thrombosis occurred in 40 rabbits involving 54 plaques. The rate of plaque rupture at the site of gene injection was significantly different between group A1 and group A2 (P < 0.001). p53 overexpression in the location of the plaque resulted in a thinner cap and a marked decrease in the number of VSMCs (Fig. 2). The number of {alpha}-smooth muscle cell actin-positive cells in rabbits treated with Ad5-p53 was significantly less than that in rabbits treated with Ad5-LacZ (51.0 ± 11.3% vs. 78.9 ± 11.7%, P < 0.001, Fig. 2). There were many inflammatory cells infiltrating into the rupture positions and the thrombi. The caps at the rupture positions were broken. The thrombi were firmly attached to the arterial wall, which had a large amount of platelets, fibrins, and red blood cells (Fig. 2). The positive staining of RAM11 (macrophages) in the sites of Ad5-p53 (17.0 ± 7.4%) and Ad5-LacZ (16.1 ± 5.8%) transfection and the corresponding segment in group B (14.9 ± 6.0%) were not significantly different. However, there were significantly more RAM11-positive cells in the ruptured positions and thrombi than those in nonruptured plaques (40.1 ± 9.9% vs. 14.7 ± 6.7%; P < 0.001). Also, the percentage of positive staining cells of MMP-1 was not significantly different among the three groups (24.6 ± 8.9% vs. 20.2 ± 6.0% or 19.5 ± 4.7%). However, there were significantly more MMP-1-positive cells in the ruptured plaques than in nonruptured plaques (36.6 ± 10.1% vs. 19.0 ± 5.7%; P < 0.001). As expected, there was more positive p53 staining at the sites of p53 adenovirus transfection (36.7 ± 11.2%) than at the sites of Ad5-LacZ transfection (17.1 ± 6.4%) and at the corresponding sites of group B (16.2 ± 6.7%, all P < 0.001, Fig. 2). There was no significant difference between p53-positive staining areas in group A2 and group B.


Figure 2
View larger version (58K):
[in this window]
[in a new window]

 
Fig. 2. Histopathological assays. A: hematoxylin and eosin (HE) staining of the abdominal aortic cross section in Ad5-p53 treatment rabbits showing a thrombus over a thin and eroded fibrous cap. B: HE staining of the abdominal aortic cross section in Ad5-p53 treatment rabbits showing plaque rupture and thrombosis. C: Masson trichrome staining of the abdominal aortic cross section in Ad5-p53 treatment rabbits showing a huge thrombus arising from a volcano-like ruptured plaque. D: Masson trichrome staining of the abdominal aortic cross section in Ad5-p53 treatment rabbits showing a high-power magnification of C. E: positive cells of immunohistological staining for {alpha}-smooth muscle cells in Ad5-p53 treatment rabbits. F: positive cells of immunohistological staining for {alpha}-smooth muscle cell actin in Ad5-LacZ treatment rabbits. G: abundant p53-positive cells in Ad5- p53 treatment rabbits. H: scanty p53-positive cells in Ad5-LacZ treatment rabbits. I: LacZ-positive cells in Ad5-LacZ treatment rabbits. Bars = 50 µm.

 
RT-PCR

The mRNA expression level of p53 in the aortic plaques of group A1 (61.2 ± 22.3%) was significantly higher than that of group A2 (41.7 ± 20.2%) or group B (35.2 ± 20.2%) (all P < 0.05). However, the difference in mRNA expression level of p53 between group A2 and group B was not significant.

Quantification of Apoptosis

TUNEL staining showed higher VSMC apoptosis rate in group A1 (2.5 ± 0.8%) than in group A2 (1.0 ± 0.3%) or group B (0.9 ± 0.4%) (all P < 0.05). Flow cytometry analysis (Fig. 3) demonstrated a higher VSMC apoptosis rate in group A1 (8.04% ± 1.2%) than in group A2 (6.89% ± 1.0%) or group B (6.61% ± 1.11%) (all P < 0.05).


Figure 3
View larger version (28K):
[in this window]
[in a new window]

 
Fig. 3. Flow cytometry analysis demonstrating a higher vascular smooth muscle cell apoptosis rate, represented by a blue peak, in group A1 (12.23%; A) than in group A2 (1.72%; B). CV, coefficient of variation.

 
Multivariate Analyses for Prediction of Plaque Rupture

To discover factors that can predict the occurrence of plaque rupture, we used a logistic regression model in which the status of plaque rupture was the dependent variable, and all other biochemical or ultrasound values were entered as independent predictors. Results showed that EI, PA, hsCRP, and AIIc% were significant predictors of the plaque rupture with odds ratios of 7.056 [95% confidence interval (CI): 1.958, ~25.430], 1.942 (95% CI: 1.058, ~3.564), 1.025 (95% CI: 1.007, ~1.043), and 0.856 (95% CI: 0.775, ~0.946), respectively, suggesting that increased EI, PA, and hsCRP are significant risk factors of plaque rupture, whereas increased AIIc% is a protector of plaque rupture (Table 3).


View this table:
[in this window]
[in a new window]

 
Table 3. Results of logistic regression

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
In the present study, we established an atherosclerotic rabbit model of vulnerable plaques by locally delivering recombinant p53 adenovirus to atherosclerotic plaques in rabbits fed high-cholesterol diet and triggered plaque rupture and thrombosis using Chinese Russell's viper venom and histamine. We identified parameters obtained through in vivo imaging and circulating biomarkers that are predictive of plaque ruptures.

Vulnerable atherosclerotic plaque rupture, with subsequent platelet aggregation and coronary thrombosis, is the most common cause of ACS. However, progress on understanding of how an atherosclerotic plaque ruptures and subsequently the effective preventive strategies have been seriously hampered by a lack of a suitable animal model. Studies of domestic and exotic animals have shown that most species will spontaneously develop fatty streaks and in some cases atheromatous lesions with dietary or genetic manipulations; however, rupture and thrombosis are exceedingly rare. With addition of high fat and/or high cholesterol to the diet, lesion development may be accelerated but does not increase the frequency of plaque rupture in most animal models (7). Abela et al. (1) and Rekhter et al. (26) reported that parenteral injection of Russell's viper venom and histamine could induce plaque rupture and thrombosis in balloon-injured cholesterol-fed New Zealand White rabbits. Recently, Johnson and Jackson (15) observed a high frequency of plaque rupture with mural thrombus in younger apolipoprotein E–/–mice fed a high-fat diet. von der Thüsen et al. (35) reported a strategy to promote plaque rupture of preexisting atherosclerotic lesions using p53-induced lesion remodeling in apolipoprotein E–/– mice and found that p53 overexpression within a plaque prompted apoptosis of the VSMCs and a proportional decrease in collagen production in the fibrous cap. However, because of the small size of the blood vessels, mice cannot be examined by some of the clinically used imaging techniques such as IVUS. This limitation makes the mouse model less useful to evaluate modern technologies that can be potentially useful in predicting the plaque rupture.

In the present study, we combined both localized p53 overexpression and pharmacological induction and established a rabbit model of vulnerable plaque suitable for ultrasound diagnosis. p53, a tumor suppressor protein, plays an important role in G1/S cell cycle arrest or apoptosis. Although more experimental evidence is still needed, excessive VSMC apoptosis induced by the transfected and overexpressed p53 could be the main reason for plaque rupture promotion. p53 may exert a destabilizing effect by selectively eliminating synthetic VSMCs or by inducing the transition of VSMCs from a synthetic to a contractile phenotype (35, 38). To simulate the hyperhemodynamic and hypercoagulative state in ACS, we administrated pharmacological triggering. Snake venom contains proteases that activate factors V and X, which leads to thrombosis occurring most likely at sites of endothelial injury. In addition to this procoagulant effect, snake venom is a direct endothelial toxin. However, these effects are less common in the presence of intact endothelium. Histamine is a vasoconstrictor in rabbits that also promotes release of norepinephrine, leading to increased blood pressure and stress on plaques (8). With this double-induction modality, we were able to produce plaque disruption in 81.1% of the experimental rabbits, which has never been achieved in any other animal model (6). This makes it a potentially very useful animal model in studies of plaque rupture.

In this study, we used untreated hypercholesterolemic rabbits as the control group and found that, although the expression of macrophage-positive cells, serum levels, inflammatory markers, and IMT tended to be greater in groups A1 and A2 after adenovirus transfection than in group B, no significant difference was found. A previous study reported that adenovirus vector transfer into normal rabbit arteries resulted in prolonged vascular inflammation and neointimal hyperplasia (23); however, our results showed that adenovirus vector transfection per se did not produce more significant damages to plaques induced by endothelial injury and hypercholesterolemia in rabbits. We believe that our animal model may provide the following advantages: 1) the high rate of plaque rupture in our model makes it a very useful tool for basic research on plaque vulnerability, and 2) a large animal model like rabbits may allow dynamic observations of plaque morphological changes by IVUS in vivo and possible local gene and drug delivery. Although the atherosclerotic lesions formed in rabbits are different from those in mice and humans and plaque rupture induced by p53 gene transfer and pharmacological triggering differs from spontaneous plaque rupture in ACS, plaques vulnerable to rupture in the present study were characterized by a thin cap, a large lipid core, and abundant activated macrophages, features consistent with those of inflamed thin-cap fibroatheroma commonly found in patients with ACS. Moreover, plaques developed disruption in the presence of increased local stress induced by pharmacological triggering, which resembles hemodynamic triggers commonly seen in patients with ACS (36).

Previous studies have shown that acute inflammation may participate in the pathogenesis of plaque vulnerability (5, 33). Thus, inflammatory markers, such as hsCRP, have been suggested in predicting the risk of future cardiovascular events. Liuzzo et al. (18) found that elevated C-reactive protein (>3 mg/l) and serum amyloid A protein at the time of hospital admission predicted a poor outcome in patients with unstable angina. Researchers (2, 14, 20) also found that soluble adhesion molecules (sICAM-1 and sVCAM-1) were associated with an adverse prognosis, and raised concentrations of CRP and sVCAM-1 had a similar degree of sensitivity in predicting future ischemic endpoints. In the present study, we found that hsCRP levels were significantly higher in rabbits that went on to have plaque rupture than in those that did not. The elevated hsCRP persisted after pharmacological triggering and rupture. A similar trend was also observed in levels of sICAM-1 and sVCAM-1 pre- and postrupture. Controlling other covariates in the logistic regression analysis, hsCRP levels appear to be one of the independent predictors for plaque rupture. Our data suggest that inflammatory processes indeed play a major role in plaque rupture, a process detectable before the plaque rupture, rendering it a high diagnostic or prognostic value.

High-frequency ultrasonography and quantitative Doppler flow measurement are frequently used in diagnosing atherosclerotic plaque, such as measuring IMT and velocity at the position of stenosis (25). Kawasaki et al. (16) used ultrasonic IBS to differentiate the tissue characteristics of calcification, fibrosis, lipid pool with fibrous cap, intimal hyperplasia, and thrombus and were able to construct two-dimensional tissue plaque structures in vivo. Many researchers have found that IVUS can identify the features of vulnerable plaques in clinical settings (12, 27, 37). Von Birgelen et al. (34) used IVUS to identify 29 ruptured plaques in arteries also containing nonruptured plaques in the same vessel. They reported that there was a difference in plaque distribution with more eccentric patterns in ruptured than in nonruptured plaques. In the present study, using ultrasonography and quantitative Doppler technique, we have shown that rabbits with higher IMT were more likely to rupture, indicating that plaques with larger lipid cores may be easier to rupture. This is supported by the lower AIIc% using IBS, which exhibited accurate densitometry of lipid cores in rabbits with vulnerable plaques. IVUS also confirmed that eccentric plaques with larger EEMAs and PAs and cross-sectional LA narrowing and positive remodeling patterns are easier to rupture. A recent clinical trial found that plaque-stabilizing therapy with atorvastatin was associated with constrictive remodeling of the arterial wall, and this beneficial effect was related to a reduction of hsCRP level (28), which lends support to our study and signifies that expansive remodeling of the arterial wall may be an important risk factor of plaque vulnerability. Our multivariate logistic regression analysis clearly demonstrated that increased EI, PA, and hsCRP are significant risk factors of plaque rupture, whereas increased AIIc% is a protector of plaque rupture.

There were several limitations in our study. First, although the plaque rupture rate was as high as 81.1% in the Ad5-p53 group after pharmacological triggering, the rate of spontaneous plaque rupture was still low, and further research work is warranted to improve our animal model. Second, the major findings in this study were derived from rabbits, thus requiring clinical confirmation in future studies. However, it is possible that, in clinical patients, an inflammatory process, which degrades the fibrous cap, may have already subsided before plaque rupture that may have been induced by mechanical stress or ruptured angiogenic vessels after the active inflammation. In these situations, biomarkers for active inflammatory process may not be detected in the ruptured plaques.

In conclusion, localized p53 overexpression and Russell's viper venom and histamine injection can reproducibly induce atherosclerotic plaque rupture in rabbits fed atherogenic diet. Although circulating inflammatory markers, e.g., hsCRP, can predict the rupture, ultrasound measurements appear to be a more valuable clinical tool in predicting the plaque vulnerability.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This study was supported by the National 973 Basic Research Program of China (2006CB503803), grants from the National Natural Science Foundation of China (30470701, 30570747, and 30670873), the Key Clinical Project of the Chinese Ministry of Health (20044681), and the Key Clinical Project of Shandong Province (2002BB1CJA1).


    FOOTNOTES
 

Address for reprint requests and other correspondence: Y. Zhang, Shandong Univ. Qilu Hospital, Jinan, No. 107, Wen Hua Xi Road, Jinan, Shandong 250012, P.R. China (e-mail: zhangyun{at}sdu.edu.cn)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

* W. Q. Chen, L. Zhang, and Y. F. Liu contributed equally to this work. Back


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Abela GS, Picon PD, Friedl SE, Gebara OC, Miyamoto A, Federman M, Tofler GH, Muller JE. Triggering of plaque disruption and arterial thrombosis in an athersclerotic rabbit model. Circulation 91: 776–784, 1995.[Abstract/Free Full Text]
  2. Avanzas P, Arroyo-Espliguero R. Markers of inflammation and multiple complex stenoses (pancoronary plaque vulnerability) in patients with non-ST segment elevation acute coronary syndromes. Heart 90: 847–852, 2004.[Abstract/Free Full Text]
  3. Bennett MR. Breaking the plaque: evidence for plaque rupture in animal model of atherosclerosis. Arterioscler Thromb Vasc Biol 22: 713–714, 2002.[Free Full Text]
  4. Burke AP, Farb A, Malcom GT, Liang YH, Smialek J, Virmani R. Coronary risk factors and plaque morphology in men with coronary disease who died suddenly. N Engl J Med 336: 1276–1282, 1997.[Abstract/Free Full Text]
  5. Carr SC, Farb A, Pearce WH, Virmani R, Yao JS. Activated inflammatory cells are associated with plaque rupture in carotid artery stenosis. Surgery 122: 757–763, 1997.[CrossRef][Web of Science][Medline]
  6. Chen WQ, Zhang Y, Zhang M, Ji XP, Yin Y, Zhu YF. Establishing an animal model of unstable atherosclerotic plaques. Chin Med J (Engl) 117: 1293–1298, 2004.[Medline]
  7. Chiesa G, Di Mario C, Colombo N, Vignati L, Marchesi M, Monteggia E, Parolini C, Lorenzon P, Laucello M, Lorusso V, Adamian M, Franceschini G, Newton R, Sirtori CR. Development of a lipid-rich, soft plaque in rabbits, monitored by histology and intravascular ultrasound. Atherosclerosis 156: 277–287, 2001.[CrossRef][Web of Science][Medline]
  8. Constantinides P, Chakravarti RN. Rabbit arterial thrombosis production by systemic procedures. Arch Pathol 72: 197–208, 1961.[Web of Science][Medline]
  9. Davies MJ. The pathophysiology of acute coronary syndromes. Heart 83: 361–366, 2000.[Free Full Text]
  10. De Korte CL, van der Steen AF. Characterization of plaque components and vulnerability with intravascular ultrasound elastography. Phys Med Biol 45: 1465–1475, 2000.[CrossRef][Web of Science][Medline]
  11. Frimerman A, Miller HI, Hallman M, Laniado S, Keren G. Intravascular ultrasound characterization of thrombi of different composition. Am J Cardiol 73: 1053–1057, 1994.[CrossRef][Web of Science][Medline]
  12. Ge J, Chirillo F, Schwedtmann J, Gorge G, Haude M, Baumgart D, Shah V, von Birgelen C, Sack S, Boudoulas H, Erbel R. Screening of ruptured plaques in patients with coronary artery disease by intravascular ultrasound. Heart 81: 621–627, 1999.[Abstract/Free Full Text]
  13. Gussenhoven EJ, Essed CE, Lancee CT, Mastik F, Frietman P, van Egmond FC, Reiber J, Bosch H, van Urk H, Roelandt J. Arterial wall characteristics determined by intravascular ultrasound imaging: an in vivo study. J Am Coll Cardiol 14: 947–952, 1989.[Abstract]
  14. Haim M, Tanne D, Boyko V, Reshef T, Goldbourt U, Leor J, Mekori YA, Behar S. Soluble intercellular adhesion molecule-1 and long-term risk of acute coronary events in patients with chronic coronary heart disease. J Am Coll Cardiol 39: 1133–1138, 2002.[Abstract/Free Full Text]
  15. Johnson JL, Jackson CL. Atherosclerotic plaque rupture in the apolipoprotein E knockout mouse. Atherosclerosis 154: 399–406, 2001.[CrossRef][Web of Science][Medline]
  16. Kawasaki M, Takatsu H, Noda T, Ito Y, Kunishima A, Arai M, Nishigaki K, Takemura G, Morita N, Minatoguchi S, Fujiwara H. Noninvasive quantitative tissue characterization and two-dimensional color-coded map of human atherosclerotic lesion using ultrasound integrated backscatter. J Am Coll Cardiol 38: 486–492, 2001.[Abstract/Free Full Text]
  17. Kelly P, Bhatt DL. Identification of vulnerable plaque—the quest continues. J Invasive Cardiol 19: 55–57, 2007.[Medline]
  18. Liuzzo G, Biasucci LM, Gallimore JR, Grillo RL, Rebuzzi AG, Pepys MB, Maseri A. The prognostic value of C-reactive protein and serum amyloid A in severe unstable angina. N Engl J Med 331: 417–424, 1994.[Abstract/Free Full Text]
  19. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(–{Delta}{Delta}CT) method. Methods 25: 402–408, 2001.[CrossRef][Web of Science][Medline]
  20. Mulvihill NT, Foley JB, Murphy RT, Curtin R, Crean PA, Walsh M. Risk stratification in unstable angina and non-Q wave myocardial infarction using soluble cell adhesion molecules. Heart 85: 623–627, 2001.[Abstract/Free Full Text]
  21. Naghavi M, John R, Naguib S, Siadaty MS, Grasu R, Kurian KC, van Winkle WB, Soller B, Litovsky S, Madjid M, Willerson JT, Casscells W. PH heterogeneity of human and rabbit atherosclerotic plaques: a new insight into detection of vulnerable plaque. Atherosclerosis 164: 27–35, 2002.[CrossRef][Web of Science][Medline]
  22. Naghavi M, Libby P, Falk E, Casscells SW, Litovsky S, Rumberger J, Badimon JJ, Stefanadis C, Moreno P, Pasterkamp G, Fayad Z, Stone PH, Waxman S, Raggi P, Madjid M, Zarrabi A, Burke A, Yuan C, Fitzgerald PJ, Siscovick DS, de Korte CL, Aikawa M, Juhani Airaksinen KE, Assmann G, Becker CR, Chesebro JH, Farb A, Galis ZS, Jackson C, Jang IK, Koenig W, Lodder RA, March K, Demirovic J, Navab M, Priori SG, Rekhter MD, Bahr R, Grundy SM, Mehran R, Colombo A, Boerwinkle E, Ballantyne C, Insull W Jr, Schwartz RS, Vogel R, Serruys PW, Hansson GK, Faxon DP, Kaul S, Drexler H, Greenland P, Muller JE, Virmani R, Ridker PM, Zipes DP, Shah PK, Willerson JT. From vulnerable plaque to vulnerable patient. A call for new definition and risk assessment strategies: part I. Circulation 108: 1664–1772, 2003.[Abstract/Free Full Text]
  23. Newman KD, Dunn PF, Owens JW, Schulick AH, Virmani R, Sukhova G, Libby P, Dichek DA. Adenovirus-mediated gene transfer into normal rabbit arteries results in prolonged vascular cell activation, inflammation, and neointimal hyperplasia. J Clin Invest 96: 2955–2965, 1995.[Web of Science][Medline]
  24. Pasterkamp G, Falk E, Woutman H. Techniques characterizing the coronaryatherosclerotic plaque: Influence on clinical decision making? J Am Coll Cardiol 36: 13–21, 2000.[Abstract/Free Full Text]
  25. Pignoli P, Tremoli E, Poli A, Oreste P, Paoletti R. Intimal plus medial thickness of the arterial wall: a direct measurement with ultrasound imaging. Circulation 74: 1399–1406, 1986.[Abstract/Free Full Text]
  26. Rekhter MD, Hicks GW, Brammer DW, Work CW, Kim JS, Gordon D, Keiser JA, Ryan MJ. Animal model that mimics atherosclerotic plaque rupture. Circ Res 83: 705–713, 1998.[Abstract/Free Full Text]
  27. Schoenhagen P, Ziada KM, Kapadia SR, Crowe TD, Nissen SE, Tuzcu EM. Extent and direction of arterial remodeling in stable versus unstable coronary syndromes. An intravascular ultrasound study. Circulation 101: 598–603, 2000.[Abstract/Free Full Text]
  28. Schoenhagen P, Tuzcu EM, Apperson-Hansen C, Wang C, Wolski K, Lin S, Sipahi I, Nicholls SJ, Magyar WA, Loyd A, Churchill T, Crowe T, Nissen SE. Determinants of arterial wall remodeling during lipid-lowering therapy: serial intravascular ultrasound observations from the reversal of atherosclerosis with aggressive lipid lowering therapy (REVERSAL) trial. Circulation 113: 2787–2789, 2006.[Free Full Text]
  29. Schwartz SM, Galis ZS, Rosenfeld ME, Falk E. Plaque rupture in humans and mice. Arterioscler Thromb Vasc Biol 27: 705–713, 2007.[Abstract/Free Full Text]
  30. Takano M, Mizuno K, Takano M, Mizuno K, Okamatsu K, Yokoyama S, Ohba T, Sakai S. Mechanical and structural characteristics of vulnerable plaques: analysis by coronary angioscopy and intravascular ultrasound. J Am Coll Cardiol 38: 99–104, 2001.[Abstract/Free Full Text]
  31. Tearney GJ, Yabushita H, Houser SL, Aretz HT, Jang IK, Schlendorf KH, Kauffman CR, Shishkov M, Halpern EF, Bouma BE. Quantification of macrophage content in atherosclerotic plaques by optical coherence tomography. Circulation 107: 113–119, 2003.[Abstract/Free Full Text]
  32. Toussaint JF, LaMuraglia GM, Southern JF, Fuster V, Kantor HL. Magnetic resonance images lipid, fibrous, calcified, hemorrhagic and thrombotic component of human atherosclerosis in vivo. Circulation 94: 932–938, 1996.[Abstract/Free Full Text]
  33. Van der Wal AC, Becker AE, van der Loos CM, Das PK. The site of intimal rupture or erosion of thrombosed coronary atherosclerotic plaques is characterized by an inflammatory process irrespective of the dominant plaque morphology. Circulation 89: 36–44, 1994.[Abstract/Free Full Text]
  34. Von Birgelen C, Klinkhart W, Mintz GS, Papatheodorou A, Herrmann J, Baumgart D, Haude M, Wieneke H, Ge J, Erbel R. Plaque distribution and vascular remodeling of ruptured and nonruptured coronary plaques in the same vessel: an intravascular ultrasound study in vivo. J Am Coll Cardiol 37: 1864–1870, 2001.[Abstract/Free Full Text]
  35. Von der Thüsen JH, van Vlijmen BJ, Hoeben RC, Kockx MM, Havekes LM, van Berkel TJ, Biessen EA. Induction of atherosclerotic plaque rupture in apolipoprotein E/ mice after adenovirus-mediated transfer of p53. Circulation 105: 2064–2070, 2002.[Abstract/Free Full Text]
  36. Waxman S, Ishibashi F, Muller JE. Detection and treatment of vulnerable plaques and vulnerable patients. Circulation 114: 2390–2411, 2006.[Free Full Text]
  37. Yamagishi M, Umeno T, Hongo Y, Tsutsui H, Goto Y, Nakatani S, Miyatake K. Intravascular ultrasonic evidence for importance of plaque distribution (eccentric vs circumferential) in determining distensibility of the left anterior descending artery. Am J Cardiol 79: 1596–1600, 1997.[CrossRef][Web of Science][Medline]
  38. Yonemitsu Y, Kaneda Y, Tanaka S, Nakashima Y, Komori K, Sugimachi K, Sueishi K. Transfer of wild-type p53 gene effectively inhibits vascular smooth muscle cell proliferation in vitro and in vivo. Circ Res 82: 147–156, 1998.[Abstract/Free Full Text]




This Article
Free upon publication Free Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/5/H2836    most recent
00472.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via ISI Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, W. Q.
Right arrow Articles by Zhang, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, W. Q.
Right arrow Articles by Zhang, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.