|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1The Key Laboratory of Cardiovascular Remodeling and Function Research, Chinese Ministry of Education and Chinese Ministry of Health, Shandong University Qilu Hospital, Jinan, Shandong, China; and 2Texas Heart Institute at St Luke's Episcopal Hospital, Division of Cardiothoracic Surgery, Michael E. DeBakey Department of Surgery, Baylor College of Medicine, Houston, Texas
Submitted 19 April 2007 ; accepted in final form 8 August 2007
| ABSTRACT |
|---|
|
|
|---|
25.430], 1.942 (95% CI: 1.058,
3.564), 1.025 (95% CI: 1.007,
1.043), and 0.856 (95% CI: 0.775,
0.946), respectively. Localized p53 overexpression technique induces plaque rupture, and the combined measurement of ultrasound and biochemical markers is a valuable tool in predicting plaque rupture.
atherosclerosis; vulnerable plaque; p53; biomarkers
Recently, a variety of imaging techniques, including high-frequency duplex ultrasound, intravascular ultrasound (IVUS), IVUS elastography, coronary angioscopy, magnetic resonance imaging, and optical coherence tomography, have been reported to potentially detect vulnerable plaques (10, 17, 21, 24, 30–32). Among these techniques, ultrasound imaging has the advantages of being widely available and capable of displaying morphology of plaques, as well as the entire vessel. In addition to the imaging information, certain biomarkers, such as inflammatory markers, have also been suggested to be associated with ACS. However, whether these markers can prospectively predict plaque rupture is still unknown.
In the present study, we developed a novel animal model using the localized p53 overexpression technique in rabbits fed atherogenic diet. Using this animal model, we investigated circulating biochemical markers that might be predictive of the unstable plaque that ruptures under stimulation and the ultrasound-based imaging technology and hemodynamic parameters that may predict such progression. Using a multivariate logistic regression model, we evaluated the factors that could best predict the dynamic process.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Although the apolipoprotein E–/– mouse model has been used to successfully generate ruptured plaque in the laboratory setting (15), it is unsuitable for IVUS diagnosis because of the small size of the blood vessels. Therefore, we developed the unstable plaque model in rabbits.
Ninety male New Zealand White rabbits weighing
1.5–2.5 kg were divided into an intervention group (group A, n = 80) and a control group (group B, n = 10). The aortic wall injuries were induced by an intravascular balloon in group A rabbits before they were fed an atherogenic diet containing 1% cholesterol (
120–140 g/day) for 8 wk. At the end of the 8th wk, balloon-induced aortic wall injury was performed with a 4-Fr balloon catheter (3.5 x 15 mm2) introduced through the right femoral artery to the thoracic aorta after rabbits had been anesthetized with an intravenous injection of pentobarbital sodium (30 mg/kg). The balloon was inflated with saline to obtain 8 atm, and the catheter was retracted down to the iliofemoral artery. This process was repeated three times in each rabbit to ensure denudation of the endothelium of the abdominal aorta. Half of these rabbits (group A1, n = 40, selected randomly) were injected with adenoviral vector containing recombinant p53, and the other half (group A2, as the vehicle control) were injected with adenoviral vector containing recombinant
-galactosidase, as described previously (6). In brief, 10 µl of recombinant adenovirus suspension (1.5 x 1010 pfu/ml replication-defective adenovirus vector Ad5-p53 and 1.5 x 1010 pfu/ml Ad5-LacZ) were injected through a catheter into the abdominal aortic segments rich in atheromatic plaques, which were mainly located between the right renal and the common iliac arteries. The suspension was left in situ for 10 min after the temporary ligation of the aortic segment. The site of injection was marked with a nesis, and the abdominal cavity was closed. These rabbits were maintained on high-cholesterol diet for an additional 2 wk. In contrast, rabbits in group B were only fed atherogenic diet containing 1% cholesterol (
120–140 g/day) for 10 wk.
At the end of the total 10-wk dietary challenge, plaque rupture was induced in all rabbits by pharmacological triggers using the method described by Constantinides and Chakravarti (8). In brief, 0.15 mg/kg Chinese Russell's viper venom (Snake Venom Institute of Guangzhou) was injected intraperitoneally. Thirty minutes after the injection, 0.02 mg/kg histamine (Sigma) was given intravenously. Rabbits were euthanized 24–48 h after the above procedure.
All animal care and experimental protocols complied with the Animal Management Rule of the Ministry of Public Health, People's Republic of China (documentation 55, 2001), and were approved by the Animal Care Committee of Shandong University.
Biochemical Studies
At the beginning of the experiment and the end of week 10, blood samples were collected from all rabbits. Serum samples were stored at –80°C for 10 wk before assay. Serum levels of total cholesterol (TC), triglyceride (TG), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C) were measured by enzymatic assays, and the level of fibrinogen was measured by the immunonephelometry method. C-reactive protein was assayed with a highly sensitive ELISA kit (Diagnostic System Laboratory). Measurements of soluble vascular cell adhesion molecule-1 (sVCAM-1) and intercellular adhesion molecule-1 (sICAM-1) were performed with ELISA kits (Bionewtrans Pharmaceutical Biotechnology).
Ultrasonographic Studies
Aortic ultrasonography and Doppler measurements. The abdominal aorta was scanned with a high-frequency duplex ultrasonographic system (HP SONOS 5500) and a 7.5-MHz transducer before and after the pharmacological triggering. The aortic longitudinal and transversal axis views were obtained; aortic end-diastolic diameter, end-systolic diameter, and intima-media thickness (IMT) were measured. Doppler flow measurement was performed to derive the aortic peak velocity, mean velocity, and velocity-time integral.
Ultrasonic integrated backscatter analysis. Ultrasonic integrated backscatters (IBS) from the aortic wall and atherosclerotic plaques were analyzed by the acoustic densitometry technique. The average ultrasonic intensities (AII) of aortic intima and adventitia in normal segments and atherosclerotic plaques were measured, and the corrected AII (AIIc%) was derived by calculating the ratio of AII of the intima to AII of the adventitia.
IVUS studies.
IVUS studies were performed three times: at the end of week 8 before gene transfer and at the end of week 10 before and after pharmacological triggering using a 3.2-Fr catheter containing a single rotating element transducer of 40 MHz connected to an IVUS system (Galaxy, Boston Scientific). After the aortic arch was reached, the catheter was withdrawn by a motorized pullback device at a constant speed of 0.5 mm/s. The following parameters were measured from cross-sectional images: external elastic membrane area (EEMA), lumen area (LA), plaque area (PA = EEMA – LA), plaque burden (PB% = PA/EEMA x 100%), lumen eccentricity index [EI = (Tmax – Tmin)/Tmax, where Tmax is the maximal thickness of plaques and Tmin is the minimal thickness of plaques], and, finally, remodeling index (RI), which was calculated as EEMA at the lesion segment/EEMA at the reference segment. The segments proximal and distal to the plaque with the least lesion and the largest LA within a 10-mm distance from the plaque were regarded as the reference segments, and the mean EEMA derived from both reference segments was calculated. In the present study, plaques with EI >0.5 were regarded as eccentric plaques, otherwise as concentric plaques. Similarly, RI >1.05 was regarded as positive remodeling, RI =
0.95–1.05 as no remodeling, and RI <0.95 as negative remodeling (13). Plaque rupture was diagnosed by visualizing an echolucent zone within a plaque, separated from the lumen by a thin echo-reflecting structure representing the fibrous cap. Intraluminal thrombus depicted intense granular or finely speckling echo reflections that scintillate during real-time imaging and appear mobile with blood flow (11). The IVUS images were reviewed by two independent observers, and the values were averaged for data analyses.
Interobserver and Intraobserver Variabilities
To assess the interobserver and intraobserver variabilities in measurements of ultrasound and IVUS imaging and biochemical assays, 10 rabbits were randomly chosen for determining the variability of AIIc%, EEMA, LA, EI, TC, TG, HDL-C, LDL-C, sVCAM-1, sICAM-1, and high-sensitive C-reactive protein (hsCRP). The interobserver variability was calculated from repeated measurements by two independent observers, and the intraobserver variability was calculated from repeated measurements by one observer who measured twice, 1 wk apart. Variability was expressed as the percentage of the absolute difference between two measurements divided by the mean value of the two measurements.
Histopathological Analysis
Histopathology. Euthanasia was conducted via an overdose of intravenous pentobarbital. The abdominal aorta was dissected and excised to observe the occurrence of plaque rupture and thrombosis. A gauge was used to measure the length and cross-sectional area of the thrombus. Tissue samples (1 cm in length) were taken from the Ad5-LacZ-injected and Ad5-p53-injected segments and corresponding aortic segments in group B and were fixed overnight in 10% formalin. Serial 5-µm-thick tissue sections were processed for hematoxylin and eosin staining and Masson trichrome staining. Plaque rupture was defined as fibrous cap disruption with overlying thrombus based on histopathological observations.
Immunohistochemistry.
After being fixed in formalin and embedded in paraffin, tissue samples from the abdominal aorta were cut into serial 5-µm-thick sections and reacted with mouse anti-human p53 monoclonal antibody (PAb1801; Sigma), mouse anti-rabbit
-smooth muscle cell actin monoclonal antibody (Sigma), mouse anti-human matrix metalloproteinases-1 (MMP-1) (Santa Cruz), and mouse anti-rabbit macrophage RAM11 monoclonal antibody (Dako).
-Galactosidase was revealed by incubation with x-gal at 37°C for 4 h. Positive staining was counted and expressed as mean percentage of the PA in at least 10 high-power fields (x400 magnification) by use of an automated image analysis system (Image-Pro Plus 5.0, Media Cybernetics).
Real-Time RT-PCR
Tissue samples were frozen with liquid nitrogen. Total RNA was extracted, and mRNA expression of p53 in plaques was examined by quantitative real-time RT-PCR with use of LightCycler (Roche Applied Science), per the manufacturer's instructions. The mRNA sequences were obtained from GenBank. Quantitative values were obtained from the threshold cycle value, the point at which a significant increase of fluorescence is first detected. The transcript number of GAPDH was quantified as an internal control. Experiments were performed in triplicate for each data point. The data were analyzed with the method as described by Livak and Schmittgen (19). The results of RT-PCR were confirmed by gel electrophoresis. The forward and reverse primer sequences used were GCGCACAGAGGAAGAGAATC and GGCCAACTTGTTCAGTGGAG, respectively. The size was 501 bp.
Quantification of Apoptosis
Terminal deoxynucleotidyl transferase end-labeling staining. Apoptosis was assessed by terminal deoxynucleotidyl transferase end-labeling (TUNEL; Calbiochem) staining. Only TUNEL-positive nuclei with morphological features of apoptosis, including cell shrinkage, nuclear pyknosis, chromatin condensation, and nuclear fragmentation, were included. Counterstaining of the nucleus involved methyl green. The apoptosis rate was calculated as the proportion of apoptotic cells to total number of cells in a given area.
Flow cytometry analysis. Vascular smooth muscle cells (VSMCs) were harvested by trypsinization, washed with PBS, resuspended in 500 µl of PBS, and fixed by the addition of 500 µl of ice-cold absolute ethanol at –20°C. After being incubated for 30 min, cell pellets were collected by centrifugation and resuspended in 0.5 ml of PBS containing 100 µg/ml RNase for incubation at 37°C for 30 min. Then, 0.5 ml of propidium iodide solution (100 µg/ml in PBS) was added, and the mixture was allowed to stand on ice for 30 min. The cells (1 x 106/ml) were analyzed with use of a FACScan flow cytometer (Becton Dickinson, San Jose, CA). Distribution of cell cycle phases was analyzed by ModFit LT software. The population of apoptotic cells was quantified by annexing V-FITC staining (Bender Medsystems, Boehringer-Mannheim), and the apoptosis rate was calculated.
Statistical Analysis
Values are expressed as means ± SD. Independent sample t-tests were used to compare continuous data for between-group differences and paired t-tests were applied to within-animal comparisons at different time points. We used
2-test to compare the categorical variables. All parameters before pharmacological triggering in rabbits with and without plaque ruptures were entered into a multivariate logistic regression model to screen risk factors that are predictive of plaque ruptures. P < 0.05 was considered statistically significant. All analyses were performed with a SPSSv13.0 software package (SPSS, Chicago, IL).
| RESULTS |
|---|
|
|
|---|
Five rabbits (3 in the Ad5-p53 and 2 in the Ad5-LacZ treatment groups) died of ileus, urine retention, and cerebral or myocardial infarction during the experiment. Among 85 surviving rabbits, 30 rabbits in the Ad5-p53 treatment group (30/37 = 81.1%) developed plaque rupture after pharmacological triggering, which was significantly higher than that in the Ad5-LacZ treatment group (10/38 = 26.3%; P < 0.001). There was no plaque rupture in rabbits of group B. In total, there were 40 rabbits with plaque rupture and 45 rabbits without plaque rupture after pharmacological triggering.
Body Weights
The body weights of rabbits at baseline were 2.42 ± 0.19 kg and increased to 3.36 ± 0.27 kg (P < 0.001) at the end of 10 wk of high-lipid diet. As shown in Tables 1 and 2, there were no significant differences in the body weights of the rabbits among group A1, group A2, and group B and between the rabbits with and without plaque rupture.
|
|
The baseline levels of TC, LDL-C, HDL-C, and TG were 2.0 ± 0.5, 0.7 ± 0.3, 0.9 ± 0.3, and 0.9 ± 0.3 mmol/l, respectively. After 10 wk on the 1% cholesterol diet, the levels of TC, LDL-C, HDL-C, and TG increased to 25.3 ± 7.9, 21.2 ± 7.0, 2.0 ± 1.3, and 2.0 ± 1.0 mmol/l, respectively (all P<0.001). However, there were no significant differences in any of these measured lipoprotein levels among rabbits in group A1, group A2, and group B (Table 1) and between the rabbits with or without plaque rupture (Table 2).
Fibrinogen Levels
Before pharmacological triggering, fibrinogen levels were not significantly different among rabbits in groups A1, A2, and B (Table 1) and between the rabbits with or without plaque rupture (Table 2). However, after pharmacological triggering, fibrinogen levels were significantly increased in rabbits with ruptured plaque compared with the rabbits without ruptured plaque (5.17 ± 1.23 vs. 4.06 ± 1.36 mmol/l; P < 0.001).
Inflammatory and Vascular Functional Markers
As shown in Table 1, levels of hsCRP, sVCAM-1, and sICAM-1 were not significantly different among rabbits in groups A1, A2, and B before pharmacological triggering. However, the three biomarkers were significantly higher in rabbits with ruptured plaque compared with the rabbits without ruptured plaque before triggering (P < 0.001, P = 0.011, P = 0.027, respectively; Table 2). After pharmacological triggering, concentrations of hsCRP, sVCAM-1, and sICAM-1 were all significantly higher in plaque-ruptured group than in nonruptured group (157.8 ± 60.7 vs. 123.6 ± 49.4 ng/ml, P = 0.010; 15.05 ± 4.61 vs. 11.40 ± 4.42 nmol/l, P = 0.001; and 404.57 ± 90.49 vs. 350.11 ± 82.15 pmol/l, P = 0.008, respectively).
Ultrasound and Doppler Measurements
Before pharmacological triggering, ultrasound and Doppler measurements were not significantly different among rabbits in groups A1, A2, and B (Table 1) and between rabbits with or without ruptured plaques, except for the IMT values, which were significantly higher in rabbits with ruptured plaques (Table 2).
IBS Analysis
Before pharmacological triggering, there were no significant differences in IBS measurements among rabbits in groups A1, A2, and B (Table 1) and between rabbits with or without ruptured plaques, except that values of AIIc% in rabbits that developed ruptured plaque were significantly lower than those in rabbits without plaque rupture (Table 2).
IVUS Measurements
Lesions formed after a high-lipid diet generally appeared as poorly echo-reflective, characteristic of lipid-rich, noncalcified and nonfibrotic plaques. IVUS measurements were not significantly different among rabbits in groups A1, A2, and B (Table 1). The differences between IVUS measurements at the end of week 8 before gene transfer and at the end of week 10 before pharmacological triggering (EEMA: 11.10 ± 1.56 vs. 11.22 ± 1.78 mm2; LA: 6.24 ± 1.10 vs. 6.29 ± 1.05 mm2; PA: 4.86 ± 0.89 vs. 4.93 ± 0.91 mm2; PB%: 43.8 ± 6.22 vs. 44.0 ± 6.51; RI: 1.07 ± 0.11 vs. 1.08 ± 0.13) in both group A1 and group A2 were not significant. There were more eccentric plaques in rabbits with ruptured plaques than in those without (P < 0.001), and the levels of EEMA, PA, and PB% in the ruptured group were also significantly larger than those without rupture (P = 0.001, P < 0.001, P = 0.009, respectively). Positive remodeling pattern was observed more frequently in rabbits with ruptured plaques, whereas normal and negative remodeling patterns were more common in rabbits without plaque rupture (Table 2, Fig. 1). Compared with histopathological findings, the sensitivity and specificity results of IVUS in detecting plaque rupture were 80% and 90%, respectively.
|
Inter- and intraobserver variabilities for AII% were 5.9 ± 1.8% and 5.0 ± 2.0%, respectively. The interobserver variabilities for EEMA, LA, and EI were 6.5 ± 1.6%, 2.4 ± 1.4%, and 5.5 ± 2.3%, respectively, and the intraobserver variabilities were 6.1 ± 1.7%, 2.5 ± 1.2%, and 5.0 ± 2.0%, respectively. The interobserver variabilities for TC, TG, HDL-C, LDL-C, sVCAM-1, sICAM-1, and hsCRP were 2.7 ± 1.4%, 2.2 ± 1.1%, 2.3 ± 1.2%, 2.4 ± 1.3%, 7.5 ± 2.0%, 5.4 ± 1.8%, and 6.0 ± 2.4%, respectively, and the intraobserver variabilities were 2.2 ± 1.1%, 2.6 ± 1.5%, 2.5 ± 1.8%, 2.2 ± 1.3%, 5.4 ± 1.5%, 5.7 ± 1.7%, and 7.4 ± 1.9%, respectively. Paired t-test demonstrated no significant difference between any intra- or interobserver measurements of aforementioned parameters.
Histopathology and Immunohistochemistry
Pathological analysis confirmed that plaque disruption and thrombosis occurred in 30 rabbits involving a total of 40 lesions in rabbits treated with Ad5-p53 adenovirus. In rabbits treated with Ad5-LacZ adenovirus, 10 rabbits involving a total of 14 lesions suffered from disruption and thrombosis after triggering. There was no plaque rupture in rabbits from group B. Together, plaque disruption and thrombosis occurred in 40 rabbits involving 54 plaques. The rate of plaque rupture at the site of gene injection was significantly different between group A1 and group A2 (P < 0.001). p53 overexpression in the location of the plaque resulted in a thinner cap and a marked decrease in the number of VSMCs (Fig. 2). The number of
-smooth muscle cell actin-positive cells in rabbits treated with Ad5-p53 was significantly less than that in rabbits treated with Ad5-LacZ (51.0 ± 11.3% vs. 78.9 ± 11.7%, P < 0.001, Fig. 2). There were many inflammatory cells infiltrating into the rupture positions and the thrombi. The caps at the rupture positions were broken. The thrombi were firmly attached to the arterial wall, which had a large amount of platelets, fibrins, and red blood cells (Fig. 2). The positive staining of RAM11 (macrophages) in the sites of Ad5-p53 (17.0 ± 7.4%) and Ad5-LacZ (16.1 ± 5.8%) transfection and the corresponding segment in group B (14.9 ± 6.0%) were not significantly different. However, there were significantly more RAM11-positive cells in the ruptured positions and thrombi than those in nonruptured plaques (40.1 ± 9.9% vs. 14.7 ± 6.7%; P < 0.001). Also, the percentage of positive staining cells of MMP-1 was not significantly different among the three groups (24.6 ± 8.9% vs. 20.2 ± 6.0% or 19.5 ± 4.7%). However, there were significantly more MMP-1-positive cells in the ruptured plaques than in nonruptured plaques (36.6 ± 10.1% vs. 19.0 ± 5.7%; P < 0.001). As expected, there was more positive p53 staining at the sites of p53 adenovirus transfection (36.7 ± 11.2%) than at the sites of Ad5-LacZ transfection (17.1 ± 6.4%) and at the corresponding sites of group B (16.2 ± 6.7%, all P < 0.001, Fig. 2). There was no significant difference between p53-positive staining areas in group A2 and group B.
|
The mRNA expression level of p53 in the aortic plaques of group A1 (61.2 ± 22.3%) was significantly higher than that of group A2 (41.7 ± 20.2%) or group B (35.2 ± 20.2%) (all P < 0.05). However, the difference in mRNA expression level of p53 between group A2 and group B was not significant.
Quantification of Apoptosis
TUNEL staining showed higher VSMC apoptosis rate in group A1 (2.5 ± 0.8%) than in group A2 (1.0 ± 0.3%) or group B (0.9 ± 0.4%) (all P < 0.05). Flow cytometry analysis (Fig. 3) demonstrated a higher VSMC apoptosis rate in group A1 (8.04% ± 1.2%) than in group A2 (6.89% ± 1.0%) or group B (6.61% ± 1.11%) (all P < 0.05).
|
To discover factors that can predict the occurrence of plaque rupture, we used a logistic regression model in which the status of plaque rupture was the dependent variable, and all other biochemical or ultrasound values were entered as independent predictors. Results showed that EI, PA, hsCRP, and AIIc% were significant predictors of the plaque rupture with odds ratios of 7.056 [95% confidence interval (CI): 1.958,
25.430], 1.942 (95% CI: 1.058,
3.564), 1.025 (95% CI: 1.007,
1.043), and 0.856 (95% CI: 0.775,
0.946), respectively, suggesting that increased EI, PA, and hsCRP are significant risk factors of plaque rupture, whereas increased AIIc% is a protector of plaque rupture (Table 3).
|
| DISCUSSION |
|---|
|
|
|---|
Vulnerable atherosclerotic plaque rupture, with subsequent platelet aggregation and coronary thrombosis, is the most common cause of ACS. However, progress on understanding of how an atherosclerotic plaque ruptures and subsequently the effective preventive strategies have been seriously hampered by a lack of a suitable animal model. Studies of domestic and exotic animals have shown that most species will spontaneously develop fatty streaks and in some cases atheromatous lesions with dietary or genetic manipulations; however, rupture and thrombosis are exceedingly rare. With addition of high fat and/or high cholesterol to the diet, lesion development may be accelerated but does not increase the frequency of plaque rupture in most animal models (7). Abela et al. (1) and Rekhter et al. (26) reported that parenteral injection of Russell's viper venom and histamine could induce plaque rupture and thrombosis in balloon-injured cholesterol-fed New Zealand White rabbits. Recently, Johnson and Jackson (15) observed a high frequency of plaque rupture with mural thrombus in younger apolipoprotein E–/–mice fed a high-fat diet. von der Thüsen et al. (35) reported a strategy to promote plaque rupture of preexisting atherosclerotic lesions using p53-induced lesion remodeling in apolipoprotein E–/– mice and found that p53 overexpression within a plaque prompted apoptosis of the VSMCs and a proportional decrease in collagen production in the fibrous cap. However, because of the small size of the blood vessels, mice cannot be examined by some of the clinically used imaging techniques such as IVUS. This limitation makes the mouse model less useful to evaluate modern technologies that can be potentially useful in predicting the plaque rupture.
In the present study, we combined both localized p53 overexpression and pharmacological induction and established a rabbit model of vulnerable plaque suitable for ultrasound diagnosis. p53, a tumor suppressor protein, plays an important role in G1/S cell cycle arrest or apoptosis. Although more experimental evidence is still needed, excessive VSMC apoptosis induced by the transfected and overexpressed p53 could be the main reason for plaque rupture promotion. p53 may exert a destabilizing effect by selectively eliminating synthetic VSMCs or by inducing the transition of VSMCs from a synthetic to a contractile phenotype (35, 38). To simulate the hyperhemodynamic and hypercoagulative state in ACS, we administrated pharmacological triggering. Snake venom contains proteases that activate factors V and X, which leads to thrombosis occurring most likely at sites of endothelial injury. In addition to this procoagulant effect, snake venom is a direct endothelial toxin. However, these effects are less common in the presence of intact endothelium. Histamine is a vasoconstrictor in rabbits that also promotes release of norepinephrine, leading to increased blood pressure and stress on plaques (8). With this double-induction modality, we were able to produce plaque disruption in 81.1% of the experimental rabbits, which has never been achieved in any other animal model (6). This makes it a potentially very useful animal model in studies of plaque rupture.
In this study, we used untreated hypercholesterolemic rabbits as the control group and found that, although the expression of macrophage-positive cells, serum levels, inflammatory markers, and IMT tended to be greater in groups A1 and A2 after adenovirus transfection than in group B, no significant difference was found. A previous study reported that adenovirus vector transfer into normal rabbit arteries resulted in prolonged vascular inflammation and neointimal hyperplasia (23); however, our results showed that adenovirus vector transfection per se did not produce more significant damages to plaques induced by endothelial injury and hypercholesterolemia in rabbits. We believe that our animal model may provide the following advantages: 1) the high rate of plaque rupture in our model makes it a very useful tool for basic research on plaque vulnerability, and 2) a large animal model like rabbits may allow dynamic observations of plaque morphological changes by IVUS in vivo and possible local gene and drug delivery. Although the atherosclerotic lesions formed in rabbits are different from those in mice and humans and plaque rupture induced by p53 gene transfer and pharmacological triggering differs from spontaneous plaque rupture in ACS, plaques vulnerable to rupture in the present study were characterized by a thin cap, a large lipid core, and abundant activated macrophages, features consistent with those of inflamed thin-cap fibroatheroma commonly found in patients with ACS. Moreover, plaques developed disruption in the presence of increased local stress induced by pharmacological triggering, which resembles hemodynamic triggers commonly seen in patients with ACS (36).
Previous studies have shown that acute inflammation may participate in the pathogenesis of plaque vulnerability (5, 33). Thus, inflammatory markers, such as hsCRP, have been suggested in predicting the risk of future cardiovascular events. Liuzzo et al. (18) found that elevated C-reactive protein (>3 mg/l) and serum amyloid A protein at the time of hospital admission predicted a poor outcome in patients with unstable angina. Researchers (2, 14, 20) also found that soluble adhesion molecules (sICAM-1 and sVCAM-1) were associated with an adverse prognosis, and raised concentrations of CRP and sVCAM-1 had a similar degree of sensitivity in predicting future ischemic endpoints. In the present study, we found that hsCRP levels were significantly higher in rabbits that went on to have plaque rupture than in those that did not. The elevated hsCRP persisted after pharmacological triggering and rupture. A similar trend was also observed in levels of sICAM-1 and sVCAM-1 pre- and postrupture. Controlling other covariates in the logistic regression analysis, hsCRP levels appear to be one of the independent predictors for plaque rupture. Our data suggest that inflammatory processes indeed play a major role in plaque rupture, a process detectable before the plaque rupture, rendering it a high diagnostic or prognostic value.
High-frequency ultrasonography and quantitative Doppler flow measurement are frequently used in diagnosing atherosclerotic plaque, such as measuring IMT and velocity at the position of stenosis (25). Kawasaki et al. (16) used ultrasonic IBS to differentiate the tissue characteristics of calcification, fibrosis, lipid pool with fibrous cap, intimal hyperplasia, and thrombus and were able to construct two-dimensional tissue plaque structures in vivo. Many researchers have found that IVUS can identify the features of vulnerable plaques in clinical settings (12, 27, 37). Von Birgelen et al. (34) used IVUS to identify 29 ruptured plaques in arteries also containing nonruptured plaques in the same vessel. They reported that there was a difference in plaque distribution with more eccentric patterns in ruptured than in nonruptured plaques. In the present study, using ultrasonography and quantitative Doppler technique, we have shown that rabbits with higher IMT were more likely to rupture, indicating that plaques with larger lipid cores may be easier to rupture. This is supported by the lower AIIc% using IBS, which exhibited accurate densitometry of lipid cores in rabbits with vulnerable plaques. IVUS also confirmed that eccentric plaques with larger EEMAs and PAs and cross-sectional LA narrowing and positive remodeling patterns are easier to rupture. A recent clinical trial found that plaque-stabilizing therapy with atorvastatin was associated with constrictive remodeling of the arterial wall, and this beneficial effect was related to a reduction of hsCRP level (28), which lends support to our study and signifies that expansive remodeling of the arterial wall may be an important risk factor of plaque vulnerability. Our multivariate logistic regression analysis clearly demonstrated that increased EI, PA, and hsCRP are significant risk factors of plaque rupture, whereas increased AIIc% is a protector of plaque rupture.
There were several limitations in our study. First, although the plaque rupture rate was as high as 81.1% in the Ad5-p53 group after pharmacological triggering, the rate of spontaneous plaque rupture was still low, and further research work is warranted to improve our animal model. Second, the major findings in this study were derived from rabbits, thus requiring clinical confirmation in future studies. However, it is possible that, in clinical patients, an inflammatory process, which degrades the fibrous cap, may have already subsided before plaque rupture that may have been induced by mechanical stress or ruptured angiogenic vessels after the active inflammation. In these situations, biomarkers for active inflammatory process may not be detected in the ruptured plaques.
In conclusion, localized p53 overexpression and Russell's viper venom and histamine injection can reproducibly induce atherosclerotic plaque rupture in rabbits fed atherogenic diet. Although circulating inflammatory markers, e.g., hsCRP, can predict the rupture, ultrasound measurements appear to be a more valuable clinical tool in predicting the plaque vulnerability.
| GRANTS |
|---|
|
|
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
* W. Q. Chen, L. Zhang, and Y. F. Liu contributed equally to this work. ![]()
| REFERENCES |
|---|
|
|
|---|

CT) method. Methods 25: 402–408, 2001.[CrossRef][ISI][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |