AJP - Heart Watch the video to see how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 293: H2870-H2877, 2007. First published August 24, 2007; doi:10.1152/ajpheart.00585.2007
0363-6135/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/5/H2870    most recent
00585.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shioura, K. M.
Right arrow Articles by Goldspink, P. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shioura, K. M.
Right arrow Articles by Goldspink, P. H.

Assessment of cardiac function with the pressure-volume conductance system following myocardial infarction in mice

Krystyna M. Shioura, David L. Geenen, and Paul H. Goldspink

The Center for Cardiovascular Research, Department of Medicine, Section of Cardiology, University of Illinois at Chicago, Chicago, Illinois

Submitted 18 May 2007 ; accepted in final form 20 August 2007


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Myocardial infarction (MI) is a major cause of heart failure (HF) with the progressive worsening of cardiac performance due to structural and functional alterations. Therefore, we studied cardiac function in adult mice following MI using the Millar pressure-volume (P-V) conductance catheter system in vivo during the later phase of compensatory remodeling and decompensation to HF. We evaluated load-dependent and -independent parameters in control and 2-, 4-, 6-, and 10-wk post-MI mice and integrated changes in function with changes in gene expression. Our results indicated a significant deterioration of cardiac function in post-MI mice over time, reflected first by systolic dysfunction, followed by a transient improvement before further decline in both systolic and diastolic function. Associated with the function and adaptive remodeling were transient changes in fetal gene and extracellular matrix gene expression. However, undermining the compensatory remodeling response was a continual decline in cardiac contractility, which promoted the transition into failure. Our study provided a scheme of integrated cardiac function and gene expression changes occurring during the adaptive and maladaptive response of the heart independent of systemic vascular properties during the transition to HF following MI in mice. P-V loop analysis was used to quantitatively evaluate the gradual deterioration in cardiac function post-MI. P-V loop analysis was found to be an appropriate method for assessment of global cardiac function under varying load-dependent and -independent conditions in the murine model with many similarities to data obtained from larger animals and humans.

gene expression; contractility


THE LOSS OF ANY PORTION OF viable myocardium following myocardial infarction (MI) decreases the pumping ability of the heart, which is reflected in a deterioration of cardiac function. Postinfarction remodeling of myocardium occurs to maintain cardiac output (CO). Coupled with changes in the architecture of the left ventricle (LV) are changes in gene expression during the progression from compensatory hypertrophy to chamber dilation associated with heart failure (HF). A better understanding of the functional and molecular phenotypic changes during the transition to HF following MI could be helpful in the treatment and/or prevention of HF (3, 16). The conductance catheter approach to measure the pressure-volume (P-V) relationships has been mainly used in larger animals and humans (1, 24, 31), but recently there has been great interest in the study of smaller animals, especially mice (7, 10, 14, 41). The simultaneous measurement of LV pressure and volume is a state-of-the-art approach to assess global cardiac function directly in vivo under both load-dependent and -independent conditions (3, 6, 23, 43). Echocardiography and magnetic resonance imaging (MRI) are alternative imaging techniques. Both are reliable, noninvasive, and suitable for longitudinal evaluation of regional cardiac function based on LV thickness and morphology, but only under load-dependent conditions. Echocardiography requires postimaging interpretation to derive the parameters, whereas MRI is very expensive and not readily available. MRI has sufficient spatial resolution in plane, but it has limited longitudinal resolution (1-mm slice thickness) affecting volume calculations (6). Therefore, the microconductance catheter has become an increasingly popular method to assess global cardiac function under load-dependent and -independent conditions in vivo in genetically engineered murine models for studies of human diseases (3, 16, 2730). However, there are limited data detailing the functional changes in post-MI mice mainly due to the technically challenging procedure of surgical ligation of the coronary artery and recording hemodynamic changes during each cardiac cycle, in such small animals with high heart rates (6, 23, 32). Despite the development of a microconductance catheter system and microsurgical techniques, it is still critical to optimize these surgical procedures to accumulate replicable functional data in post-MI mice (41).

Our goal was to evaluate functional changes during the transition to HF following MI in adult mice in vivo. We used the Millar P-V conductance catheter system and integrated the changes in cardiac function with changes in gene expression. Although there are reports of cardiac function in intact and post-MI hearts, there are no comprehensive reports of the deterioration of cardiac function in post-MI mice over time using P-V loop analyses (26, 35, 38, 39). This approach permits the integrated assessment of cardiac function in the context of systemic and neurohormonal regulation, which may be helpful in targeting specific temporal and molecular events for the design of new treatments of HF.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The experiments were conducted in accordance with the Institutional Animal Care and Use Committee and National Institutes of Health guidelines.

Animals. Forty C57/BL6 male mice weighing 20–25 g were used. Seven were designated as control without coronary artery ligation and 33 underwent coronary artery ligation, of which 29 (~88%) survived. Three (~10%) did not develop MI based on postprocedural inspection, and an additional two mice (one control and one 4 wk post-MI), did not yield P-V loops with an end-systolic pressure (ESP) higher than 60 mmHg in the open-chest configuration, so they were excluded from final analysis. There were five experimental groups of mice: control (n = 6) and post-MI at 2 wk (n = 7), 4 wk (n = 5), 6 wk (n = 6), and 10 wk (n = 7). Mice were housed separately in cages and kept in a temperature- and a humidity-controlled environment with standard chow and water given ad libitum on a 12-h:12-h light/dark cycle.

Surgical preparation. Mice were initially anesthetized with 3% isoflurane inhaled in a closed chamber and an intraperitoneal injection of etomidate (10 mg/kg). Mice were intubated and connected to a rodent ventilator with a stroke volume (SV) of 0.2–0.4 ml/min and respiration rate of 135 breaths/min. A plane of anesthesia for surgery was regulated by delivery of 1.5% isoflurane through a vaporizer with 100% oxygen. All surgical manipulations were performed under a Zeiss dissecting microscope, maintaining aseptic conditions on a heated surgical pad at 40°C.

MI. A left thoracotomy was performed, and the left main coronary artery was ligated with an 8-0 prolene suture 1 to 2 mm below the ostium as previously described (2, 26). Myocardial blanching indicated a lack of perfusion. The chest cavity was closed in three layers (intercostal muscles, pectoral muscles, and skin) with 7-0 silk sutures. The mouse was gradually weaned off the respirator, and once spontaneous respiration was resumed, the endotracheal tube was removed and the animal placed in a cage on a heating pad until fully conscious.

P-V loop analyses. A 1.4-Fr pressure-conductance catheter (SPR-839; Millar Instruments, Houston, TX) was inserted into the right carotid artery to measure baseline arterial pressure and then fed retrograde into the LV to record baseline hemodynamics in the closed chest with the ARIA Pressure Volume Conductance System (Millar Instruments). A small incision in the diaphragm was made, and open-chest hemodynamics were recorded, followed by transient occlusion of the thoracic vena cava (TVC) to vary venous return during the recording of hemodynamics (17, 45). Subsequently, parallel conductance (Vp) was determined by a 10-µl injection of 15% saline into the right femoral vein to establish the offset due to the conductivity of structures external to the blood pool. The derived Vp was used to correct the P-V loop data (9, 46). All data were analyzed with the PVAN 3.4 software package from Millar Instruments. Afterward, mice were euthanized with an overdose of 5% isoflurane, and their hearts were weighed and frozen in liquid nitrogen for subsequent gene expression analyses.

Infarct quantification. Duplicate 1-mm mid-LV sections of frozen hearts were cut and incubated with 1% triphenyltetrazolium chloride for 20 min at 37°C. The infarct size was determined by planimetry of the infarct zone (white) and expressed as a percentage of the total LV area on digital images at x10 magnification (Advanced SPOT Diagnostic Instruments) (40, 44).

Quantitative RT-PCR. Real-time quantitative polymerase chain reaction (RT-PCR) was performed using a LightCycler thermocycler (Roche Diagnostics). Total RNA was extracted from the apical third of the heart using TRIzol (Life Technologies), and 100 ng were used in a one-step RT-PCR reaction using the RNA amplification kit with SYBR Green 1 (Roche Molecular Biochemical). The reaction conditions for RT were 55°C for 15 min, which was followed by a four-step PCR amplification with signal acquisition at 80–89°C for 2 s (depending on the melting temperature for each PCR product, determined by the melting curve analysis) for 45 cycles. The RT-PCR reaction was quantified using in vitro transcribed mRNA standards, prepared for each gene, that were run alongside to develop a standard curve. The second derivative maximum (log linear phase) for each amplification curve was determined and plotted against the standard curve to calculate the amount of product (12). Samples were normalized against glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression to ensure equal loading. The primers used were as follows: {alpha}-myosin heavy chain ({alpha}-MHC), AAGGTGAAGGCCTACAAGCG and TTTCTGCTGGACAGGTTATTCC (M76601 [GenBank] ); beta-MHC, AAGGTGAAGGCCTACAAGCG and TTCTGCTTCCACCTAAAGGGC (M74752 [GenBank] ); atrial natriuretic factor (ANF), TGGAGGAGAAGATGCCGGTA and CGAAGCAGCTGGATCTTCGTAG (K02781 [GenBank] ); matrix metalloproteinase-2 (MMP-2), AGCTCCCAGAAAAGATTGACG and GATGAGCTTAGGGAAACCGGG (NM_008610 [GenBank] ); MMP-9, GTTTTTGATGCTATTGCTGAGATCCA and CCCACATTTGACGTCCAGAGAAGA (NM_013599 [GenBank] ); and GAPDH, TATGACAATGAATACGGCT and CTCCTGTTATTATGGGGG (M32599 [GenBank] ).

Statistical analysis. The differences in the means between the groups were tested using one-way ANOVA, followed by post hoc analysis for multiple comparisons (Student-Newman-Keuls method) to test for statistical significance (P < 0.05).


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Overall cardiac function gradually declined in post-MI mice over the 10-wk period compared with that in control mice, which is shown in the families of P-V loops obtained during transient TVC occlusions in the open-chest configuration (Fig. 1). A characteristic continuous right shift in the P-V loops and a decline in amplitude of the pressure signal indicated a greater LV operating volume due to dilation of the chamber and a decrease in contractility with time post-MI.


Figure 1
View larger version (19K):
[in this window]
[in a new window]

 
Fig. 1. Representative left ventricular (LV) pressure-volume (P-V) loops from control (A), 2 (B), 4 (C), 6 (D), and 10 (E) wk post-myocardial infarction (post-MI) mice following thoracic vena cava (TVC) occlusion in the open-chest configuration. A characteristic right shift and decline in amplitude of the pressure signal in the P-V loops is indicative of greater LV operating volumes and decreased contractility with time post-MI. ESPVR and EDPVR, end-systolic and -diastolic P-V relationships, respectively.

 
Based on measurements in the right carotid artery, heart rate was unchanged but the mean arterial pressure gradually declined and was significantly depressed by 10 wk post-MI (control, 72 ± 10; 2 wk MI, 61 ± 5; 4 wk MI, 60 ± 9; 6 wk MI, 68 ± 11; and 10 wk MI, 55 ± 13 mmHg; P < 0.05 for the 10 wk MI group).

With the catheter in the LV, the load-dependent hemodynamic parameters were recorded in the closed chest (Table 1). Following an incision in the diaphragm, the load-dependent hemodynamic parameters were then recorded in the open chest after stabilization (Table 2). Data derived in the closed chest showed that by 2 wk post-MI, there was a discernable level of cardiac dysfunction, as noted by a significant decline in several of the load-dependent parameters of systolic function, such as SV, stroke work (SW), CO, and preload-adjusted maximal power (PAMP). These parameters remained significantly depressed at the 4 and 6 wk post-MI and declined further by 10 wk post-MI. Cardiac index derived from CO for the body weight of the animal was significantly decreased at 2 wk post-MI and then declined further by 10 wk post-MI. Pressures and volume within the LV showed characteristic responses with a drop in end-systolic pressure (ESP) and an increase in end-diastolic pressure (EDP), end-systolic volume (ESV), and end-diastolic volume (EDV) at 2 wk post-MI. Although these changes did not reach significance (except with ESV), there was a normalization of these parameters by 4 and 6 wk post-MI, before a significant increase in the volumes noted by 10 wk post-MI indicative of chamber dilation. In comparison, the maximum derivative of change in pressure rise over time (dP/dtmax) and the maximum derivative of change in pressure fall over time (dP/dtmin) demonstrated a continual decline over time but without reaching statistical significance. The time constant of isovolumic relaxation (Tau-Glantz) increased in post-MI mice indicating the onset of diastolic dysfunction, but by 10 wk post-MI, the value was restored to control. Changes in arterial elastance (Ea) directly effect systolic function. Ea, an index of afterload, is the ratio of ESP and SV (25, 36). Overall, Ea was elevated at post-MI and peaked at 6 wk post-MI, suggesting a change in vascular function due to either increased peripheral resistance or gradual stiffening of the arteries. Analysis of total peripheral resistance (TPR), expressed as the mean arterial pressure over CO reflecting cumulative resistance, showed a similar trend, indicating a diminished ability of arterioles to completely relieve pressure in the arteries during diastole post-MI.


View this table:
[in this window]
[in a new window]

 
Table 1. Deterioration of cardiac function in mice at 2, 4, 6, and 10 wk following MI based on P-V loop measurements collected in the closed-chest configuration

 

View this table:
[in this window]
[in a new window]

 
Table 2. Deterioration of cardiac function in mice at 2, 4, 6, and 10 wk following MI based on P-V loop measurements collected in the open-chest configuration

 
Data obtained after a small incision in the diaphragm, but before TVC occlusion, demonstrated similar directional changes as those noted in the closed-chest configuration. Overall values obtained under these conditions were slightly lower than those recorded in the closed chest but were not statistically significant. However, the values obtained in the open-chest configuration revealed a greater level of diastolic dysfunction post-MI; this could be partially explained by the absence of negative thoracic pressure compared with the closed chest. Load-dependent systolic parameters rapidly decreased at 2 wk, continually declined, and in most cases declined further by 10 wk post-MI (Table 2). The pressures and volume within the LV showed a similar response and a trend to normalize by 6 wk post-MI, as seen in the closed-chest configuration. In contrast to the closed-chest data, the dP/dtmax demonstrated a significant decline over the time course compared with that in the control. Likewise, the dP/dtmin also declined and was significantly lower 10 wk post-MI. Similarly, the time constant of isovolumic relaxation ({tau}) increased and remained elevated in post-MI mice, indicating the presence of diastolic dysfunction.

Load-independent hemodynamic parameters, obtained during transient TVC occlusions to vary preload, were used to derive indexes of cardiac contractility and are shown in Fig. 2. The slope of the end-systolic P-V relationship [ESPVR; can be defined by the slope (Ees)] significantly declined by 2 wk post-MI and continued to decline with time following MI (Fig. 2A). Although a decline in the slope of the ESPVR suggests a decrease in contractility, the volume axis intercept of the ESPVR slope reinforces the observation that chamber wall contractility is depressed over a range of increasing volumes (Fig. 2B). Interestingly, the volume axis intercept showed evidence of normalization at 6 wk MI before a steep increase, indicating dilation of the chamber coincidental with decompensation by 10 wk post-MI. The end-diastolic P-V relationship (EDPVR) was elevated at 2 and 4 wk post-MI and then declined without reaching a significant difference (control, 0.15 ± 0.06; 2 wk MI, 0.25 ± 0.16; 4 wk MI, 0.25 ± 0.18; 6 wk MI, 0.18 ± 0.12; and 10 wk MI, 0.17 ± 0.09 mmHg/µl).


Figure 2
View larger version (12K):
[in this window]
[in a new window]

 
Fig. 2. Graphic representation of load-independent parameters [ESPVR (A), maximum derivative of change of pressure rise vs. end-diastolic volume (dP/dtmaxEDV; B), time-varying elastance (Emax; C), and volumeintercept (D)] derived from P-V loops during TVC occlusion in control, 2, 4, 6, and 10 wk post-MI mice. Data are means ± SE. *P < 0.05, #P < 0.01 vs. control.

 
Preload-recruitable SW (PRSW) integrates data from the entire cardiac cycle as a linear relation between SW and EDV and reveals changes in systolic function independent of chamber geometry and Vp (6, 11). The PRSW values demonstrated deterioration in LV contractile function in post-MI mice and were reduced by ~57% by 10 wk post-MI compared with control. dP/dtmax versus EDV (dP/dtmaxEDV) permits an analysis of contractility independent of preload. A continual depression in contractility occurred in post-MI mice that reached statistical significance at 10 wk post-MI compared with control (Fig. 2C).

The time-varying elastance indicates the temporal course of the chamber stiffness and is defined by the proportionality between intraventricular pressure and volume. Time-varying elastance (Emax) decreased in post-MI mice compared with control mice and reached statistical significance by the 6 and 10 wk (Fig. 2D). Finally, cardiac contractile efficiency (CCE) was obtained based on TVC occlusions in the open chest and corrected for parallel conductance. CCE, representing heart work, significantly deteriorated in post-MI mice but improved by 6 wk compared with that in control mice (control, 85 ± 6; 2 wk MI; 73 ± 7; 4 wk MI, 66 ± 7; 6 wk MI, 74 ± 8; and 10 wk MI, 67 ± 11; P < 0.05 for 2 and 4 wk MI; P < 0.01 for 10 wk MI).

The vascular-to-ventricular coupling ratio (Ea/Ees) did increase in post-MI mice and reached statistical significance by 6 and 10 wk post-MI (control, 0.35 ± 0.16; 2 wk MI, 0.56 ± 0.16; 4 wk MI, 0.56 ± 0.2; 6 wk MI, 1.0 ± 0.5; and 10 wk MI, 0.9 ± 0.4; P < 0.05 for 6 and 10 wk MI). The increase in Ea/Ees indicates that the decrease in mechanical efficiency of the ventricle occurred as a result of LV dysfunction largely independent of vascular changes post-MI.

To determine whether the functional decline with time post-MI and the extent of remodeling were similar in each group, infarct size was quantified. The infarcted area, expressed as a percentage of the total LV area, showed that infarcts consistently >40% were created at all time points (Fig. 3A). The heart weight-to-body weight ratios were measured as an index of cardiac hypertrophy. A significant increase in the ratio was seen by 2 wk post-MI and maintained throughout the 10 wk post-MI period compared with that in control mice (Fig. 3B). Gene expression analysis showed a significant increase in the beta-MHC mRNA expression in 2 wk post-MI mice, which then declined to baseline levels by 4 and 6 wk before significantly increasing again in 10 wk post-MI mice (Fig. 3C). Expression of the other embryonic/fetal marker gene, ANF, significantly increased in 2 wk post-MI mice but also declined to baseline level at 4 wk and then did not show any further change (Fig. 3D). Expression of the MMPs have been implicated in the extracellular matrix remodeling as part of the changes in wall structure and chamber geometry post-MI. Analysis of MMP-2 mRNA expression showed that there was an increase beginning at 2 wk MI, which reaches a statistically significant peak by 4 wk before declining to baseline levels at 6 wk post-MI. This was followed by a second increase in MMP-2 expression 10 wk post-MI that was also significantly greater than that in the control (Fig. 3E). MMP-9 expression at baseline was just within the detection range of the assay and showed a similar profile of expression as seen with MMP-2 in the post-MI hearts. Expression peaked and reached statistical significance by 4 wk post-MI before declining toward baseline levels by 6 wk post-MI. Unlike MMP-2, a second increase in expression could not be detected in the 10 wk post-MI hearts (Fig. 3F).


Figure 3
View larger version (23K):
[in this window]
[in a new window]

 
Fig. 3. Quantification of infarct size, cardiac mass, and analysis of gene expression post-MI. A: infarct size. B: heart weight-to-body weight ratios (HW/BW). C: beta-myosin heavy chain (beta-MHC) isoform expression. D: atrial natriuretic peptide (ANF) expression. E and F: metalloproteinase (MMP) expression MMP-2 and MMP-9, respectively. Expression was normalized to GAPDH. Data are means ± SE. *P < 0.05, #P < 0.01 vs. control.

 

    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Our study evaluated changes in cardiac function during the transition to HF following MI in mice using the Millar P-V loop conductance system and integrated changes in gene expression during the remodeling of the ventricle. To our knowledge, this is the first study to characterize the systolic and diastolic functional changes during the transition to HF following MI using the P-V conduction system in mice. Our results demonstrate that P-V loop analysis is an appropriate method for the assessment of cardiac function in the murine model of myocardial infarction, whereas previous reports have focused on later time points post-MI in larger animals or transgenic models of HF (26–28, 35, 47). Our study provided useful insights into contractile changes assessed by load-dependent and -independent parameters in post-MI mice during the stable phase of remodeling and transition to HF in vivo. These changes are depicted in Fig. 4 as a schematic of the functional and molecular events occurring post-MI.


Figure 4
View larger version (39K):
[in this window]
[in a new window]

 
Fig. 4. Schematic representation of the temporal changes in cardiac function during the progression to failure following MI. CO, cardiac output; SV, stroke volume; SW, stroke work; and PAMP, preload-adjusted maximal power.

 
Hemodynamic data obtained in the closed chest are more physiologically relevant due to normal intrathoracic pressures. However, the hemodynamic data obtained in the closed and open chest were not significantly different in the present study (Tables 1 and 2), whereas other studies have found differences (18, 45). This may be due to less trauma and loss of blood associated with accessing the TVC through the diaphragm as opposed to opening the chest cavity to expose the TVC. In addition, our method of transient TVC occlusions seems to be more effective than other reported values with occlusion of the inferior vena cava (18, 27, 28, 31, 45). Although there was variability in some of the parameters, this could be attributed to individual responses to infarcts of over 40%, the sensitivity of the microcatheter to the position in the LV, and the nonlinear electrical properties of myocardium.

Both load-dependent (SV, SW, CO, dP/dtmax/min, {tau}, and PAMP) and -independent (ESPVR, EDPVR, PRSW, and Emax) P-V loop-derived major parameters indicated a gradual decrease in LV function in the post-MI mice. This is depicted by the right shift and decreased amplitude of the P-V loops, indicating that the infarcted hearts were operating over larger volumes and with declining contractility. The overall decline in LV function appeared to result from an initial significant decline in systolic function (ESP, SV, CO, SW, dP/dtmax, and PAMP) occurring at 2 wk, accompanied by a gradual decline in diastolic function (dP/dtmin, {tau}), which showed significance by 10 wk post-MI. However, there were notable rebounds in the volumes that occurred at the 4 and 6 wk post-MI, before declining further by 10 wk post-MI, in both closed and open-chest configurations (Tables 1 and 2). A similar trend was also noted in PAMP. Even though it never improved to control levels, the values at the 4- and 6-wk time points were less statistically significant (P < 0.05) compared with those at the 2- and 10-wk time points (P < 0.01). This apparent improvement may be due to beneficial effects of compensatory hypertrophy as well as scar formation and stabilization, which have been shown to occur in rodents at 2- to 3-wk post-MI (21). Concurrent with some of these functional changes were dynamic changes in myocyte gene expression and expression of the MMPs associated with remodeling of the extracellular matrix. Sustained activation of the fetal gene program (beta-MHC and ANF) did not occur and declined during the period when volumes improved despite the presence of hypertrophy. A similar decline in expression has been previously reported in rodent models of infarction over comparable time points, but others have also shown persistent expression (11, 48). These differences may reflect the use of different detection methodologies, regional variations, and the initial size of the infarct on the extent of remodeling (30). Although some of these variables were not measured in the present study and therefore limit the degree of interpretation, the extent of functional decline we observed is consistent with data published in rat hearts with infarcts >40% (34, 37). Likewise, we report very similar biphasic MMP mRNA expression as previously reported in rats over a similar period (33). In those experiments, however, enzymatic actively was continuous, indicating that remodeling of the extracellular matrix is an ongoing active process during this period. Nevertheless, these rebounds could not be sustained, and all parameters eventually declined by 10 wk post-MI. This phase was associated with a significant decline in diastolic function and accompanied by the reexpression of beta-MHC and MMP-2, suggesting a secondary remodeling, which may represent the decompensation of the LV and transition to HF.

During the cardiac cycle, the work performed by the heart is confined within boundaries defined by EDPVR and ESPVR. Within the normal physiological range of LV systolic and diastolic pressures, ESPVR is relatively independent of preload and afterload, making it a reliable index of LV contractility. The slope of the ESPVR significantly declined by 2 wk post-MI and continued to do so over the 10-wk post-MI period. Together with the other indexes of contractility (PRSW and dP/dtmaxEDV), these data clearly point toward an insidious decline in contractility. Consequently, the compensatory response associated with ventricular remodeling appears to take place independently of changes in contractility. Thus the beneficial effects of hypertrophy are not attributable to factors that regulate cardiac myocyte contractility but rather those geometric changes that transmit the contractile force generated by the myocardium to the ventricular chamber. However, despite these salutary remodeling effects, contractile dysfunction undermines the compensatory response and promotes decompensation into failure. At the cellular level, the contribution of depressed cardiac myocyte contractility in the viable myocardium post-MI is poorly understood. A decrease in myocyte contractility results from the dysregulation of excitation-contraction coupling due to alterations in calcium handling, myofilament function, and/or changes in the cytoskeletal architecture, which alters the passive properties and contractile dynamics of the myocyte. Despite the activation of numerous neurohormonal compensatory mechanisms, the notion that myocyte contractility is depressed in the infarcted heart due to dysregulation of excitation-contraction coupling particularly at the level of calcium handling is supported by several studies. However, others have challenged these findings (5, 13, 15, 19, 42). Recent studies have also shown that there may also be fundamental defects in myofilament function that contribute to the systolic and diastolic dysfunction during the remodeling and transition to HF (5, 42).

Our study provided a scheme of integrated cardiac function and gene expression changes occurring during the adaptive and maladaptive response of the heart during the transition to HF following MI in mice. P-V loop analysis was used to quantitatively assess the gradual deterioration of global cardiac function, which appears to be mainly due to a decrease in systolic function despite a compensatory hypertrophic response post-MI. The systolic dysfunction was apparent before prolongation of relaxation associated with diastolic dysfunction, which became evident during the decompensated phase. Delineating these events could serve for a better understanding of cardiac dysfunction following MI and to the early detection of HF.


    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
K. M. Shioura was supported by National Heart, Lung, and Blood Institute (NHLBI) Training Grant T32-HL-07692. This work was also supported by NILBI Grant P01-HL-62426 and funds from University of Illinois at Chicago Center for Cardiovascular Research (to P. H. Goldspink).


    FOOTNOTES
 

Address for reprint requests and other correspondence: P. H. Goldspink, Univ. of Illinois at Chicago, Dept. of Medicine/Section of Cardiology, 840 S. Wood St. (M/C 715), Chicago, IL 60612 (e-mail: pgolds{at}uic.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Baan J, van der Velde ET, de Bruin HG, Smeek GJ, Koops J, van Dijk AD, Temmerman D, Senden J, Buis B. Continuous measurement of left ventricular volume in animals and humans by conductance catheter. Circulation 70: 812–823, 1984.[Abstract/Free Full Text]
  2. Bialik S, Geenen DL, Sasson IE, Cheng R, Horner JW, Evans SM, Lord EM, Koch CJ, Kitsis RN. Myocyte apoptosis during acute myocardial infarction in the mouse localizes to hypoxic regions but occurs independently of p53. J Clin Invest 100: 1363–1372, 1997.[Web of Science][Medline]
  3. Burkhoff D, Mirsky I, Suga H. Assessment of systolic and diastolic ventricular properties via pressure-volume analysis: a guide for clinical, translational, and basic researchers. Am J Physiol Heart Circ Physiol 289: H501–H512, 2005.[Abstract/Free Full Text]
  4. Costanti PN, Frank LR, McCulloch AD, Omens JH. Role of diastolic properties in the transition to failure in a mouse model of cardiac dilatation. Am J Physiol Heart Circ Physiol 291: H2971–H2979, 2006.[Abstract/Free Full Text]
  5. Daniels MC, Naya T, Rundell VL, de Tombe PP. Development of contractile dysfunction in rat heart failure: hierarchy of cellular events. Am J Physiol Regul Integr Comp Physiol 293: R284–R292, 2007.[Abstract/Free Full Text]
  6. Feldman MD, Erikson JM, Mao Y, Korcarz CE, Lang RM, Freeman GL. Validation of a mouse conductance system to determine LV volume: comparison to echocardiography and crystals. Am J Physiol Heart Circ Physiol 279: H1698–H1707, 2000.[Abstract/Free Full Text]
  7. Fletcher PJ, Pfeffer JM, Pfeffer MA, Braunwald E. Left ventricular diastolic pressure-volume relations in rats with healed myocardial infarction. Effects on systolic function. Circ Res 49: 618–626, 1981.[Abstract/Free Full Text]
  8. Geenen DL, White TP, Lampman RM. Papillary mechanics and cardiac morphology of infarcted rat hearts after training. J Appl Physiol 3: 92–96, 1987.
  9. Georgakopoulos D, Kass DA. Estimation of parallel conductance by dual-frequency conductance catheter in mice. Am J Physiol Heart Circ Physiol 279: H443–H450, 2000.[Abstract/Free Full Text]
  10. Georgakopoulos D, Mitzner WA, Chen CH, Byrne BJ, Millar HD, Hare JM, Kass DA. In vivo murine left ventricular pressure-volume relations by miniaturized conductance micromanometry. Am J Physiol Heart Circ Physiol 274: H1416–H1422, 1998.[Abstract/Free Full Text]
  11. Gidh-Jain M, Huang B, Jain P, Gick G, El-Sherif N. Alterations in cardiac gene expression during ventricular remodeling following experimental myocardial infarction. J Mol Cell Cardiol 30: 627–637, 1998.[CrossRef][Web of Science][Medline]
  12. Goldspink PH, Montgomery DE, Walker LA, Urboniene D, McKinney RD, Geenen DL, Solaro RJ, Buttrick PM. Protein kinase C{varepsilon} over-expression alters myofilament properties and composition during the progression of heart failure. Circ Res 95: 424–432, 2004.[Abstract/Free Full Text]
  13. Gomez AM, Guatimosim S, Dilly KW, Vassort G, Lederer WJ. Heart failure after myocardial infarction: altered excitation-contraction coupling. Circulation 104: 688–693, 2001.[Abstract/Free Full Text]
  14. Grieve DJ, Cave AC, Byrne JA, Layland J, Shah AM. Analysis of ex vivo left ventricular pressure-volume relations in the isolated murine ejecting heart. Exp Physiol 89: 573–582, 2004.[Abstract/Free Full Text]
  15. Gupta S, Prahash AJ, Anand IS. Myocyte contractile function is intact in the post-infarct remodeled rat heart despite molecular alterations. Cardiovasc Res 48: 77–88, 2000.[Abstract/Free Full Text]
  16. Hamosh P, Cohn JN. Left ventricular function in acute myocardial infarction. J Clin Invest 50: 523–533, 1971.[Web of Science][Medline]
  17. Hasnat K, van der Velde ET, Hon JK, Yacoub MH. Reproducible model of post-infarction left ventricular dysfunction: haemodynamic characterization by conductance catheter. Eur J Cardiothorac Surg 24: 98–104, 2003.[Abstract/Free Full Text]
  18. Hoit BD, Ball N, Walsh RA. Invasive hemodynamics and force frequency relationships in open- versus closed-chest mice. Am J Physiol Heart Circ Physiol 273: H2528–H2533, 1997.[Abstract/Free Full Text]
  19. Holt E, Tonnessen T, Lunde PK, Semb SO, Wasserstrom JA, Sejersted OM, Christensen G. Mechanisms of cardiomyocyte dysfunction in heart failure following myocardial infarction in rats. J Mol Cell Cardiol 8: 1581–1593, 1998.
  20. Ikonomidis JS, Hendrick JW, Parkhurst AM, Herron AR, Escobar PG, Dowdy KB, Stroud RE, Hapke E, Zile MR, Spinale FG. Accelerated LV remodeling after myocardial infarction in TIMP-1-deficient mice: effects of exogenous MMP inhibition. Am J Physiol Heart Circ Physiol 288: H149–H158, 2005.[Abstract/Free Full Text]
  21. Jugdutt BI, Joliart MJ, Khan MI. Rate of collagen deposition during healing and ventricular remodeling after myocardial infarction in rat and dog models. Circulation 94: 94–101, 1996.[Abstract/Free Full Text]
  22. Kass DA, Maughan WL, Guo ZM, Kono A, Sunagawa K, Sagawa K. Comparative influence of load versus inotropic states on indexes of ventricular contractility: experimental and theoretical analysis based on pressure-volume relationships. Circulation 76: 1422–1436, 1987.[Abstract/Free Full Text]
  23. Kass DA, Maughan WL. From ‘Emax' to pressure-volume relations: a broader view. Circulation 77: 1203–1212, 1998.
  24. Kass DA, Yamazaki T, Burkhoff D, Maughan WL, Sagawa K. Determination of left ventricular end-systolic pressure-volume relationships by the conductance (volume) catheter technique. Circulation 76: 1422–1436, 1987.[Abstract/Free Full Text]
  25. Kelly RP, Ting CT, Yang TM, Liu CP, Maughan WL, Chang MS, Kass DA. Effective arterial elastance as index of arterial vascular load in humans. Circulation 86: 513–521, 1992.[Abstract/Free Full Text]
  26. Kumar D, Hacker TA, Buck J, Whitesell LF, Kaji EH, Douglas PS, Kamp TJ. Distinct mouse coronary anatomy and myocardial infarction consequent to ligation. Coron Artery Dis 16: 41–44, 2005.[CrossRef][Web of Science][Medline]
  27. Pacher P, Bátkai S, Kunos G. Haemodynamic profile, responsiveness to anandamide of TRPV1 receptor knock-out mice. J Physiol 558: 647–657, 2004.[Abstract/Free Full Text]
  28. Pacher P, Bátkai S, Osei-Hyiaman D, Offertáler L, Liu J, Harvey-White J, Brassai A, Járai Z, Cravatt BJ, Kunos G. Hemodynamic profile, responsiveness to anandamide, and baroreflex sensitivity of mice lacking fatty acid amide hydrolase. Am J Physiol Heart Circ Physiol 289: H533–H541, 2005.[Abstract/Free Full Text]
  29. Pacher P, Liaudet L, Bai P, Mabley JG, Kaminski PM, Virág L, Deb A, Szabó E, Ungvári Z, Wolin MS, Groves JT, Szabó C. Potent metalloporphyrin peroxynitrite decomposition catalyst protects against the development of doxorubicin-induced cardiac dysfunction. Circulation 107: 896–904, 2007.
  30. Pacher P, Liaudet L, Mabley JG, Cziráki A, Haskó G, Szabó C. Beneficial effects of a novel ultrapotent poly(ADP-ribose) polymerase inhibitor in murine models of heart failure. Int J Mol Med 17: 369–375, 2006.[Web of Science][Medline]
  31. Pacher P, Mabley JG, Liaudet L, Evgenov PV, Marton A, Haskó G, Kollai M, Szabó C. Left ventricular pressure-volume relationship in a rat model of advanced aging-associated heart failure. Am J Physiol Heart Circ Physiol 287: H2132–H2137, 2004.[Abstract/Free Full Text]
  32. Patten RD, Aronovitz MJ, Deras-Mejia L, Pandian NG, Hanak GG, Smith JJ, Mendelsohn ME, Konstam MA. Ventricular remodeling in a mouse model of myocardial infarction. Am J Physiol Heart Circ Physiol 274: H1812–H1820, 1998.[Abstract/Free Full Text]
  33. Peterson JT, Li H, Dillon L, Bryant JW. Evolution of matrix metalloprotease and tissue inhibitor expression during heart failure progression in the infarcted rat. Cardiovasc Res 46: 307–315, 2000.[Abstract/Free Full Text]
  34. Pfeffer MA, Pfeffer JM, Fishbein MC, Fletcher PJ, Spadaro J, Kloner RA, Braunwald E. Myocardial infarct size and ventricular function in rats. Circ Res 44: 503–512, 1979.[Abstract/Free Full Text]
  35. Pons S, Fornes P, Hagege AA, Heudes D, Giudicelli JF, Richer C. Survival, haemodynamics and cardiac remodeling follow up in mice after myocardial infarction. Clin Exp Pharmacol Physiol 30: 25–31, 2003.[CrossRef][Web of Science][Medline]
  36. Segers P, Georgakopoulos D, Afanasyeva M, Champion HC, Judge DP, Millar HD, Verdonck P, Kass DA, Stergiopulos N, Westerhof N. Conductance catheter-based assessment of arterial input impedance, arterial function and ventricular-vascular interaction in mice. Am J Physiol Heart Circ Physiol 288: H1157–H1164, 2005.[Abstract/Free Full Text]
  37. Solomon SD, Greaves SC, Rayan M, Finn P, Pfeffer MA, Pfeffer JM. Temporal dissociation of left ventricular function and remodeling following experimental myocardial infarction in rats. J Card Fail 5: 213–223, 1999.[CrossRef][Medline]
  38. Stull LB, Leppo MK, Szweda L, Gao WD, Marbán E. Chronic treatment with allopurinol boosts survival and cardiac contractility in murine postischemic cardiomyopathy. Circ Res 95: 1005–1011, 2004.[Abstract/Free Full Text]
  39. Suzuki Y, Nakano K, Sugiyama M, Imagawa J. betaARK1 inhibition improves survival in a mouse model of heart failure induced by myocardial infarction. J Cardiovasc Pharmacol 44: 329–334, 2004.[CrossRef][Web of Science][Medline]
  40. Takagawa J, Zhang Y, Wong ML, Sievers RE, Kapasi NK, Wang Y, Yeghiiazarians Y, Lee RJ, Crossman W, Springer ML. Myocardial infarct size measurement in the mouse chronic infarction model: comparison of area- and length-based approaches. J Appl Physiol 102: 2104–2111, 2007.[Abstract/Free Full Text]
  41. Tarnavski O, McMullen JR, Schinke M, Nie Q, Kong S, Izumo S. Mouse cardiac surgery: comprehensive techniques for the generation of mouse models of human diseases and their application for genomic studies. Physiol Genomics 16: 349–360, 2004.[Abstract/Free Full Text]
  42. Van der Velden J, Merkus D, Klarenbeek BR, James AT, Boontje NM, Dekkers DH, Steinen GJ, Lamers JM, Duncker DJ. Alterations in myofilament function contribute to left ventricular dysfunction in pigs early after myocardial infarction. Circ Res 95: 85–95, 2004.[CrossRef]
  43. Van Rooij E, Doevendans PA, Crijns HJ, Heeneman S, Lips DJ, van Bilsen M, Williams RS, Olson EN, Bassel-Duby R, Rothermel BA, De Windt LJ. MCIP1 overexpression suppress left ventricular remodeling and sustains cardiac function after myocardial infarction. Circ Res 94: e18–e26, 2004.[Abstract/Free Full Text]
  44. Wang GY, Wu S, Pei JM, Yu XC, Wong TM. {kappa}- and {delta}-Opioid receptors mediate effects of ischemic preconditioning on both infarct and arrhythmia in rats. Am J Physiol Heart Circ Physiol 280: H384–H391, 2001.[Abstract/Free Full Text]
  45. Wang Y, Haider HK, Ahmad N, Xu M, Ge R, Ashraf M. Combining pharmacological mobilization with intramyocardial delivery of bone marrow cells over-expressing VEGF is more effective for cardiac repair. J Mol Cell Cardiol 40: 736–745, 2006.[CrossRef][Web of Science][Medline]
  46. White PA, Brookes CIO, Ravn H, Hjortdal V, Chaturvedi RR, Redington AN. Validation and utility of novel volume reduction technique for determination of parallel conductance. Am J Physiol Heart Circ Physiol 280: H475–H482, 2001.[Abstract/Free Full Text]
  47. Yang B, Larson DF, Watson R. Age-related left ventricular function in the mouse: analysis based on in vivo pressure-volume relationships. Am J Physiol Heart Circ Physiol 277: H1906–H1913, 1999.[Abstract/Free Full Text]
  48. Yue P, Long CS, Austin R, Chang KC, Simpson PC, Massie BM. Post-infarction heart failure in the rat is associated with distinct alterations in cardiac myocyte molecular phenotype. J Mol Cell Cardiol 30: 1615–1630, 1998.[CrossRef][Web of Science][Medline]



This article has been cited by other articles:


Home page
HypertensionHome page
D. Westermann, A. Riad, O. Lettau, A. Roks, K. Savvatis, P. M. Becher, F. Escher, A.H. Jan Danser, H.-P. Schultheiss, and C. Tschope
Renin Inhibition Improves Cardiac Function and Remodeling After Myocardial Infarction Independent of Blood Pressure
Hypertension, December 1, 2008; 52(6): 1068 - 1075.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
K. M. Shioura, D. L. Geenen, and P. H. Goldspink
Sex-related changes in cardiac function following myocardial infarction in mice
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2008; 295(2): R528 - R534.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/5/H2870    most recent
00585.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shioura, K. M.
Right arrow Articles by Goldspink, P. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shioura, K. M.
Right arrow Articles by Goldspink, P. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.