AJP - Heart Calcium Transients and Cell-Sarcomere
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 293: H2952-H2958, 2007. First published August 31, 2007; doi:10.1152/ajpheart.00004.2007
0363-6135/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/5/H2952    most recent
00004.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xu, X.
Right arrow Articles by Cao, J.-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xu, X.
Right arrow Articles by Cao, J.-M.

Hexarelin suppresses cardiac fibroblast proliferation and collagen synthesis in rat

Xiangbin Xu,1,* Jinjiang Pang,1,* Hongchao Yin,2 Meixiu Li,3 Wei Hao,1 Chen Chen,4 and Ji-Min Cao1

1Department of Physiology and Pathophysiology and 2Department of Pathology, Institute of Basic Medical Science, Chinese Academy of Medical Sciences, School of Basic Medical Sciences, Peking Union Medical College, Beijing, China; 3Department of Regional Anatomy, College of Basic Medicine, Jiamusi University, Jiamusi, China; and 4Endocrine Cell Biology, Prince Henry's Institute of Medical Research, Melbourne, Australia

Submitted 2 January 2007 ; accepted in final form 24 August 2007


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Abnormal growth of cardiac fibroblasts is critically involved in the pathophysiology of cardiac hypertrophy/remodeling. Hexarelin is a synthetic growth hormone secretagogue (GHS), which possesses a variety of cardiovascular protective activities mediated via the GHS receptor (GHSR), including improving cardiac dysfunction and remodeling. The cellular and molecular mechanisms underlying the effect of GHS on cardiac fibrosis are, however, not clear. In this report, cultured cardiac fibroblasts from 8-day-old rats were stimulated with ANG II or FCS to induce proliferation. The fibroblast proliferation and DNA and collagen synthesis were evaluated utilizing 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, 3H-thymidine incorporation, and 3H-proline incorporation. The level of mRNA of transforming growth factor (TGF)-beta was evaluated by RT-PCR, and the active TGF-beta1 release from cardiac fibroblasts was evaluated by ELISA. The level of cellular cAMP was measured by radioimmunoassay. In addition, the effects of 3,7-dimethyl-l-propargylxanthine (DMPX; a specific adenosine receptor A2R antagonist) and 8-cyclopentyl-1,3-dipropylxanthine (DPCPX; a specific A1R antagonist) were tested. It was found that incubation with 10–7 mol/l hexarelin for 24 h 1) inhibited the ANG II-induced proliferation and collagen synthesis and the 5% FCS- and TGF-beta-induced increase of DNA synthesis in cardiac fibroblast and 2) reduced ANG II-induced upregulation of TGF-beta mRNA expression and active TGF-beta1 release from fibroblasts. Hexarelin increased the cellular level of cAMP in cardiac fibroblasts. DMPX (10–8 mol/l) but not DPCPX abolished the effect of hexarelin on cardiac fibroblast DNA synthesis. It is concluded that hexarelin inhibits DNA and collagen synthesis and proliferation of cardiac fibroblasts through activation of both GHSR and A2R and diminishment of ANG II-induced increase in TGF-beta expression and release.

growth hormone secretagogues; growth hormone-releasing peptides; heart


ABNORMAL GROWTH OF CARDIAC fibroblasts is critically involved in the pathophysiology of cardiac remodeling induced by hypertension and myocardial ischemia-reperfusion injury (7). Cardiac fibroblasts, which constitute 60% of the total heart cells, contribute to the pathological structure changes in the heart by undergoing proliferation, deposition of extracellular matrix (ECM) proteins such as collagen, and replacement of myocytes with fibrotic scar tissue (17). Thus fibroblast-induced cardiac remodeling may participate in diastolic and systolic dysfunction, leading to congestive heart failure (7).

Hexarelin is one of the synthetic growth hormone (GH) secretagogues (GHSs). GHSs possess strong GH-releasing effects and other neuroendocrine activities, such as stimulatory effects on prolactin and adrenocorticotropic hormone secretion, and influence on sleep and food intake (21, 43). These activities are mediated by specific receptors, GHS receptors (GHSRs), which have also been identified in several peripheral tissues other than the hypothalamus-pituitary system, particularly in the myocardium, where they probably mediate GH-independent activities (36). Recent evidence indicates that GHSs feature a variety of cardiovascular activities, including an increase of myocardial contractility (4, 5, 44), improvement of left ventricular dysfunction and left ventricular pathological remodeling (6, 25, 34), and protection of cardiomyocytes from ANG II-induced apoptosis (35) and myocardial infarction- or pressure overload-induced heart failure in vivo (33, 37, 45). However, the cellular and molecular mechanisms underlying the effect of GHS on cardiac fibroblasts have not been investigated.

Using cultured 8-day-old rat cardiac fibroblasts, we tested whether hexarelin 1) inhibits cardiac fibroblast proliferation [3H-thymidine incorporation and 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) assay] when stimulated with fetal calf serum (FCS) or ANG II, 2) blocks collagen synthesis by cardiac fibroblasts stimulated with ANG II in vitro (3H-proline incorporation into collagenase-sensitive proteins), or 3) affects the expression and release of transforming growth factor (TGF)-beta by cardiac fibroblasts. We also tested whether 8-cyclopentyl-1,3-dipropylxanthine (DPCPX), a selective A1 adenosine receptor (A1R) inhibitor, or 3,7-dimethyl-l-propargylxanthine (DMPX) a selective A2 adenosine receptor (A2R) inhibitor, blocks FCS-induced DNA synthesis.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Reagents. Hexarelin was provided by Dr. R Deghenghi (Europeptide, France). DPCPX, DMPX, and ANG II were purchased from Sigma.

Cardiac fibroblast culture. Primary cultures of rat cardiac fibroblasts were prepared and characterized as described recently with a minor modification (19). Briefly, hearts were removed under aseptic conditions from 8-day-old Sprague-Dawley rats that were overdosed by pentobarbital sodium. All animal experiments were conducted in compliance with the regulations of and approved by the Ethics Committee of Peking Union Medical College. The cardiac ventricles were minced into 2- to 3-mm3 fragments. Digestion was performed by four to six 15-min periods of incubation at 37°C with HEPES-buffered saline solution containing (in mmol/l) 20 HEPES-NaOH (pH 7.6), 130 NaCl, 3 KCl, 1 NaH2PO4, and 4 glucose, along with 3.3 µmol/l phenol red containing 0.1% collagenase II (Sigma), 0.1% trypsin (GIBCO), 15 µg/ml DNase I (Sigma), and 1.0% chicken serum (GIBCO) at 37°C. At the end of each cycle, the supernatant was stored on ice after the addition of newborn calf serum (10%, vol/vol) to neutralize trypsin. The dissociated cells were collected by centrifugation at 1,000 g for 10 min at 4°C and resuspended in DMEM/Ham's F-12 medium supplemented with 5% horse serum, 3 mmol/l pyruvic acid, 100 µmol/l ascorbic acid, 5 µg/ml insulin, 5 µg/ml transferrin, 5 ng/ml sodium selenite, 100 U/ml penicillin, 100 µg/ml streptomycin, and 0.25 mg/l amphotericin B. Cell suspensions were passed through a 200-µm mesh screen (Sigma) into a 100-mm culture dish and incubated for 45 min at 37°C. Unattached cells were discarded; attached cells were washed twice with 10% FCS-DMEM and allowed to grow to confluence before passage in 1:3 dilutions of trypsin-based solution. All cells used in these experiments were taken from passage 2 to 3.

MTT assay. Fibroblast proliferation was evaluated by MTT assay, which is based on the transformation of tetrazolium salt MTT by active mitochondria to an insoluble formazan salt. Cardiac fibroblasts (plating density, 120 cells/mm2) were treated in 96-well plates and grown until 70–80% confluent, synchronized in medium containing 0.1% FCS, and then stimulated to grow synchronously by adding 10–7 mol/l ANG II to the culture medium. After 24 h of treatment with and without hexarelin, MTT was added to each well under sterile conditions (with a final concentration of 0.5 mg/ml), and the plates were incubated for 4 h at 37°C. Untransformed MTT was removed by aspiration, and formazan crystals were dissolved in dimethyl sulfoxide (150 µl/well). Formazan was quantified spectroscopically at 540 nm using Bio-Rad Automated EIA Analyzer (Bio-Rad). The experiments were performed in triplicate with different preparations of fibroblasts.

3H-thymidine incorporation. Fibroblasts were seeded onto 24-well plates containing DMEM supplemented with 10% FCS at a density of 2 x 104 cells/well and allowed to grow until subconfluent, occupying 60–70% of the total surface of the plate. Cells were cultured in serum-free DMEM for 24 h and then treated with 5% FCS either alone or combined with hexarelin (10–7 mol/l). After 20 h, the treatments were repeated with freshly prepared solutions but supplemented with 3H-thymidine (1 mCi/ml) for an additional 4 h.

The procedure for quantitating the incorporation of labeled thymidine was essentially as described by Itoh et al. (23). At the end of the incubation period, the medium was aspirated, and the cells were washed twice with cold phosphate-buffered saline (pH 7.0) washed once with 10% ice-cold trichloroacetic acid (TCA), and then incubated at 4°C for 30 min in 10% TCA. Following aspiration, the cell residue was rinsed in 95% ethanol and dissolved in 0.25 N NaOH at room temperature for 4 h. After ingneutralizing with HCl, the radioactivity was measured by liquid scintillation spectrometry. Triplicate experiments were performed with different preparations of cells.

3H-proline incorporation. Collagen synthesis by confluent cardiac fibroblasts was measured according to the method described by Brilla et al. (10). Briefly, fibroblasts from passage 2 (1 x 105 cells/well) were seeded onto 24-well plates containing 10% FCS-DMEM and allowed to grow until confluent. Cells were cultured in serum-free DMEM for 24 h before the medium was replaced with 0.5% FCS-DMEM. Cells were treated with hexarelin (10–7 mol/l) and/or ANG II (10–7 mol/l) for 18 h followed by 6 h exposure to 3H-proline (14 µCi/well) in fresh serum-free DMEM containing 10–7 mol/l ANG II either alone or combined with hexarelin. After incubation, cells were sonicated on ice, and TCA (final concentration 10% wt/vol) was used to precipitate proteins in the presence of 0.04% proline and 0.1% BSA. The samples were allowed to stand overnight at 4°C before centrifugation. Protein pellets were washed three times with 1 ml of 5% TCA and 1 mmol/l proline, and the final pellet was dissolved in 1 ml of 0.2 mol/l NaOH. Fibroblast proteins were incubated with 1 mmol/l CaCl2 and 2.5 mmol/l N-ethylmaleimide in the presence of either collagenase type III (50 U/ml; Calbiochem) or 2 mmol/l Tris·HCl (pH 7.6) and 0.2 mmol/l CaCl2 for 90 min at 37°C. The vials were placed on ice, and 0.5 ml of 20% TCA-0.5% tannic acid was added to precipitate protein for 1 h. Supernatants were transferred to scintillation vials together with 0.5 ml 5% TCA after centrifugation at 10,000 rpm for 5 min. Scintillation fluid (10 ml) was added to each sample, and radioactivity was determined with a liquid scintillation counter. Triplicate experiments were performed with different cell preparations.

RT-PCR. Total RNA was isolated from cardiac fibroblasts by TRIzol reagent (Gibco BRL, Life Technologies). Total RNA (2 µg) from each sample was reverse-transcribed into cDNA with SuperScript First-Strand Synthesis System (Gibco). The PCR was performed as previously described (35) in a 50-µl reaction volume containing 0.5 µmol/l of each of the following primers: TGF-beta, sense, 5'-GCCCTGGACACCAACTATTGCT-3', antisense, 5'-AGGCTCCAAATGTAGGGGCAGG-3'; and GAPDH, sense, TGAAGGTCGGTGTGAACGGATTTGG, antisense, ACGACATACTCAGCACCAGCATCAC. The reaction system included 10 x 5 µl PCR buffer, 5 µl MgCl2 (25 mmol/l), 1 µl dNTP (10 mmol/l), 2 units Taq DNA polymerase, 1 µl of each primer, and 2 µl of each cDNA sample. In our preliminary experiment, 30 cycles of amplification of GAPDH generated PCR products in a linear increasing phase. Thirty cycles of amplification were therefore performed for GAPDH in a TC-96AE programmable thermal controller (MJ Research, Watertown, MA). The experiments were performed in triplicate with different preparations of cells.

Measurement of active TGF-beta1 release from cardiac fibroblasts. Cardiac fibroblasts were placed in 24-well plates at a density of 2 x 104 cells/well with DMEM supplemented with 10% FCS and allowed to grow until subconfluent. Cells were synchronized in medium containing 0.1% FCS and then stimulated to proliferate by adding 10–7 mol/l ANG II either alone or combined with different concentrations of hexarelin to the culture medium. After a 24-h incubation, the protein levels of bioactive TGF-beta1 in the culture medium were measured by an ELISA Kit (TGF-beta1 Emax ImmunoAssay System, Promega). Briefly, a 96-well ELISA plate (Corning Costar, Cat No. 3590) was coated with 100 µl/well monoclonal mouse anti-human TGF-beta1 antibody overnight at 4°C without shaking. After washing once with Tris-buffered saline plus Tween 20 wash buffer containing 20 mM Tris·HCl (pH 7.6), 150 mM NaCl, and 0.05% (vol/vol) Tween 20, the plate was incubated with 100 µl of sample or standard at room temperature for 90 min with shaking (500 rpm). After a 5-min wash, 100 µl of polyclonal anti-human TGF-beta1 antibody were added into each well and incubated for 2 h at room temperature with shaking. The plate was then washed and incubated with 100 µl-diluted TGF-beta1 horseradish peroxidase conjugate at room temperature for 2 h with shaking. After a further wash, the TMB One Solution was added for 15 min at room temperature in the dark to generate color, and then the reaction was terminated by adding an equal volume of 1 N hydrochloric acid to the well. Absorbance at 450 nm was immediately read with the use of an ELISA microtiter plate reader (Vector II, Perkin-Elmer), and active TGF-beta1 concentrations were determined from a standard curve, with human recombinant TGF-beta1 used as the standard. The active TGF-beta1 concentrations were calculated by reference to the total cellular protein contents of the corresponding samples and reported as picograms per micrograms cellular protein. Duplicate quantitative experiments were performed for each sample.

Measurement of cAMP level in cardiac fibroblasts. The fibroblasts were seeded onto 24-well plates containing DMEM supplemented with 10% FCS at a density of 2 x 104 cells/well and allowed to grow until subconfluent. Cells were synchronized in medium containing 0.1% FCS and then stimulated by hexarelin at different concentrations. After incubation with hexarelin for 10 min, the cAMP level in cardiac fibroblast was determined by radioimmunoassay. Briefly, the cells were lysed in 6% TCA, and the acid was removed by water-saturated diethyl ether extraction. After lyophilization of the aqueous phase, intracellular cAMP was measured with an RIA kit (Amersham). Triplicate experiments were performed with different cell preparations.

Statistical analysis. Data were expressed as means ± SD, and differences in mean values were analyzed by Student's t-test and one-way ANOVA with pairwise multiple comparisons and further analyzed by the Newman-Keuls method. P < 0.05 was considered significant (compared with control unless otherwise specified).


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Hexarelin inhibited ANG II-stimulated proliferation of cardiac fibroblasts. ANG II (10–7 mol/l) significantly increased the proliferation of cardiac fibroblasts compared with the negative control (Fig. 1). In ANG II-stimulated cells, cotreatment with hexarelin (from 10–9 to 10–6 mol/l) dose dependently reduced the ANG II-induced increase of cardiac fibroblast proliferation, as reflected by the optical density (OD) value in the MTT assay (Fig. 1). Hexarelin alone did not affect the rate of proliferation of cardiac fibroblasts (Fig. 1).


Figure 1
View larger version (15K):
[in this window]
[in a new window]

 
Fig. 1. The inhibitory effect of hexarelin on ANG II-induced proliferation of rat cardiac fibroblasts. The survival of 8-day-old rat cardiac fibroblasts was measured by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay after 24-h treatment with ANG II or ANG II + hexarelin. Values are means ± SD of 10 observations. **P < 0.01 vs. control; #P < 0.05; ##P < 0.01 vs. ANG II alone. OD, optical density.

 
Hexarelin decreased the FCS- and TGF-beta-induced 3H-thymidine incorporation in cardiac fibroblasts. FCS induced a significant increase in 3H-thymidine incorporation by rat cardiac fibroblasts compared with the control group, reflecting an increase in DNA synthesis (Fig. 2A). TGF-beta1 exerted a similar effect to FCS but showed relatively less intensity (Fig. 2B). Cotreatment with hexarelin (10–7 mol/l) significantly inhibited FCS- and TGF-beta1-induced increases of 3H-thymidine incorporation. These results indicate that hexarelin (10–7 mol/l) significantly inhibited both FCS- and TGF-beta1-induced increases of DNA synthesis (Fig. 2).


Figure 2
View larger version (13K):
[in this window]
[in a new window]

 
Fig. 2. The inhibitory effect of hexarelin on 5% FCS- and transforming growth factor (TGF)-beta1-induced increase in 3H-thymidine incorporation in cultured cardiac fibroblasts. Hexarelin at 10–7 mol/l significantly inhibited the FCS- (A) and TGF-beta1 (B) -induced increase in DNA synthesis, whereas hexarelin alone did not affect DNA synthesis. *P < 0.05 vs. control; #P < 0.05 vs. FCS alone (A) or TGF-beta1 alone (B). cpm, Counts per minute.

 
Hexarelin reduced ANG II- and TGF-beta1-stimulated collagen synthesis in cardiac fibroblasts. Collagen synthesis was quantified by measuring the incorporation of 3H-proline into collagen protein in confluent rat cardiac fibroblasts incubated with ANG II or TGF-beta1 alone or combined with hexarelin (10–7 mol/l). Increased collagen synthesis induced by ANG II or TGF-beta1 was significantly reduced in the presence of hexarelin (Fig. 3, A and B). Hexarelin alone (10–7 mol/l) had no effect on 3H-proline incorporation (Fig. 3). These results indicate that hexarelin can significantly reduce the ANG II-induced increase in collagen synthesis.


Figure 3
View larger version (13K):
[in this window]
[in a new window]

 
Fig. 3. The inhibitory effect of hexarelin on ANG II- and TGF-beta1-induced increase in collagen synthesis in cultured cardiac fibroblasts. Collagen synthesis was estimated by 3H-proline incorporation into collagenase-sensitive proteins. Note that either ANG II (A) or TGF-beta1 (B) significantly enhanced collagen synthesis, which was blunted by concomitant addition of hexarelin (10–7 mol/l). Hexarelin alone did not have any effect on collagen synthesis. *P < 0.05 vs. control; #P < 0.05 vs. ANG II.

 
Hexarelin inhibited the ANG II-stimulated TGF-beta expression and release from cardiac fibroblasts. The mRNA level of TGF-beta was estimated by semiquantitative RT-PCR, and active TGF-beta was estimated by measuring the release of TGF-beta1 from cardiac fibroblasts using ELISA. ANG II significantly increased the mRNA level of TGF-beta compared with the control group, whereas hexarelin (10–7 mol/l) prevented the ANG II-induced increase in the transcription of TGF-beta (Fig. 4A). ANG II doubled the release of active TGF-beta1 from cardiac fibroblasts compared with the control (Fig. 4B). Hexarelin significantly suppressed the release of active TGF-beta1 from fibroblasts in a dose-dependent manner (Fig. 4B).


Figure 4
View larger version (13K):
[in this window]
[in a new window]

 
Fig. 4. The inhibitory effects of hexarelin on ANG II-induced increase in TGF-beta mRNA transcription and active TGF-beta1 release from cultured rat cardiac fibroblasts. The level of mRNA was estimated by semiquantitative RT-PCR, and active TGF-beta1 release was measured by ELISA. The TGF-beta-to-GAPDH ratios for the vehicle-treated cells were set to 100%. A: Each histogram bar is the corresponding phosphorimage scan of the PCR products detected using the primers marked on the left. *P < 0.05 vs. vehicle-treated cells; #P < 0.05 vs. ANG II-treated cells. B: hexarelin dose dependently reduced ANG II-induced increase in active TGF-beta1 release from cardiac fibroblasts. *P < 0.05 vs. ANG II-treated cells.

 
Both GHSR and A2R mediate the inhibitory effects of hexarelin on the proliferation of cardiac fibroblasts. D-Lys(3)-GHRP-6, a specific GHSR antagonist, abolished the inhibitory effect of hexarelin on 3H-thymidine incorporation induced by 5% FCS in a dose-dependent manner (Fig. 5). This result indicates that the effect of hexarelin on the DNA synthesis and proliferation of cardiac fibroblasts is mediated by GHSR.


Figure 5
View larger version (13K):
[in this window]
[in a new window]

 
Fig. 5. Effect of growth hormone secretagogue receptor (GHSR) antagonist on the inhibitory action of hexarelin on DNA synthesis in cultured cardiac fibroblasts. Note that GHSR antagonist D-Lys(3)-GHRP-6 dose dependently abolished the inhibition of hexarelin on DNA synthesis induced by 5% FCS. **P < 0.01 vs. hexarelin and 5% FCS-treated cells.

 
In 5% serum-stimulated cells, hexarelin (10–7 mol/l) significantly reduced the FCS-induced increase of 3H-thymidine incorporation (Fig. 6A). DMPX at 10–7 mol/l almost abolished the inhibitory effect of hexarelin on the DNA synthesis of cardiac fibroblast compared with the control, whereas 10–7 mol/l DPCPX had no effect on the inhibition of hexarelin (Fig. 6A). DPCPX or DMPX alone (10–7 mol/l) did not significantly affect the FCS-induced increase of 3H-thymidine incorporation (Fig. 6A). The cAMP level in cardiac fibroblasts was significantly increased by hexarelin (Fig. 6B). These results suggest that A2R mediates the inhibitory effect of hexarelin on cardiac fibroblast proliferation, possibly via the cAMP pathway, whereas A1R may not.


Figure 6
View larger version (14K):
[in this window]
[in a new window]

 
Fig. 6. Effects of A1 adenosine receptor (A1R) and A2 adenosine receptor (A2R) antagonists on the inhibitory effect of hexarelin on 5% FCS-induced DNA synthesis and the effect of hexarelin on cellular cAMP level in cultured cardiac fibroblasts. A: DPCPX (an antagonist of A1R) did not affect the action of hexarelin. However, DMPX (an antagonist of A2R) significantly abolished the inhibitory effect of hexarelin on FCS-induced DNA synthesis. **P < 0.01. NS, not significant. B: hexarelin dose dependently increased the cellular level of cAMP. *P < 0.05 vs. control.

 

    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Data presented here indicate that 1) hexarelin inhibits ANG II- and serum-induced rat cardiac fibroblast growth, proliferation, DNA synthesis, and collagen synthesis; 2) the inhibitory effect of hexarelin is mediated through GHSR and A2R with a reduction of ANG II-induced TGF-beta expression and active TGF-beta1 release; and 3) cAMP is involved in the A2R-mediated inhibitory effect of hexarelin on cardiac fibroblast proliferation.

Hexarelin may alleviate cardiac fibrosis by reducing fibroblast proliferation and collagen syntheses. Cardiac fibrosis is a hallmark of heart disease and is the result of a variety of structural changes that occur after pathological stimuli to the cardiovascular system (27). The fibrosis is characterized by a disproportionate accumulation of fibrillar collagen that occurs after myocyte death, inflammation, enhanced workload, hypertrophy, and stimulation by a number of hormones, cytokines, and growth factors (3, 29, 30, 42). The proximal effecter cells in this process are fibroblasts, which constitute the vast majority (>90%) of nonmyocyte cells in the heart (17). Cardiac fibroblasts increase the production of fibronectin and collagen when the heart is exposed to a variety of injuries such as myocardial infarction, pressure overload, and myocarditis. It is believed that an increase in both the number of cardiac fibroblasts and the content of ECMs during cardiac remodeling is a major cause of cardiac dysfunction (9, 31, 32).

GHSs, of which hexarelin is one, have myocardial protective effects, including improving ventricular function in cardiac diseases and cardiac remodeling (25, 34). Based on these observations, we raised the hypothesis that GHS may directly inhibit cardiac fibroblast proliferation and collagen turnover. Our results have shown that ANG II significantly promoted the cardiac fibroblast proliferation and collagen synthesis, whereas incubation with ANG II and hexarelin abolished ANG II-induced proliferation. Meanwhile, FCS significantly increased rat cardiac fibroblast DNA synthesis, but following incubation with both FCS and hexarelin for 24 h, FCS-increased DNA synthesis was inhibited. These findings may throw light on the mechanisms of action of GHS on the heart.

Hexarelin maximally inhibited ANG II-induced collagen synthesis at the same dose that blocked DNA synthesis in fibroblasts. The mechanisms of the inhibitory effects of hexarelin on fibroblasts are still unknown. Possible mechanisms are through GHSR and/or an adenosine receptor directly or downregulation of TGF-beta expression and release indirectly and inhibition of the cardiac fibroblast proliferation. In addition, hexarelin does not seem to have a cytotoxic effect on fibroblasts because cell numbers were not reduced when quiescent fibroblasts were incubated with hexarelin alone.

The inhibitory effects of hexarelin on DNA and collagen synthesis in rat cardiac fibroblasts are mediated by activating both GHSR and A2R. Hexarelin has been found to act via GHSR. The present study shows that a specific GHSR antagonist, D-Lys(3)-GHRP-6, dose dependently abolished the inhibitory effect of hexarelin on DNA synthesis. This result strongly supports the hypothesis that one of the mechanisms of hexarelin-induced inhibition of DNA and collagen, and synthesis and proliferation of cardiac fibroblasts, is through activation of GHSR.

Cardiac fibroblast growth is regulated by several autocrine/paracrine factors (7), including adenosine (26), which has long been known as a "retaliatory" metabolite, particularly in the heart, where it induces cardioprotective effects (26). The biological effects of adenosine are mediated via adenosine receptors, which exist in multiple subtypes (A1R, A2AR, A2BR, and A3R) (26). The currently accepted view is that within the heart, mainly A1 and A2A adenosine receptors are cardioprotective. For example, activation of A1 receptors attenuates sympathetic nerve activity, inhibits renin release from juxtaglomerular cells, and opens cardiac K+ channels (26). By means of activating an A2B receptor, adenosine causes vasodilation, inhibits platelet aggregation, diminishes neutrophil adhesion to vascular endothelial cells, attenuates neutrophil-induced endothelial cell damage, and stimulates nitric oxide release from vascular endothelial cells and vascular smooth muscle cells (15, 20). Although the standard view is that A1 and A2A receptors are the most important with regard to adenosine-mediated cardioprotection, some indirect evidence suggests that adenosine inhibits cardiac fibroblast growth by means of activation of A2B receptors (14, 16). Tullin et al. (41) reported that adenosine is an agonist of the GHSR. Our study demonstrated that hexarelin dose dependently increased the cellular level of cAMP in cardiac fibroblasts. Based on these findings, we speculate that the inhibitory effect of hexarelin on rat cardiac fibroblast proliferation is possibly partially mediated by the adenosine receptor. The present study showed that the specific A2R antagonist DMPX abolished the inhibitory effect of hexarelin on FCS-induced increase of DNA synthesis, whereas specific A1R antagonist DPCPX had no effect on these outcomes. These results suggest that the inhibitory effect of hexarelin on DNA and collagen production in rat cardiac fibroblasts is partially mediated by means of activating the A2R, possibly by the A2BR subtype.

The inhibitory effect of hexarelin on DNA and collagen synthesis in rat cardiac fibroblasts is associated with reduced TGF-beta expression and release in response to ANG II. ANG II has a mitogenic effect in neonatal rat cardiac fibroblasts (38, 39). ANG II also exerts mitogenic effects on adult cardiac fibroblasts (13). As in the neonatal heart, ANG II increases mRNA levels for c-fos, c-jun, jun B, Egr-1, and c-myc in cardiac fibroblasts via the AT1 receptor (38). Furthermore, ANG II increases collagen type I mRNA and the synthesis and secretion of collagen (13) as well as mRNA expression and protein secretion of fibronectin (24). ANG II also increases cardiac fibroblast osteopontin expression and DNA synthesis that are completely blocked by antibodies against osteopontin and beta3 integrin, suggesting that ANG II-induced cardiac fibroblast proliferation may require osteopontin engagement of beta3 integrin (2). In this experiment, we observed stimulation of cardiac fibroblast proliferation and collagen production by ANG II in vitro. In addition to these effects, ANG II increased cardiac fibroblast mRNA expression and protein secretion of TGF-1 (11), which acted in synergy to interfere with the normal structure and function of the surrounding myocardium (11, 12, 28).

TGF-beta has been implicated in several fibrotic disorders, including glomerulonephritis, liver cirrhosis, lung fibrosis, and vascular restenosis (8). In vitro observations indicate that TGF-beta1 stimulates the expression of fibronectin and collagen and their incorporation into the ECM from cardiac fibroblasts (1, 18, 22, 40), indicating that TGF-beta1 plays a crucial role in the myocardial remodeling process, particularly in cardiac fibrosis. The present studies show that administration of ANG II for 24 h significantly increases mRNA expression of TGF-beta and active TGF-beta1 release from cardiac fibroblasts. However, hexarelin abolished ANG II-induced upregulation of TGF-beta expression and active TGF-beta1 release. It is therefore suggested that the effect of hexarelin on collagen production in rat cardiac fibroblasts is associated with a decrease in ANG II-induced TGF-beta expression and active TGF-beta1 release.

In summary, hexarelin inhibits cardiac fibroblast proliferation and collagen synthesis. These inhibitory effects are mediated by A2BR and probably also GHSR and associated with downregulation of TGF-beta expression. Our study suggests that the inhibitory effects of hexarelin on DNA and collagen synthesis in rat cardiac fibroblasts may be considered to be a new mechanism for protective effect of hexarelin on cardiac diseases.


    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by the Distinguished Young Investigator Awards from the Natural Science Foundation of China (NSFC) (30125016 to J.-M. Cao and 30028007 to C. Chen), NSFC Grants (30670863, 30370565, and 30313902 to J.-M. Cao), the National Key Basic Research Program (NKBRP; 973 Program) funded by Ministry of Science and Technology (People's Republic of China) (2006-CB-503806 and 2006-CB-933202 to J.-M. Cao), and Australian National Health and Medical Research Council (to C. Chen). Hexarelin was supplied by Dr. R. Deghenghi (Europeptide, France).


    FOOTNOTES
 

Address for reprint requests and other correspondence: C. Chen, Prince Henry's Institute of Medical Research, PO Box 5152, Clayton, Victoria 3168, Australia (e-mail: chen.chen{at}princehenrys.org); or J.-M. Cao, Dept. of Physiology and Pathophysiology, Inst. of Basic Medical Sciences, Chinese Academy of Medical Sciences, School of Basic Medical Sciences, Peking Union Medical College, Beijing 100005, People's Republic of China (e-mail: caojimin{at}126.com)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

* X. Xu and J. Pang contributed equally to this work. Back


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Agocha A, Lee HW, Eghbali-Webb M. Hypoxia regulates basal and induced DNA synthesis and collagen type I production in human cardiac fibroblasts: effects of transforming growth factor-beta1, thyroid hormone, angiotensin II and basic fibroblast growth factor. J Mol Cell Cardiol 29: 2233–2244, 1997.[CrossRef][Web of Science][Medline]
  2. Ashizawa N, Graf K, Do YS, Nunohiro T, Giachelli CM, Meehan WP, Tuan TL, Hsueh WA. Osteopontin is produced by rat cardiac fibroblasts and mediates A(II)-induced DNA synthesis and collagen gel contraction. J Clin Invest 98: 2218–2227, 1996.[Web of Science][Medline]
  3. Bishop JE, Lindahl G. Regulation of cardiovascular collagen synthesis by mechanical load. Cardiovasc Res 42: 27–44, 1999.[Free Full Text]
  4. Bisi G, Podio V, Valetto MR, Broglio F, Bertuccio G, Aimaretti G, Pelosi E, Del Rio G, Muccioli G, Ong H, Boghen MF, Deghenghi R, Ghigo E. Cardiac effects of hexarelin in hypopituitary adults. Eur J Pharmacol 381: 31–38, 1999.[CrossRef][Web of Science][Medline]
  5. Bisi G, Podio V, Valetto MR, Broglio F, Bertuccio G, Del Rio G, Arvat E, Boghen MF, Deghenghi R, Muccioli G, Ong H, Ghigo E. Acute cardiovascular and hormonal effects of GH and hexarelin, a synthetic GH-releasing peptide, in humans. J Endocrinol Invest 22: 266–272, 1999.[Web of Science][Medline]
  6. Bodart V, Febbraio M, Demers A, McNicoll N, Pohankova P, Perreault A, Sejlitz T, Escher E, Silverstein RL, Lamontagne D, Ong H. CD36 mediates the cardiovascular action of growth hormone-releasing peptides in the heart. Circ Res 90: 844–849, 2002.[Abstract/Free Full Text]
  7. Booz GW, Baker KM. Molecular signalling mechanisms controlling growth and function of cardiac fibroblasts. Cardiovasc Res 30: 537–543, 1995.[CrossRef][Web of Science][Medline]
  8. Border WA, Noble NA. Transforming growth factor beta in tissue fibrosis. N Engl J Med 331: 1286–1292, 1994.[Free Full Text]
  9. Brilla CG, Maisch B. Regulation of the structural remodelling of the myocardium: from hypertrophy to heart failure. Eur Heart J 15, Suppl D: 45–52, 1994.[Abstract/Free Full Text]
  10. Brilla CG, Zhou G, Matsubara L, Weber KT. Collagen metabolism in cultured adult rat cardiac fibroblasts: response to angiotensin II and aldosterone. J Mol Cell Cardiol 26: 809–820, 1994.[CrossRef][Web of Science][Medline]
  11. Campbell SE, Katwa LC. Angiotensin II stimulated expression of transforming growth factor-beta1 in cardiac fibroblasts and myofibroblasts. J Mol Cell Cardiol 29: 1947–1958, 1997.[CrossRef][Web of Science][Medline]
  12. Chua CC, Diglio CA, Siu BB, Chua BH. Angiotensin II induces TGF-beta 1 production in rat heart endothelial cells. Biochim Biophys Acta 1223: 141–147, 1994.[Medline]
  13. Crabos M, Roth M, Hahn AW, Erne P. Characterization of angiotensin II receptors in cultured adult rat cardiac fibroblasts. Coupling to signaling systems and gene expression. J Clin Invest 93: 2372–2378, 1994.[Web of Science][Medline]
  14. Dubey RK, Gillespie DG, Jackson EK. Adenosine inhibits collagen and protein synthesis in cardiac fibroblasts: role of A2B receptors. Hypertension 31: 943–948, 1998.[Abstract/Free Full Text]
  15. Dubey RK, Gillespie DG, Jackson EK. Cyclic AMP-adenosine pathway induces nitric oxide synthesis in aortic smooth muscle cells. Hypertension 31: 296–302, 1998.[Abstract/Free Full Text]
  16. Dubey RK, Gillespie DG, Mi Z, Jackson EK. Exogenous and endogenous adenosine inhibits fetal calf serum-induced growth of rat cardiac fibroblasts: role of A2B receptors. Circulation 96: 2656–2666, 1997.[Abstract/Free Full Text]
  17. Eghbali M. Cardiac fibroblasts: function, regulation of gene expression, and phenotypic modulation. Basic Res Cardiol 87, Suppl 2: 183–189, 1992.
  18. Eghbali M, Tomek R, Sukhatme VP, Woods C, Bhambi B. Differential effects of transforming growth factor-beta 1 and phorbol myristate acetate on cardiac fibroblasts. Regulation of fibrillar collagen mRNAs and expression of early transcription factors. Circ Res 69: 483–490, 1991.[Abstract/Free Full Text]
  19. Farivar RS, Chobanian AV, Brecher P. Salicylate or aspirin inhibits the induction of the inducible nitric oxide synthase in rat cardiac fibroblasts. Circ Res 78: 759–768, 1996.[Abstract/Free Full Text]
  20. Feoktistov I, Biaggioni I. Adenosine A2B receptors. Pharmacol Rev 49: 381–402, 1997.[Abstract/Free Full Text]
  21. Frieboes RM, Murck H, Maier P, Schier T, Holsboer F, Steiger A. Growth hormone-releasing peptide-6 stimulates sleep, growth hormone, ACTH and cortisol release in normal man. Neuroendocrinology 61: 584–589, 1995.[Web of Science][Medline]
  22. Ignotz RA, Massague J. Transforming growth factor-beta stimulates the expression of fibronectin and collagen and their incorporation into the extracellular matrix. J Biol Chem 261: 4337–4345, 1986.[Abstract/Free Full Text]
  23. Itoh H, Pratt RE, Dzau VJ. Atrial natriuretic polypeptide inhibits hypertrophy of vascular smooth muscle cells. J Clin Invest 86: 1690–1697, 1990.[Web of Science][Medline]
  24. Iwami K, Ashizawa N, Do YS, Graf K, Hsueh WA. Comparison of ANG II with other growth factors on Egr-1 and matrix gene expression in cardiac fibroblasts. Am J Physiol Heart Circ Physiol 270: H2100–H2107, 1996.[Abstract/Free Full Text]
  25. Iwase M, Kanazawa H, Kato Y, Nishizawa T, Somura F, Ishiki R, Nagata K, Hashimoto K, Takagi K, Izawa H, Yokota M. Growth hormone-releasing peptide can improve left ventricular dysfunction and attenuate dilation in dilated cardiomyopathic hamsters. Cardiovasc Res 61: 30–38, 2004.[Abstract/Free Full Text]
  26. Jackson EK, Koehler M, Mi Z, Dubey RK, Tofovic SP, Carcillo JA, Jones GS. Possible role of adenosine deaminase in vaso-occlusive diseases. J Hypertens 14: 19–29, 1996.[Web of Science][Medline]
  27. Jugdutt BI. Remodeling of the myocardium and potential targets in the collagen degradation and synthesis pathways. Curr Drug Targ Cardiovasc Haematol Disord 3: 1–30, 2003.
  28. Lee AA, Dillmann WH, McCulloch AD, Villarreal FJ. Angiotensin II stimulates the autocrine production of transforming growth factor-beta 1 in adult rat cardiac fibroblasts. J Mol Cell Cardiol 27: 2347–2357, 1995.[CrossRef][Web of Science][Medline]
  29. Lijnen PJ, Petrov VV, Fagard RH. Induction of cardiac fibrosis by angiotensin II. Methods Find Exp Clin Pharmacol 22: 709–723, 2000.[CrossRef][Web of Science][Medline]
  30. Lijnen PJ, Petrov VV, Fagard RH. Induction of cardiac fibrosis by transforming growth factor-beta(1). Mol Genet Metab 71: 418–435, 2000.[CrossRef][Web of Science][Medline]
  31. Liu YH, Yang XP, Sharov VG, Nass O, Sabbah HN, Peterson E, Carretero OA. Effects of angiotensin-converting enzyme inhibitors and angiotensin II type 1 receptor antagonists in rats with heart failure. Role of kinins and angiotensin II type 2 receptors. J Clin Invest 99: 1926–1935, 1997.[Web of Science][Medline]
  32. Liu YH, Yang XP, Sharov VG, Sigmon DH, Sabbath HN, Carretero OA. Paracrine systems in the cardioprotective effect of angiotensin-converting enzyme inhibitors on myocardial ischemia/reperfusion injury in rats. Hypertension 27: 7–13, 1996.[Abstract/Free Full Text]
  33. Locatelli V, Rossoni G, Schweiger F, Torsello A, De Gennaro Colonna V, Bernareggi M, Deghenghi R, Muller EE, Berti F. Growth hormone-independent cardioprotective effects of hexarelin in the rat. Endocrinology 140: 4024–4031, 1999.[Abstract/Free Full Text]
  34. Nagaya N, Moriya J, Yasumura Y, Uematsu M, Ono F, Shimizu W, Ueno K, Kitakaze M, Miyatake K, Kangawa K. Effects of ghrelin administration on left ventricular function, exercise capacity, and muscle wasting in patients with chronic heart failure. Circulation 110: 3674–3679, 2004.[Abstract/Free Full Text]
  35. Pang JJ, Xu RK, Xu XB, Cao JM, Ni C, Zhu WL, Asotra K, Chen MC, Chen C. Hexarelin protects rat cardiomyocytes from ANG II-induced apoptosis in vitro. Am J Physiol Heart Circ Physiol 286: H1063–H1069, 2004.[Abstract/Free Full Text]
  36. Papotti M, Ghe C, Cassoni P, Catapano F, Deghenghi R, Ghigo E, Muccioli G. Growth hormone secretagogue binding sites in peripheral human tissues. J Clin Endocrinol Metab 85: 3803–3807, 2000.[Abstract/Free Full Text]
  37. Rossoni G, Locatelli V, Gennaro Colonna V, Muller EE, Berti F. Hexarelin, a growth hormone secretagogue, protects the isolated rat heart from ventricular dysfunction produced by exposure to calcium-free medium. Pharmacol Res 42: 129–136, 2000.[CrossRef][Web of Science][Medline]
  38. Sadoshima J, Izumo S. Molecular characterization of angiotensin II-induced hypertrophy of cardiac myocytes and hyperplasia of cardiac fibroblasts. Critical role of the AT1 receptor subtype. Circ Res 73: 413–423, 1993.[Abstract/Free Full Text]
  39. Schorb W, Booz GW, Dostal DE, Conrad KM, Chang KC, Baker KM. Angiotensin II is mitogenic in neonatal rat cardiac fibroblasts. Circ Res 72: 1245–1254, 1993.[Abstract/Free Full Text]
  40. Sigel AV, Centrella M, Eghbali-Webb M. Regulation of proliferative response of cardiac fibroblasts by transforming growth factor-beta 1. J Mol Cell Cardiol 28: 1921–1929, 1996.[CrossRef][Web of Science][Medline]
  41. Tullin S, Hansen BS, Ankersen M, Moller J, Von Cappelen KA, Thim L. Adenosine is an agonist of the growth hormone secretagogue receptor. Endocrinology 141: 3397–3402, 2000.[Abstract/Free Full Text]
  42. Weber KT. Cardiac interstitium in health and disease: the fibrillar collagen network. J Am Coll Cardiol 13: 1637–1652, 1989.[Abstract]
  43. Wren AM, Small CJ, Ward HL, Murphy KG, Dakin CL, Taheri S, Kennedy AR, Roberts GH, Morgan DG, Ghatei MA, Bloom SR. The novel hypothalamic peptide ghrelin stimulates food intake and growth hormone secretion. Endocrinology 141: 4325–4328, 2000.[Abstract/Free Full Text]
  44. Xu XB, Cao JM, Pang JJ, Xu RK, Ni C, Zhu WL, Asotra K, Chen MC, Chen C. The positive inotropic and calcium-mobilizing effects of growth hormone-releasing peptides on rat heart. Endocrinology 144: 5050–5057, 2003.[Abstract/Free Full Text]
  45. Xu XB, Pang JJ, Cao JM, Ni C, Xu RK, Peng XZ, Yu XX, Guo S, Chen MC, Chen C. GH-releasing peptides improve cardiac dysfunction and cachexia and suppress stress-related hormones and cardiomyocyte apoptosis in rats with heart failure. Am J Physiol Heart Circ Physiol 289: H1643–H1651, 2005.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/5/H2952    most recent
00004.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xu, X.
Right arrow Articles by Cao, J.-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xu, X.
Right arrow Articles by Cao, J.-M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.