AJP - Heart Calcium Transients and Cell-Sarcomere
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Heart Circ Physiol 293: H3279-H3289, 2007. First published August 31, 2007; doi:10.1152/ajpheart.00519.2007
0363-6135/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/6/H3279    most recent
00519.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Saifeddine, M.
Right arrow Articles by Hollenberg, M. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Saifeddine, M.
Right arrow Articles by Hollenberg, M. D.

Proteinase-activated receptor-2 activating peptides: distinct canine coronary artery receptor systems

Mahmoud Saifeddine,1 Michelle L. Seymour,2 Yu-Pei Xiao,6 Steven J. Compton,6 Steeve Houle,1,2 Rithwik Ramachandran,1,2,6 Wallace K. MacNaughton,2,4 Serge Simonet,7 Christine Vayssettes-Courchay,7 Tony J. Verbeuren,7 and Morley D. Hollenberg1,2,3,5,6

1Endocrine-Diabetes Group and 2Inflammation Research Network, Departments of 3Pharmacology and Therapeutics, 4Physiology and Biophysics, and 5Medicine, University of Calgary Faculty of Medicine, Calgary, Alberta, Canada; 6Respiratory Medicine, Division of Academic Medicine, University of Hull, Hull, United Kingdom; and 7Division of Angiology, Institut de Recherches Servier, Suresnes, France

Submitted 30 April 2007 ; accepted in final form 28 August 2007


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
In canine coronary artery preparations, the proteinase-activated receptor-2 (PAR2) activating peptides (PAR2-APs) SLIGRL-NH2 and 2-furoyl-LIGRLO-NH2 caused both an endothelium-dependent relaxation and an endothelium-independent contraction. Relaxation was caused at peptide concentrations 10-fold lower than those causing a contractile response. Although trans-cinnamoyl-LIGRLO-NH2, like other PAR2-APs, caused relaxation, it was inactive as a contractile agonist and instead antagonized the contractile response to SLIGRL-NH2. RT-PCR-based sequencing of canine PAR2 revealed a cleavage/activation (indicated by underlines) sequence (SKGR/SLIGKTDSSLQITGKG) that is very similar to the human PAR2 sequence (R/SLIGKV). As a synthetic peptide, the canine PAR-AP (SLIGKT-NH2) was a much less potent agonist than either SLIGRL-NH2 or 2-furoyl-LIGRLO-NH2, either in the coronary contractile assay or in a Madin-Darby canine kidney (MDCK) cell PAR2 calcium signaling assay. In the MDCK signaling assay, the order of potencies was as follows: 2-furoyl-LIGRLO-NH2 >> SLIGRL-NH2 = trans-cinnamoyl-LIGRLO-NH2 >> SLIGKT-NH2, as expected for PAR2 responses. In the coronary contractile assay, however, the order of potencies was very different: SLIGRL-NH2 >> 2-furoyl-LIGRLO-NH2 >> SLIGKT-NH2, trans-cinnamoyl-LIGRLO-NH2 = antagonist. Because of 1) the distinct agonist (relaxant) and antagonist (contractile) activity of trans-cinnamoyl-LIGRLO-NH2 in the canine coronary contractile assays, 2) the different concentration ranges over which the peptides caused either relaxation or contraction in the same coronary preparation, and 3) the markedly distinct structure-activity profiles for the PAR-APs in the coronary contractile assay, compared with those for PAR2-mediated MDCK cell calcium signaling, we suggest that the canine coronary tissue possesses a receptor system for the PAR-APs that is distinct from PAR2 itself.

protease; vascular G protein-coupled receptor

PROTEINASE-ACTIVATED RECEPTORS (PARs) comprise a family of novel G-protein-coupled receptors that are activated proteolytically by serine proteinases like thrombin and trypsin (6, 11, 20, 28, 33). These receptors have a unique activation mechanism involving a proteolytically revealed NH2-terminal "tethered ligand" receptor-activating sequence. Each of the four receptors cloned to date (PAR1 to PAR4) has a distinct tethered ligand sequence. PAR1, PAR2, and PAR4 can be activated selectively by short synthetic peptides based on their tethered ligand sequences, without the need for proteolysis. Such PAR-selective agonists [so-called PAR-activating peptides (PAR-APs)] are of considerable value in assessing the consequences of PAR activation in a variety of tissues, both in vitro and in vivo, in lieu of proteolytic receptor activators that would yield confounding results because of their lack of receptor specificity (11, 12, 14). In particular, the PAR2-APs SLIGRL-NH2, trans-cinnamoyl-LIGRLO-NH2, and 2-furoyl-LIGRLO-NH2 have proved to be the most potent receptor-selective activators of PAR2 from a number of species, including rats, mice, guinea pigs, and humans. The N-acyl derivatives were designed to be aminopeptidase resistant for use in vivo and in vitro. In murine, rat, and human tissues, the 2-furoyl derivative is 10–100 times more potent for activating PAR2 than either SLIGRL-NH2 or trans-cinnamoyl-LIGRLO-NH2, which are about equipotent in activating PAR2 in all species so far examined (15, 23).

In vascular tissue, the endothelium is the principal target for PAR2-APs, which in preconstricted preparations cause an endothelium-dependent relaxation that is both nitric oxide mediated and nitric oxide independent (endothelium-derived hyperpolarization factor-like) (22). Although PAR2 mRNA is present in endothelium-denuded rat aorta tissue, we have been unable to detect a response (contraction or relaxation) to PAR2 activation in such preparations (3, 4, 30). That said, we have detected receptors distinct from PAR2 that can mediate contractile responses caused by PAR2-APs in murine (21) and human (31) vascular tissues by a mechanism that may or may not involve the release of an endothelium-derived contracting factor (31). Specifically, in murine mesenteric arteries, the PAR2-AP trans-cinnamoyl-LIGRLO-NH2 is able to cause an endothelium-independent contractile response in PAR2-null mice, pointing to a novel non-PAR2 vascular contractile receptor for this peptide (21). Thus the PAR2-APs themselves can serve as probes to activate and discover receptors other than PAR2.

We turned to the canine coronary artery as a potential model vascular preparation for understanding the non-PAR2 receptor(s) responsible for the contractile actions of PAR2-APs. This preparation has long been used to evaluate the vasoregulatory properties of thrombin, presumably acting via PAR1 (7, 8, 32, 36). No such studies related to the potential consequences of PAR2 activation in the canine coronary have yet been described, although a role for PAR2 has been suggested for other canine tissue targets like the pancreas and kidney (26, 29). It was our aim, therefore, to evaluate the potential role of PAR2 in regulating canine coronary contractility and to determine whether a receptor other than PAR2 might be involved in the actions of PAR2-APs in this tissue. To this end, we used the potent and receptor-selective PAR2-APs SLIGRL-NH2, trans-cinnamoyl-LIGRLO-NH2, and 2-furoyl-LIGRLO-NH2, all of which have been validated as PAR2 probes for vascular preparations in previous work (3, 12, 14, 15, 23). These peptides are known not to activate PAR1 or PAR4 from many species at concentrations up to 200 µM or higher (14, 22). We also determined by an RT-PCR sequencing approach the partial cleavage/activation sequence of canine PAR2, so as to identify its tethered-ligand-derived sequence and thereby synthesize and test SLIGKT-NH2 as a canine receptor-derived PAR2-AP. The PAR2-APs were used in both endothelium-intact and endothelium-denuded canine coronary ring preparations to obtain a structure-activity relationship (SAR) profile for the contractile and relaxant activities of the agonists. This SAR profile was compared with the one obtained for calcium signaling by the same PAR2-APs in PAR2-expressing cultured MDCK cells, which represent a well-characterized readily studied system that responds to PAR2 activation. Because presently there are no commercially available high-potency receptor-selective PAR2 antagonists, we relied principally on the hypothesis that, according to SAR principles established in the past for adrenoceptors (2), distinct SAR agonist profiles for the agonist PAR2-APs in the contractile and relaxant tissue bioassays, compared with the SAR profile in the PAR2-mediated MDCK calcium signaling assay, would distinguish PAR2 from non-PAR2-mediated responses in the canine coronary.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Test Systems Used

Canine coronary tissues. This study was performed with the cooperation of Dr. J. V. Tyberg, University of Calgary Cardiovascular Research Group, using mongrel dogs (18–20 kg) of either sex and procedures previously described (9). This cooperation, in which animals used for nondrug studies of cardiovascular hemodynamics by the Tyberg laboratory were used jointly for the coronary studies, enabled an efficient and economical use of this valuable resource of canine tissues.

All experiments were done according to a protocol approved by the faculty Animal Care Committee of the University of Calgary, in keeping with the Canadian Council on Animal Care. All animal experiments also conformed to the Guiding Principles for Research Involving Animals and Human Beings of the American Physiological Society. The same principles were followed for experiments done with animals obtained in Suresnes, wherein animals dedicated for the study were used.

Animals were euthanized by a lethal injection of KCl, and the heart was removed for isolation of the left descending coronary artery. The coronary and other vascular tissues were carefully trimmed free of adipose and connective tissue and were either used immediately or were stored overnight at 4°C in a 25 mM HEPES-fortified isotonic Krebs-Henseleit buffer of the following composition (in mM): 115 NaCl, 4.7 KCl, 2.5 CaCl2, 1.2 MgCl, 25 NaHCO3, 1.2 KH2PO4, and 10 glucose, adjusted to pH 7.4. Comparable samples of coronary, renal, and femoral artery tissues were obtained. On the day of an experiment, endothelium-intact arterial rings (5 mm x 2 mm) were cut for use in the organ bath. Because the PARs are regulated by proteolysis (either activated or disarmed), it was not possible to use tissue dissociation methods to assess the action of the PAR-APs in freshly detached cells from the tissues.

Cell culture. Epithelial Madin-Darby canine kidney (MDCK) cells (American Type Culture Collection, Manassas, VA) were cultured in 75-cm2 plastic T-flasks (NUNC, VWR International, Mississauga, ON) at 37°C using DMEM (GIBCO, Grand Island, NY) supplemented with 10% FCS under a humidified atmosphere of 5% CO2 in room air. These cells offer the advantage that, unlike other canine-derived cultures, the cells are readily released from the culture surface without the use of trypsin and can be easily "loaded" with calcium indicator dye (fluo 3) for the study of calcium signaling in cell suspensions. For studies of PAR2-stimulated increases in intracellular calcium, cells were propagated without the use of trypsin by resuspension in EDTA-containing isotonic PBS (cell dissociation buffer, enzyme-free; GIBCO).

Measurements Made

Monitoring contractile and relaxant responses. Arterial rings were suspended in a gassed (95% O2-5% CO2) plastic cuvette containing the above-described Krebs-Henseleit buffer without addition of HEPES (buffer volume 3.5 ml) under a resting tension of 1 g, which was found to be optimal for observing contractile responses in the preparations. Tissues were equilibrated in buffer for a minimum of 1 h before each experiment was started. Endothelial integrity (or lack thereof in denuded preparations) was verified by monitoring the presence or absence of a relaxant response to substance P (0.01–1 µM) for rings that had been preconstricted with 1 µM PGF2{alpha}. After changes in tension were monitored, using either Grass or Statham force-displacement transducers, the preparation was washed free of added reagents and reequilibrated in buffer for a minimum of 20 min before the addition of other test reagents.

Relaxant responses. The relaxant responses of PGF2{alpha}-preconstricted endothelium-intact preparations were monitored for a number of PAR-APs at concentrations in the range of 0.5–50 µM. As indicated in RESULTS, the variability in the relaxation response to the same peptides from one preparation to another precluded measurements of reliable concentration-response curves. Thus only representative responses are shown, reflecting comparable observations made in four or more independently prepared coronary preparations.

Contractile responses and measurements of antagonism by trans-cinnamoyl-LIGRLO-NH2. The main focus of our study was on the reproducible contractile responses caused by the PAR2-APs. Tissues at baseline tension (1.0 g) were exposed to increasing concentrations of the PAR2-APs, and tension was allowed to reach a plateau, at which time a wash procedure removed all agonists from the tissue bath and the tissue was reequilibrated for 20 min between exposure to agonists. To construct concentration-effect curves for evaluating the SAR of the peptide agonists, responses to increasing concentrations of each peptide were expressed as a percentage (%KCl) of the contraction caused in the same tissue by 50 mM KCl. At each peptide concentration evaluated, data from four or more independently prepared tissue preparations were pooled. Data points for the concentration-contraction curves represent the averages ± SE for pooled measurements. To assess the ability of trans-cinnamoyl-LIGRLO-NH2 to antagonize the contractile action of SLIGRL-NH2, tissues were first exposed to 50 µM SLIGRL-NH2 and a contractile response was measured. After the tissue was washed free of peptide and reequilibrated in fresh buffer for 20 min, the preparation was treated for 10 min with a predetermined concentration of trans-cinnamoyl-LIGRLO-NH2, and the reduced response to the addition of 50 µM SLIGRL-NH2 in the continued presence of trans-cinnamoyl-LIGRLO-NH2 was again measured. The contractile response of the tissue in the presence of trans-cinnamoyl-LIGRLO-NH2 was then expressed as a percentage (%control) of the response to SLIGRL-NH2 in the absence of trans-cinnamoyl-LIGRLO-NH2. Measurements done with a minimum of four independently prepared coronary rings were obtained for increasing concentrations of trans-cinnamoyl-LIGRLO-NH2. Data are plotted as means ± SE for observations at each concentration of trans-cinnamoyl-LIGRLO-NH2. To minimize the effect of nitric oxide, tissues were treated with 0.1 mM nitro-L-arginine methyl ester (L-NAME) before the addition of agonists to the organ bath. Measurements of the contractile responses to the PAR2-APs and to the PAR1-AP TFLLR-NH2 were made in tissues that were maintained at 1-g resting tension, without preconstriction with PGF2{alpha}.

Monitoring calcium transients. To evaluate the SARs for the PAR2-APs in a recognized canine cell target that responds reliably to PAR2 activation, we used the increased intracellular calcium response of cultured MDCK cells. Measurements of increases in intracellular calcium triggered by PAR2 activation, as monitored by increases in fluo 3 fluorescence at 530 nm (excitation wavelength of 480 nm), were done with cell suspensions as previously described in detail elsewhere (3, 14). The fluorescence signals caused by the addition of test agonists [PAR-APs added to 2 ml of a cell suspension (final concentration of cells: ~1 x 106/ml in the above buffer)] were compared with the fluorescence peak heights yielded by replicate cell suspensions treated with 2 µM of ionophore A-23187 (Sigma-Aldrich, St. Louis, MO). To construct concentration-response curves for fluorescence yield, the signals caused by the addition of each concentration of the test agonists (PAR2-APs) were expressed as a percentage (%A-23187) of the fluorescence peak height yielded by replicate cell suspensions when treated with 2 µM of the ionophore A-23187. This concentration of A-23187 was at the plateau of its concentration-response curve for a fluorescence response. Previous work (14) has shown that the fluorescence response of a cell preparation relative to 2 µM A-23187 is a valid reference standard in the determination of concentration-response curves for all PAR agonists. Under these conditions, the calculated values for intracellular calcium in a variety of cultured cells were ~30 nM under basal conditions and ~340 nM on exposure to A-23187 (3, 13, 24). In addition, in previous work, our group (14) observed, as expected, that the presence of PAR2-APs in the cell suspensions does not affect the fluo 3 signal generated by the intracellular calcium indicator in response to other agonists such as lysophosphatidic acid.

Isolation of RNA, RT-PCR amplification of PAR2 mRNA, and nucleotide sequencing of canine PAR2. Cellular RNA was isolated either from confluent cultures of MDCK cells or from quick-frozen isolated canine heart, lung, and intestinal tissues. Left anterior descending (LAD) coronary artery segments (3–5 cm long) were dissected free of adventitial connective tissue and trimmed before processing. A section of left ventricular tissue immediately adjacent to the LAD coronary was similarly processed. In brief, the tissue, quick-frozen in liquid nitrogen, was pulverized with a ceramic mortar and pestle and homogenized by passing through a QIAShredder (Qiagen, Mississauga, ON, Canada), and RNA was extracted from cell and homogenized tissue samples with an RNeasy kit (Qiagen) according to the manufacturer's instructions. MDCK cell and tissue cDNA was reverse transcribed at 37°C for 60 min using the first-strand cDNA synthesis kit (Pharmacia, Uppsala, Sweden) or the omniscript RT kit (Qiagen) according to the manufacturer's recommendations.

To determine the canine receptor sequence, the RT product from the MDCK cells was used for PCR amplification to determine a full-length receptor cDNA with overlapping primer pairs flanking the entire coding region. The primer pairs were originally designed on the basis of the published rat PAR2 sequence (30). The sequence of the receptor representing the "cleavage/activation" domain containing the "tethered ligand" was determined with the following primer pair: 5'-TCAAGCTTCCACCATGCGAAGTCTCAGCCTGGC-3' was the forward primer for PAR2 (containing a HindIII site and Kozak sequence shown in bold) and 5'-CCCGGGCTCAGTAGGAGGTTTTAACAC-3' was the PAR2 reverse primer (containing SmaI site shown in bold). For a semi-quantitative estimate of the relative abundance of mRNA for PAR1 and PAR2 in the tissue samples, we used primer pairs that were targeted to comparable regions of the two receptors. For PAR1, the primer pair was AGTGCTCCCCTTCAAGATCA (forward) and AGGGTTTCATTGAGCACGTC (reverse), with expected PCR product size of 327 bp. For PAR2, the second set of primer pair used for this purpose was CTTGGCAGACCTCCTTTCTG (forward) and ATAGCAGGAGAGCGGAGTGT (reverse), with expected PCR product size of 467 bp. The RT-PCR products for the two PARs were compared with the RT-PCR product for β-actin in the same samples. The primer pair used for actin was GGGTCAGAAGGATTCCTATG (forward) and GGTCTCAAACATGATCTGGG (reverse), with an expected PCR product size of 237 bp.

Routinely, amplification was done with 2.5 U of Taq DNA polymerase [Promega (Madison, WI) or Qiagen] in a 10 mM Tris·HCl buffer, pH 9.0 (final volume of 50 µl), containing 1.5 mM MgCl2, 50 mM KCl, 0.1% (vol/vol) Triton X-100, and 0.2 mM of each dNTPs. Amplification was allowed to proceed for 35 cycles beginning with a 1-min denaturing period at 94°C, followed by a 1-min reannealing time at 55°C, and a primer extension period of 2 min at 72°C.

The PCR products, analyzed along with a standard size oligonucleotide "ladder" mix (Mass Ruler, Fermeutas, Burlington, ON, Canada), were separated by 1.5% agarose gel electrophoresis and visualized with ethidium bromide. Images of the gels were acquired with a gel documentation system (Bio-Rad) and the Quantity One image acquisition software (Bio-Rad). Intensities of bands were determined by densitometry analysis using the NIH ImageJ image processing software, and signals of the RT-PCR products for the two PARs were expressed relative to the signal for β-actin in the same sample (see GoGoGoGoGoGoFig. 7). The identities of the RT-PCR products from the MDCK cell source and the tissue sources were verified by automated DNA sequencing methods conducted by the University Core DNA Services at the University of Calgary Faculty of Medicine and confirmed to be in agreement with the canine PAR sequences.


Figure 1
View larger version (15K):
[in this window]
[in a new window]

  		Fig. 1. Relaxant and contractile responses of the coronary artery to proteinase-activated receptor-2 (PAR2)-activating peptides (APs): representative responses. Representative tracings are shown for 3 different experiments (traces A–C) in which the responsiveness of the left anterior descending (LAD) coronary ring to PGF2{alpha} and the presence of an intact endothelium, as evidenced by a relaxant response to substance P (SP), were first monitored (traces A–C, left). Tissues were then washed (designated by the tracing separation //) and were either 1) constricted again with PGF2{alpha}, followed by the addition of a PAR2-AP (traces A–C) and the PAR1-AP, TFLLR-NH2 (TF-NH2: trace C), or 2) were washed, pretreated with nitro-L-arginine methyl ester (L-NAME), and then exposed at baseline tension to the PAR2-AP trans-cinnamoyl-LIGRLO-NH2 (tcL-NH2) and SLIGRL-NH2 (SL-NH2) (traces A and B). Each trace shows data obtained in a single coronary ring preparation. Traces A–C represent data obtained with tissues obtained from 4 or more animals in separately conducted experiments.

 

Figure 2
View larger version (10K):
[in this window]
[in a new window]

  		Fig. 2. Concentration-effect curves for the contractile action of PAR2-APs in the coronary artery. Contractile responses of the LAD coronary rings to the PAR2-APs, such as those shown in Fig. 1, were monitored in individual ring preparations for increasing concentrations of each peptide. 2fL-NH2, 2-furoyl-LIGRLO-NH2; GKT-NH2, SLIGKT-NH2. Contractions are expressed as a percentage (%KCl) of the contraction caused in the same tissue by 50 mM KCl. Each data point represents the average response (±SE; bars) for measurements done in 3 or more separate anterior descending coronary preparations coming from different animals. Error bars are not shown when SE values are smaller than symbols.

 

Figure 3
View larger version (13K):
[in this window]
[in a new window]

  		Fig. 3. Contractile actions of SL-NH2: representative blockade by tcL-NH2 and concentration-inhibition curve. Top: representative tracing showing an individual coronary ring preparation that was first tested for its contractile response to SL-NH2, washed (//), and then rechallenged with SL-NH2 after the addition of tcL-NH2 along with L-NAME. Trace represents comparable results obtained with 3 or more coronary preparations coming from 3 or more individual animals. Bottom: concentration-inhibition curve for the ability of tcL-NH2 to attenuate the contractile action of SL-NH2 (50 µM) in either LAD or circumflex coronary rings, as measured for increasing concentrations of tcL-NH2. Symbols at each concentration of tcL-NH2 represent the average inhibition (bars are ±SE) observed for 4 different coronary preparations.

 

Figure 4
View larger version (8K):
[in this window]
[in a new window]

  		Fig. 4. Lack of endothelial dependence of the contractile response: enhancement by indomethacin (INDO). The contractile responses to SL-NH2 (50 µM) were monitored in anterior descending coronary rings with or without an intact endothelium either in the presence or absence of 1 µM indomethacin. Bars represent the average contractile responses (±SE) in preparations either with or without an intact endothelium evaluated either in the absence or in the presence of 1 µM indomethacin. Measurements were done with 3 or more individual ring preparations coming from 2 or more different animals.

 

Figure 5
View larger version (13K):
[in this window]
[in a new window]

  		Fig. 5. Calcium signaling in Madin-Darby canine kidney (MDCK) cells stimulated by peptide agonists of PAR2 and PAR1: representative tracings. E530, emission at 530 nm. Representative increases in MDCK cell intracellular calcium (upward deflection) are shown for each of the synthetic PAR2-APs studied (all at 100 µM), as well as for the receptor-selective PAR1-AP TFLLR-NH2 (TF-NH2). The response to the PAR1-AP was monitored in cells that had first been PAR2 desensitized by repeated exposure to a relatively high concentration of SL-NH2 (50 µM; not shown). All responses can be compared with the maximal response due to the addition of 2 µM of the calcium ionophore A-23187.

 

Figure 6
View larger version (12K):
[in this window]
[in a new window]

  		Fig. 6. Concentration-effect curves for calcium signaling in MDCK cells. Calcium signaling responses in cultured MDCK cells, as illustrated in Fig. 5, were monitored for increasing concentrations of the same PAR2-APs. Values at each peptide concentration represent the average responses for 3 or more measurements done with cells coming from 3 or more separately cultured stocks of MDCK cells. SE values are smaller in magnitude than symbols and are therefore not shown.

 

Figure 7
View larger version (21K):
[in this window]
[in a new window]

  		Fig. 7. Analysis of mRNA for PAR2 and PAR1 in coronary, ventricular, lung, and intestinal tissue. Samples were obtained from heart [descending coronary artery (DCA) and ventricle], lung, and intestinal tissues, quick frozen, and then processed for RT-PCR analysis as described in MATERIALS AND METHODS. A: gels of ethidium bromide signals visualized for PAR1, PAR2, and β-actin. B: abundance of mRNA for the PARs, relative to that for β-actin, as determined by scanning densitometry. Error bars show SE for n = 3.

 
Drugs, Chemical Reagents, and Other Materials

All peptides, including the PAR2 peptide antagonist LIGK-NH2, were synthesized as carboxy-amides (>95% purity, assessed by HPLC and mass spectrometry) by the Peptide Core Facility at the University of Calgary (peplab{at}ucalgary.ca). The PAR2 peptide antagonist LIGK-NH2 (ENMD 1005) was kindly provided by EntreMed (Rockville, MD), courtesy of Dr. Todd Hembrough. Unless otherwise indicated, all remaining chemicals, including substance P, neurokinin A, L-NAME, and PGF2{alpha}, were purchased from Sigma-Aldrich, as was the neurokinin-2 (NK2)-tachykinin receptor antagonist cyclo(QWFGLM) (L-659,877). The neurokinin-1 (NK1)-receptor antagonist GR-82334 was from Cedarlane Laboratories (Hornby, ON, Canada). Peptides as stock solutions of 1 mM or greater were dissolved in PBS containing 25 mM HEPES (pH 7.4). 4-Amino-5(4-methylphenyl)-7-(t-butyl)pyrazolo [3,4-D]pyrimidine (PP1) was from Calbiochem (La Jolla, CA).

Data Analyses and Statistical Procedures

Presented values represent the averages (±SE) of three or more measurements made with two or more independently grown cell culture crops or with four or more isolated vascular rings derived from several different animals. In figures, error bars are not shown when the magnitude of the error bar is smaller than the size of the symbols used to represent the data.


   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
Relaxant and Contractile Responses in Coronary Artery Rings: Agonist and Antagonist Actions of trans-Cinnamoyl-LIGRLO-NH2

Relaxant actions. Our first aim was to assess the relaxant and contractile actions of the PAR-APs in the bioassay. Similar to substance P (0.01–1 µM), the PAR2 peptide agonists trans-cinnamoyl-LIGRLO-NH2, SLIGRL-NH2, and 2-furoyl-LIGRLO-NH2 all caused a relaxant response in rings that had been precontracted with PGF2{alpha} (Fig. 1, left; data not shown for 2-furoyl-LIGRLO-NH2). At concentrations (50 µM) 10-fold higher than those used for trans-cinnamoyl-LIGRLO-NH2 and SLIGRL-NH2, the canine-derived PAR2-tethered ligand sequence (SLIGKT-NH2) failed to cause a relaxant response, presumably because of its low biological potency (see below). For reasons we could not ascertain, although we observed a relaxant response to substance P in all preparations examined, there was considerable variation among different tissues in the ability of the PAR2 agonists to cause relaxation in otherwise substance P-responsive tissues. In our preliminary series of 15 separate experiments with LAD coronary arterial tissues coming from different mongrel dogs of both sexes, a relaxation response to SLIGRL-NH2 was observed in only six tissues. The responses of acutely isolated tissues were as variable as were tissues that were stored in the refrigerator in buffered saline overnight before the preparation of the rings for the assay. There was no correlation between the sex of the animal and the absence of relaxant response to the PAR2-APs. We were unable to determine the cause of this variability and therefore were not able to obtain reliable concentration-relaxation response curves for several PAR2 agonists. Notwithstanding, on four or more occasions, we did observe relaxant response to the PAR2-APs tested, as shown by the representative tracings in Fig. 1 for SLIGRL-NH2 and trans-cinnamoyl-LIGRLO-NH2. In contrast, the selective PAR1-AP TFLLR-NH2, which routinely elicited a contractile response at baseline tension (see below), uniformly failed to cause relaxation in tissues that otherwise relaxed in response to SLIGRL-NH2 (Fig. 1C). In preparations that did relax in response to repeated exposures to both substance P and SLIGRL-NH2, L-NAME did not affect the relaxant response to either agonist (not shown). Nonetheless, to eliminate any potential effect of endothelial-derived nitric oxide in the preparations, we treated the tissues with L-NAME when we went on to assess the ability of the peptides to cause a contractile response (see Contractile actions). Given the lack of consistency of the relaxant assay and because our primary aim was to study the pharmacology of the PAR2-AP-induced contractile response, we did not evaluate the relaxant assay further and turned our attention to study the contractile assay.

Contractile actions. To assess the ability of the PAR2 agonists to cause a contractile response, tissues were, as mentioned above, first treated with L-NAME to eliminate any potential production of nitric oxide, followed by exposure of the tissue to the peptide agonists. At baseline tension, SLIGRL-NH2 (but not the partial reverse peptide LSIGRL-NH2; not shown) elicited a contractile response, whereas the aminopeptidase-resistant PAR2-AP trans-cinnamoyl-LIGRLO-NH2 did not (Fig. 1, A and B, right), even in preparations in which it did cause a relaxant response at comparatively low concentrations (Fig. 1A). The contractile responses caused by SLIGRL-NH2 in tissues used immediately after isolation from the heart were not different from the responses of coronary tissues that had been stored at 4°C overnight. Therefore, to conserve on the use of animals, tissues that had been stored overnight were used for much of the work. Unlike the variability of the relaxation response, SLIGRL-NH2 regularly caused a contractile response in all tissues evaluated. The contractile response was reproducible on washing the preparation and repeatedly exposing the tissue to the peptide. At a concentration of 100 µM, the PAR2-AP SLIGRL-NH2 also caused a contractile response in the circumflex coronary artery and in preparations of the femoral and renal arteries either with or without an intact endothelium (data not shown); the carotid artery responded only minimally to the peptide at this concentration. The coronary artery tissue responded best to the peptides and was therefore used for further studies of the peptide structure-activity profiles.

Peptide structure-activity profiles. As shown by the concentration-effect curve for the LAD coronary artery, the contractile action of SLIGRL-NH2 was maximal at ~50 µM, with an EC50 of ~15 µM (Fig. 2). The other PAR2-APs, including the canine PAR2-derived peptide SLIGKT-NH2, also caused a contractile response but with potency much lower than that of SLIGRL-NH2 (Fig. 2). The potency order of the PAR2-APs inthe contractile assay was as follows: SLIGRL-NH2 >> 2-furoyl-LIGRLO-NH2 >> SLIGKT-NH2.

Because of the lack of contractile activity of trans-cinnamoyl-LIGRLO-NH2, we wondered whether it might be an antagonist. Indeed, as shown by the representative tracing in Fig. 3, top, when added first to the organ bath, this peptide was able to attenuate the contractile action of SLIGRL-NH2. A comparable antagonism of the contractile action of 2-furoyl-LIGRLO-NH2 was also observed (not shown). In contrast, high concentrations (100–200 µM) of the partial reverse PAR2-derived peptide LSIGRL-NH2, which cannot activate PAR2 and which did not cause a contractile response, did not block the contractile action of SLIGRL-NH2 (not shown). The IC50 for the ability of trans-cinnamoyl-LIGRLO-NH2 to block the contractile action of 50 µM SLIGRL-NH2 was in the range of 30–70 µM (Fig. 3, bottom). A comparable inhibitory potency for this peptide was found in both the anterior descending and circumflex arteries. In contrast, the peptide PAR2 antagonist LIGK-NH2 (ENMD 1005), which is not a partial agonist for PAR2, blocked the action of SLIGRL-NH2 in a human embryonic kidney cell and MDCK cell calcium signaling assay (data not shown); however, unlike trans-cinnamoyl-LIGRLO-NH2, it did not affect the contractile action of SLIGRL-NH2 in the coronary preparation (not shown). Thus, in the coronary artery tissue, the peptide trans-cinnamoyl-LIGRLO-NH2 proved to be an agonist for endothelium-mediated relaxation but an antagonist for the contractile response generated at resting tension by SLIGRL-NH2. In contrast, SLIGRL-NH2 was an agonist for both the relaxant and contractile responses. Furthermore, neither the PAR2-inactive peptide LSIGRL-NH2 nor the PAR2-targeted peptide antagonist LIGK-NH2 (ENMD 1005) was an agonist or an antagonist in the tissue.

Contractile Response Is Endothelium Independent, Enhanced by Indomethacin, and Not Dependent on Src Kinase Activity

Response to PAR2-AP. To evaluate the endothelium dependence of the contractile response, anterior descending coronary rings were denuded or not of the endothelium, as verified by the disappearance of a relaxant response to substance P, and tested for their contractile response to SLIGRL-NH2 in the absence or presence of indomethacin (Fig. 4). The contractile response was the same in either the presence or absence of the endothelium, and indomethacin potentiated the contractile response in the anterior descending preparation either with or without a functional endothelium (Fig. 4). The enhanced contraction in the presence of indomethacin was observed in the two coronary preparations (anterior descending and circumflex) but not in the other arterial tissues studied (femoral, renal, and carotid; not shown). Because the presence or absence of the endothelium did not affect the contractile response, it was possible to use preparations either with or without an intact endothelium to assess the structure-activity profiles for the contractile responses.

Possible role of Src kinase. In view of work with G-protein-coupled agonist responses in porcine coronary and other vascular tissues wherein a contractile role for a tyrosine kinase-driven pathway has been identified (18, 34, 35), we assessed the potential contribution of Src kinase by using the Src-selective kinase inhibitor PP1. This inhibitor did not affect the contractile action of SLIGRL-NH2 (not shown), making it unlikely that Src plays a role in this response.

Possible Action of PAR2-APs Via Neurokinin Receptors in Canine Coronary Tissue

During the course of our study, data were published suggesting that PAR2-related peptides, such as SLIGRL-NH2, can stimulate murine epithelial chloride secretion by activating the NK1 receptor (1). In the coronary tissue assay, as shown in Fig. 1, substance P presumably acting via the canine NK1 receptor caused a relaxant and not a contractile response. In such preparations preconstricted by PGF2{alpha}, exposure of the tissue to relatively high concentrations of SLIGRL-NH2 (e.g., 50–100 µM) caused a further increase in tension, whereas the subsequent addition of substance P caused a prompt relaxation toward baseline (not shown). These data demonstrating diametrically opposed effects [on the one hand of relatively high concentrations of SLIGRL-NH2 that caused contraction (50–100 µM), and on the other hand of low concentrations of substance P (0.01–1 µM) that caused a relaxant response under the same conditions] indicated that the NK1 receptor was not responsible for the contractile actions of SLIGRL-NH2. In accordance with this conclusion, the contractile action of SLIGRL-NH2 was not affected by antagonists of the NK1, NK2, or the bradykinin B1/B2 receptors (not shown).

Response to PAR1-AP

Although our main focus was on PAR2-APs, we also explored briefly the response of the coronary and other vascular preparations to the PAR1-AP TFLLR-NH2. In contrast to the relaxant action of the PAR2-AP in an endothelium-intact preparation, the PAR1-AP TFLLR-NH2, even at relatively low concentrations (0.5 µM), caused contractile responses in the coronary preparation at baseline tension (data not shown) and an enhanced contractile response over and above the contraction caused by PGF2{alpha} (Fig. 1C). Comparable responses were observed in preparations either with or without an intact endothelium (not shown). At baseline tension, the PAR1-selective receptor AP (TFLLR-NH2) caused a concentration-dependent contractile response in all arterial preparations that we examined (descending and anterior coronary, carotid, renal and femoral) (not shown). This contractile action of the PAR1-AP was the same in the absence or presence of 100 µM trans-cinnamoyl-LIGRLO-NH2. Like the contraction caused by SLIGRL-NH2, the contraction induced by TFLLR-NH2 was potentiated by indomethacin in the anterior descending coronary artery preparation (not shown). Also, like the SLIGRL-NH2-triggered contractile response, the response of the carotid artery preparation to TFLLR-NH2 was minimal.

Calcium Signaling in Cultured MDCK Cells by PAR2-APs and Amino Acid Sequence of MDCK PAR2

Structure-activity profile for PAR2-APs acting on canine PAR2 in the calcium signaling assay. As outlined above, the endothelium-intact coronary preparation was not suitable for evaluating the canine SAR profile for the PAR2-APs. To assess the SAR profile for these peptides to activate PAR2, we therefore turned to a cultured MDCK cell calcium signaling assay. Although PAR2 activation can stimulate a number of signal pathways in the MDCK cells (e.g., MAPK activation), the increase in intracellular calcium has proved to be a robust response suitable for studying the structure-activity profiles of PAR-APs in this and other cell types (14). Our previous experience with isolated artery-derived smooth muscle cells indicated that they are not suitable for SAR studies because they do not release without enzymatic dissociation from the culture dish and do not readily permit studies of PAR activation in cell suspensions. In contrast, we found that cultured MDCK cells were ideal for our calcium signaling assay, thereby enabling a stringent evaluation of the structure-activity profile of the PAR2-APs for the canine receptor. In the MDCK cells, activation of PAR2 with SLIGRL-NH2 and the other PAR2-APs yielded a robust increase in intracellular calcium (Fig. 5). In contrast, in MDCK cells in which PAR2 was first completely desensitized by repeated exposure to SLIGRL-NH2 so as to optimize visualizing the PAR1 response, only a small signal was observed for TFLLR-NH2 (Fig. 5, bottom right) at concentrations of 100 µM. This concentration is well above concentrations known to activate PAR1 maximally. Little or no calcium signal was observed at or below 50 µM of TFLLR-NH2 (not shown), although these concentrations might have triggered other responses in the cells, such as the activation of MAPK. No calcium signal to the PAR4-AP AYPGKF-NH2 was observed (up to 300 µM; not shown). Therefore, we were confident that the principal calcium signals observed in the MDCK assay in response to the PAR2-APs at concentrations below 50 µM did not come from PARs other than PAR2 and that the SARs derived from the calcium signaling measurements reflected accurately the activation of canine PAR2. Concentration-effect curves for calcium signaling in the MDCK cells (Fig. 6) showed that the relative potencies of the PAR2-APs in this assay were as follows: 2-furoyl-LIGRLO-NH2 >> SLIGRL-NH2 = trans-cinnamoyl-LIGRLO-NH2 >> SLIGKT-NH2, with EC50 values estimated from the concentration-response curves of ~0.08, 0.8, and 10 µM, respectively. We obtained the identical SAR for these peptides with a Kirsten virus-transformed rat kidney cell system expressing recombinant rat PAR2 (Ref. 3 and data not shown). Unfortunately, attempts to clone and express the full-length canine PAR2 construct to conduct similar experiments with expressed canine PAR2 were not successful. Maximally, all of the PAR2-APs stimulated an elevation of intracellular calcium in the MDCK cells that was ~50% of the signal caused in the same cells by 2 µM A-23187. This result, demonstrating the same maximal effect of all peptides, suggested that they were all "full agonists" in the MDCK PAR2 calcium assay. Furthermore, the potency order of the PAR2-APs observed in the MDCK cells was not only the same for rat PAR2 expressed in KNRK cells (above) but also for human PAR2 expressed constitutively in cultured human embryonic kidney cells (data not shown and Ref. 14).

Cloning and sequencing of canine PAR2. Given the presence of functional PAR2 in the MDCK cells, we used them as a source of mRNA for RT-PCR-based sequencing of the canine receptor. This approach was a necessary prelude to assessing the content of PAR2 mRNA in the coronary tissue. As shown in Table 1, our data defined the tethered ligand sequence of MDCK PAR2 (SLIGKT) that would be revealed by tryptic cleavage. That sequence was therefore used to probe the responsiveness of the canine tissue and the MDCK calcium assay (above). The cloning also established sequences for key portions of the canine receptor involved in signaling by either the tethered ligand or peptide agonists (extracellular loop 2 and intracellular loops 1, 2, and 3). The sequences that we determined matched exactly those deposited in the National Center for Biotechnology Information database (XM 546057) subsequent to the completion of this part of our study. As summarized in Table 1, these sequences are very similar to the comparable sequences in human PAR2, particularly in the region of the cleavage-activation site (5) and are close to the same sequences that we determined in the past for rat PAR2 (30).


View this table:
[in this window]
[in a new window]

  		Table 1. Deduced amino acid sequences of canine PAR2 compared with human and rat PAR2

 
RT-PCR Detection of PAR1 and PAR2 mRNA in the Coronary and Other Canine Tissues

Given the responsiveness of the coronary preparation to the PAR-APs, it was of interest to establish the presence of PAR mRNA in the tissue. Analysis of the mRNAs for PAR1 and PAR2 detected by RT-PCR in the heart (coronary artery and ventricle), lung, and intestinal tissues is shown in Fig. 7, relative to the RT-PCR signal for β-actin mRNA. The identity of the visualized RT-PCR products, which were of the expected size for the PARs, was confirmed by nucleotide sequencing. Although semi-quantitative, the data suggest that, relative to β-actin mRNA, there was an equivalent abundance of mRNA for PAR1 and PAR2 in the coronary, ventricular, intestinal, and lung tissue (Fig. 7). Unequivocally, mRNAs for both PAR1 and PAR2 were present in the coronary tissues used for the bioassay procedures.


   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
A main focus of our study was to determine the pharmacology of the coronary artery receptor(s) responsible for the contractile actions of the PAR2-APs. An evaluation of the structure-activity profile of these receptor APs for their effects is of general importance, since the biological responses to the PAR2-APs can be used (possibly uncritically) as evidence for a role for PAR2 itself. Our group's previous work with PAR4-APs (10) and with PAR2-APs (21) has demonstrated the caution with which such response data must be interpreted. Our principal finding with the canine coronary tissue was that the receptor conferring a contractile response appears distinct from PAR2 that we detect either in the coronary endothelium or in MDCK cells based on two principal observations. First, the peptide trans-cinnamoyl-LIGRLO-NH2 was an agonist in the relaxation and MDCK calcium signaling assays but an antagonist for SLIGRL-NH2 in the contractile assay. The antagonist activity was selective for the action of SLIGRL-NH2, since contractions caused by TFLLR-NH2 were not affected. Second, the relative order of potencies for the peptides in the coronary contractile assay (SLIGRL-NH2 >> 2-furoyl-LIGRLO-NH2 >> SLIGKT-NH2, with trans-cinnamoyl-LIGRLO-NH2 an inactive antagonist) differed substantially from the relative order of potencies of these same peptides in the MDCK calcium assay, which we believe best reflects the pharmacology of canine PAR2 (2-furoyl-LIGRLO-NH2 >> SLIGRL-NH2 = trans-cinnamoyl-LIGRLO-NH2 >> SLIGKT-NH2). This order of agonist peptide potencies observed in the MDCK cells is the same as the one that has been previously observed for PAR2 in a variety of intact tissues and cultured cells coming from several species, including the mouse, human, and rat (11, 23). In the MDCK calcium signaling assay, trans-cinnamoyl-LIGRLO-NH2 appeared to be a full agonist, and, in the endothelium-intact coronary preparation, the action of this peptide paralleled that of SLIGRL-NH2 as shown with endothelium-intact rat vascular tissue (4, 11). This relaxation response to SLIGRL-NH2 and trans-cinnamoyl-LIGRLO-NH2 is in keeping with the presence of PAR2 mRNA in the coronary tissue, although the relative amount of PAR2 mRNA in the endothelium vs. the smooth muscle elements was not determined. Unfortunately, it was not possible to obtain reliable concentration-effect curves for the relaxant actions of the PAR2-APs to establish further, pharmacologically, the presence of functional PAR2 in the intact coronary tissue.

In addition to differing from a potency order expected of PAR2, the order of PAR2-AP potencies in the contractile assay also differed substantially from the one thought to reflect activation of the NK1 receptor by PAR2-related peptides in murine tracheal preparations (1). Moreover, the distinct actions of substance P (relaxant at all concentrations tested) and SLIGRL-NH2 (contractile at high concentrations) ruled out an action of the PAR2-derived peptides at the canine NK1 receptor. This result was complemented by the lack of effect of either the NK1 or the bradykinin B1/B2 receptor antagonists on the contractile action of SLIGRL-NH2.

What mechanism might account for the very distinct PAR2 SAR pharmacology for the receptor responsible for the contractile response in the coronary preparation, compared with the "classical" peptide SAR pharmacology of the PAR2-AP-mediated calcium response in the MDCK cells? Given the very close sequence homology between canine, human, and rat PAR2 (Table 1), it is unlikely that the distinct pharmacology for the PAR2-APs to cause contraction can be attributed to differences in the PAR2 receptor sequences (canine vs. human or other). If anything, the canine receptor is closest to the human one, with a glycosylation site present just before the cleavage/activation site, a lysine at position 5 of the tethered receptor-activating ligand, and close homology in the predicted extracellular and intracellular loop sequences thought to confer responsiveness either to the tethered ligand or to the peptide agonists.

One possibility is that the different potency order observed in the coronary ring contraction assay, compared with the MDCK calcium signaling assay, might result from a novel receptor with extracellular loops in common with PAR2, although extensive differences elsewhere. Although PARs other than PAR1, PAR2, PAR3, and PAR4 are not to be found in the human or canine genome, it is feasible that an as-yet unknown but PAR-related receptor is present in the canine genome to account for the "contractile" receptor system in the coronary. Although unlikely, given the lack of introns within the PAR gene portion coding for the tethered ligand and signaling portion of the receptors, the data might also be explained by a PAR splice variant. In this regard, the lack of dependence of the contractile response on either a prostanoid (resistance to and potentiation by indomethacin) or a Src kinase signal pathway (resistance to PP1) would distinguish signaling by this unknown receptor from signaling by the PARs in smooth muscle tissue, which has been found to be blocked by inhibitors of either tyrosine kinases or cyclooxygenase (18, 37, 38).

Apart from a PAR family-related receptor (splice variant or other distinct but related sequence), our data rule out the NK1 and bradykinin B1/B2 receptors as targets for the PAR2-derived peptides. Our results therefore contrast with the situation described for the murine epithelial NK1 receptor, which appears to be triggered by PAR2-related peptides to activate chloride transport (1). Another possibility is that the coronary contractile response may be due to the activation PAR2 heterodimers, akin to those now known to exist for PAR1 and PAR4 in human platelets and to exist for many G-protein-coupled receptors (19). Should such heterodimers exist, involving PAR2 and one or more of PAR1, PAR3, and PAR4, the overall pharmacology of heterodimer activation could well differ from that observed in a homodimer situation that may exist in cells like MDCK, wherein a PAR1 response (and presumably PAR1 itself) is minimal (Fig. 5, bottom right) and PAR4 appears to be absent. Heterodimer formation involving PAR1 and PAR4 might also provide a rationale for the distinct endothelial receptors for thrombin detected on canine venous vs. arterial ring preparations (32). The presence of a novel PAR2-AP-responsive receptor that could in principle form PAR dimers may be of clinical importance in the setting of ischemia-reperfusion, wherein PAR2 has been found to be upregulated so as to contribute to a reduction in myocardial injury (25). Although we have yet to obtain evidence for or against the formation of PAR2 dimers, this hypothesis merits further exploration in the context of a receptor expression system, possibly using the MDCK cell background. In such a study, it will be important to look for SARs such as the one that we have observed here for the canine coronary tissue.

In summary, our structure-activity data point to a novel contractile receptor system for the PAR2-APs in the canine coronary preparation. Irrespective of the mechanism that may account for this unusual receptor system and its unprecedented SAR relationships for the PAR2-APs, the results do bear on the development of PAR2-targeted therapeutic agents in the future. Such PAR2 agonists and antagonists are likely to prove of value in the setting of inflammatory and neurodegenerative disease (16, 27). Thus, for PAR2-related drug development, in addition to the use of cell-based assays, it will be of importance to employ vascular tissue assays, especially those derived from human sources, to assess fully the pharmacology of potential therapeutic candidates.


   GRANTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
This work was supported in large part by a Servier International Alliance Project grant dealing with proteinases, proteinase-activated receptors, and the regulation of vascular targets, in conjunction with a Canadian Institutes of Health (CIHR) Operating grant to M. D. Hollenberg dealing with vascular PARs. Partial financial support was also provided by a CIHR proteinases and inflammation group grant and a CIHR operating grant to W. K. MacNaughton. M. L. Seymour was supported by a postdoctoral fellowship from the Canadian Association of Gastroenterology; S. Houle was supported by a Neuroscience Canada postdoctoral fellowship sponsored jointly by the Alberta Heritage Foundation for Medical Research and the CIHR.


   FOOTNOTES
 

Address for reprint requests and other correspondence: M. D. Hollenberg, Dept. of Pharmacology & Therapeutics, Univ. of Calgary Faculty of Medicine, 3330 Hospital Drive N.W., Calgary, AB, Canada T2N 4N1 (e-mail: mhollenb{at}ucalgary.ca)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Abey HT, Fairlie DP, Moffatt JD, Balzary RW, Cocks TM. Protease-activated receptor-2 peptides activate neurokinin-1 receptors in the mouse isolated trachea. J Pharmacol Exp Ther 317: 598–605, 2006.[Abstract/Free Full Text]
  2. Ahlquist RP. A study of the adrenotropic receptors. Am J Physiol 153: 586–600, 1948.[Free Full Text]
  3. Al-Ani B, Hollenberg MD. Selective tryptic cleavage at the tethered ligand site of the amino terminal domain of proteinase-activated receptor-2 in intact cells. J Pharmacol Exp Ther 304: 1120–1128, 2003.[Abstract/Free Full Text]
  4. Al-Ani B, Saifeddine M, Hollenberg MD. Detection of functional receptors for the proteinase-activated-receptor-2-activating polypeptide, SLIGRL-NH2, in rat vascular and gastric smooth muscle. Can J Physiol Pharmacol 73: 1203–1207, 1995.[Web of Science][Medline]
  5. Bohm SK, Kong W, Bromme D, Smeekens SP, Anderson DC, Connolly A, Kahn M, Nelken NA, Coughlin SR, Payan DG, Bunnett NW. Molecular cloning, expression and potential functions of the human proteinase-activated receptor-2. Biochem J 314: 1009–1016, 1996.[Web of Science][Medline]
  6. Coughlin SR. Protease-activated receptors in hemostasis, thrombosis and vascular biology. J Thromb Haemost 3: 1800–1814, 2005.[CrossRef][Web of Science][Medline]
  7. Damiano BP, Cheung WM, Mitchell JA, Falotico R. Cardiovascular actions of thrombin receptor activation in vivo. J Pharmacol Exp Ther 279: 1365–1378, 1996.[Abstract/Free Full Text]
  8. De Mey JG, Claeys M, Vanhoutte PM. Endothelium-dependent inhibitory effects of acetylcholine, adenosine triphosphate, thrombin and arachidonic acid in the canine femoral artery. J Pharmacol Exp Ther 222: 166–173, 1982.[Abstract/Free Full Text]
  9. Hollander EH, Dobson GM, Wang JJ, Parker KH, Tyberg JV. Direct and series transmission of left atrial pressure perturbations to the pulmonary artery: a study using wave-intensity analysis. Am J Physiol Heart Circ Physiol 286: H267–H275, 2004.[Abstract/Free Full Text]
  10. Hollenberg MD, Saifeddine M, Sandhu S, Houle S, Vergnolle N. Proteinase-activated receptor-4: evaluation of tethered ligand-derived peptides as probes of receptor function and as inflammatory agonists in vivo. Br J Pharmacol 143: 443–454, 2004.[CrossRef][Web of Science][Medline]
  11. Hollenberg MD, Compton SJ. International Union of Pharmacology XXVIII. Proteinase-activated receptors. Pharmacol Rev 54: 203–217, 2002.[Abstract/Free Full Text]
  12. Hollenberg MD, Saifeddine M, al-Ani B, Kawabata A. Proteinase-activated receptors: structural requirements for activity, receptor cross-reactivity, and receptor selectivity of receptor-activating peptides. Can J Physiol Pharmacol 75: 832–841, 1997.[CrossRef][Web of Science][Medline]
  13. Kao JP, Harootunian AT, Tsien RY. Photochemically generated cytosolic calcium pulses and their detection by fluo-3. J Biol Chem 264: 8179–8184, 1989.[Abstract/Free Full Text]
  14. Kawabata A, Saifeddine M, Al-Ani B, Leblond L, Hollenberg MD. Evaluation of proteinase-activated receptor-1 (PAR1) agonists and antagonists using a cultured cell receptor desensitization assay: activation of PAR2 by PAR1-targeted ligands. J Pharmacol Exp Ther 288: 358–370, 1999.[Abstract/Free Full Text]
  15. Kawabata A, Kanke T, Yonezawa D, Ishiki T, Saka M, Kabeya M, Sekiguchi F, Kubo S, Kuroda R, Iwaki M, Katsura K, Plevin R. Potent and metabolically stable agonists for protease-activated receptor-2: evaluation of activity in multiple assay systems in vitro and in vivo. J Pharmacol Exp Ther 309: 1098–1107, 2004.[Abstract/Free Full Text]
  16. Kelso EB, Lockhart JC, Hembrough T, Dunning L, Plevin R, Hollenberg MD, Sommerhoff CP, McLean JS, Ferrell WR. Therapeutic promise of proteinase-activated receptor-2 antagonism in joint inflammation. J Pharmacol Exp Ther 316: 1017–1024, 2006.[Abstract/Free Full Text]
  17. Laniyonu AA, Saifeddine M, Yang SG, Hollenberg MD. Tyrosine kinase inhibitors and the contractile action of G-protein-linked vascular agonists. Can J Physiol Pharmacol 72: 1075–1085, 1994.[Web of Science][Medline]
  18. Laniyonu AA, Hollenberg MD. Vascular actions of thrombin receptor-derived polypeptides: structure-activity profiles for contractile and relaxant effects in rat aorta. Br J Pharmacol 114: 1680–1686, 1995.[Web of Science][Medline]
  19. Leger AJ, Jacques SL, Badar J, Kaneider NC, Derian CK, Andrade-Gordon P, Covic L, Kuliopulos A. Blocking the protease-activated receptor 1–4 heterodimer in platelet-mediated thrombosis. Circulation 113: 1244–1254, 2006.[Abstract/Free Full Text]
  20. Macfarlane SR, Seatter MJ, Kanke T, Hunter GD, Plevin R. Proteinase-activated receptors. Pharmacol Rev 53: 245–282, 2001.[Abstract/Free Full Text]
  21. McGuire JJ, Dai J, Andrade-Gordon P, Triggle CR, Hollenberg MD. Proteinase-activated receptor-2 (PAR2): vascular effects of a PAR2-derived activating peptide via a receptor different than PAR2. J Pharmacol Exp Ther 303: 985–992, 2002.[Abstract/Free Full Text]
  22. McGuire JJ, Hollenberg MD, Andrade-Gordon P, Triggle CR. Multiple mechanisms of vascular smooth muscle relaxation by the activation of proteinase-activated receptor 2 in mouse mesenteric arterioles. Br J Pharmacol 135: 155–169, 2002.[CrossRef][Web of Science][Medline]
  23. McGuire JJ, Saifeddine M, Triggle CR, Sun K, Hollenberg MD. 2-furoyl-LIGRLO-amide: a potent and selective proteinase-activated receptor 2 agonist. J Pharmacol Exp Ther 309: 1124–1131, 2004.[Abstract/Free Full Text]
  24. Minta A, Kao JP, Tsien RY. Fluorescent indicators for cytosolic calcium based on rhodamine and fluorescein chromophores. J Biol Chem 264: 8171–8178, 1989.[Abstract/Free Full Text]
  25. Napoli C, De Nigris F, Cicala C, Wallace JL, Caliendo G, Condorelli M, Santagada V, Cirino G. Protease-activated receptor-2 activation improves efficiency of experimental ischemic preconditioning. Am J Physiol Heart Circ Physiol 282: H2004–H2010, 2002.[Abstract/Free Full Text]
  26. Nguyen TD, Moody MW, Steinhoff M, Okolo C, Koh DS, Bunnett NW. Trypsin activates pancreatic duct epithelial cell ion channels through proteinase-activated receptor-2. J Clin Invest 103: 261–269, 1999.[Web of Science][Medline]
  27. Noorbakhsh F, Tsutsui S, Vergnolle N, Boven LA, Shariat N, Vodjgani M, Warren KG, Andrade-Gordon P, Hollenberg MD, Power C. Proteinase-activated receptor 2 modulates neuroinflammation in experimental autoimmune encephalomyelitis and multiple sclerosis. J Exp Med 203: 425–435, 2006.[Abstract/Free Full Text]
  28. Ossovskaya VS, Bunnett NW. Protease-activated receptors: contribution to physiology and disease. Physiol Rev 84: 579–621, 2004.[Abstract/Free Full Text]
  29. Petersen LC, Thastrup O, Hagel G, Sorensen BB, Freskgard PO, Rao LV, Ezban M. Exclusion of known protease-activated receptors in factor VIIa-induced signal transduction. Thromb Haemost 83: 571–576, 2000.[Web of Science][Medline]
  30. Saifeddine M, al-Ani B, Cheng CH, Wang L, Hollenberg MD. Rat proteinase-activated receptor-2 (PAR-2): cDNA sequence and activity of receptor-derived peptides in gastric and vascular tissue. Br J Pharmacol 118: 521–530, 1996.[Web of Science][Medline]
  31. Saifeddine M, Roy SS, Al-Ani B, Triggle CR, Hollenberg MD. Endothelium-dependent contractile actions of proteinase-activated receptor-2-activating peptides in human umbilical vein: release of a contracting factor via a novel receptor. Br J Pharmacol 125: 1445–1454, 1998.[CrossRef][Web of Science][Medline]
  32. Simonet S, Bonhomme E, Laubie M, Thurieau C, Fauchere JL, Verbeuren TJ. Venous and arterial endothelial cells respond differently to thrombin and its endogenous receptor agonist. Eur J Pharmacol 216: 135–137, 1992.[CrossRef][Web of Science][Medline]
  33. Steinhoff M, Buddenkotte J, Shpacovitch V, Rattenholl A, Moormann C, Vergnolle N, Luger TA, Hollenberg MD. Proteinase-activated receptors: transducers of proteinase-mediated signaling in inflammation and immune response. Endocr Rev 26: 1–43, 2005.[Abstract/Free Full Text]
  34. Thakali K, Davenport L, Fink GD, Watts SW. Cyclooxygenase, p38 mapk, ERK MAPK, Rho kinase and SRC mediate hydrogen peroxide-induced contraction of rat thoracic aorta and vena cava. J Pharmacol Exp Ther 320: 236–243, 2007.[Abstract/Free Full Text]
  35. Watts SW, Yeum CH, Campbell G, Webb RC. Serotonin stimulates protein tyrosyl phosphorylation and vascular contraction via tyrosine kinase. J Vasc Res 33: 288–298, 1996.[CrossRef][Web of Science][Medline]
  36. White RP, Shirasawa Y, Robertson JT. Comparison of responses elicited by alpha-thrombin in isolated canine basilar, coronary, mesenteric, and renal arteries. Blood Vessels 21: 12–22, 1984.[Web of Science][Medline]
  37. Yang SG, Saifeddine M, Laniyonu A, Hollenberg MD. Distinct signal transduction pathways for angiotensin-II in guinea pig gastric smooth muscle: differential blockade by indomethacin and tyrosine kinase inhibitors. J Pharmacol Exp Ther 264: 958–966, 1993.[Abstract/Free Full Text]
  38. Zheng XL, Renaux B, Hollenberg MD. Parallel contractile signal transduction pathways activated by receptors for thrombin and epidermal growth factor-urogastrone in guinea pig gastric smooth muscle: blockade by inhibitors of mitogen-activated protein kinase-kinase and phosphatidyl inositol 3'-kinase. J Pharmacol Exp Ther 285: 325–334, 1998.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/6/H3279    most recent
00519.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Saifeddine, M.
Right arrow Articles by Hollenberg, M. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Saifeddine, M.
Right arrow Articles by Hollenberg, M. D.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.