Am J Physiol Heart Circ Physiol 294: H810-H820, 2008.
First published November 30, 2007; doi:10.1152/ajpheart.00724.2007
0363-6135/08 $8.00
Deficiency of M2 muscarinic acetylcholine receptors increases susceptibility of ventricular function to chronic adrenergic stress
Carly LaCroix,1
Jessica Freeling,1
Alese Giles,1
Jürgen Wess,2 and
Yi-Fan Li1
1Division of Basic Biomedical Sciences, Sanford School of Medicine, University of South Dakota, Vermillion, South Dakota; and 2Molecular Signaling Section, Laboratory of Bioorganic Chemistry, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, Maryland
Submitted 21 June 2007
; accepted in final form 29 November 2007
 |
ABSTRACT
|
|---|
Suppressed parasympathetic nervous system (PSNS) function has been found in a variety of cardiovascular diseases, such as hypertension, heart failure, and diabetes. However, whether impaired PSNS function plays a significant role in ventricular dysfunction remains to be investigated. Cardiac regulation by the PSNS is primarily mediated by the M2 muscarinic acetylcholine receptor (M2-AChR). In this study, we tested the hypothesis that lack of M2-AChR-mediated PSNS function may adversely impact cardiac ventricular function. Using M2-AChR knockout (KO) and wild-type (WT) mice, we found that the basal levels of heart rate and left ventricular function were similar in M2-AChR KO and WT mice. A bolus injection of isoproterenol (Iso) induced a greater increase in heart rate in M2-AChR KO mice than in WT mice. However, the responses of change in pressure over time (dP/dt) to Iso were similar in the two groups. After chronic infusion with Iso for 1 wk, the baseline values of left ventricular function were increased to similar extents in M2-AChR KO and WT mice. However, the M2-AChR KO mice exhibited impaired ventricular function, indicated as attenuated dP/dt and increased end-diastolic pressure, during an increase in cardiac afterload induced by a bolus injection of phenylephrine. Furthermore, chronic Iso infusion significantly increased matrix metalloproteinase (MMP) activity in the heart in M2-AChR KO mice. In primary culture of mixed neonatal rat cardiac fibroblast and cardiomyocytes, cotreatment with muscarinic agonist bethanechol reversed phenylephrine-induced increase in MMP-9 activation. These data suggest that M2-AChR may mediate an inhibitory regulation on MMP function. The overall results from this study suggest that M2-AChR-mediated PSNS function may provide cardiac protection. Lack of this protective mechanism will increase the susceptibility of the heart to cardiac stresses.
muscarinic; cardiac; contractility; matrix metalloproteinase; isoproterenol
CARDIAC FUNCTION IS REGULATED by the two major branches of the autonomic nervous system: the sympathetic (SNS) and the parasympathetic nervous systems (PSNS). The balanced interaction between SNS and PSNS maintains normal cardiac function and hemodynamic homeostasis. Imbalanced SNS and PSNS activities are one of the common hallmarks in a variety of cardiovascular diseases, including hypertension (29, 35), congestive heart failure (CHF) (12, 31), and diabetes (16). A substantial body of evidence indicates that sustained and excessive sympathoexcitation is associated with cardiac hypertrophy (47), fibrosis (3), and cardiomyocyte death (13) during the progression of CHF. It has also been found that suppressed PSNS function commonly exists in a variety of cardiovascular diseases, including CHF (24), hypertension (15, 35), obesity (7), and diabetes (16). However, in contrast to the extensive studies on the SNS in cardiac dysfunction, the role of PSNS function in cardiac pathophysiology has received much less attention. Clinical studies have indicated that impaired PSNS function is related to poor outcome and high mortality of patients with CHF (33). Conversely, augmentation of PSNS activity by pharmacological regimens (34, 43) or stimulation of the vagus (36, 61) improved cardiac function and decreased mortality in CHF, suggesting a beneficial effect of the PSNS in CHF. However, the mechanisms of the impact of impaired PSNS function on cardiac function and PSNS cardioprotection remain to be addressed.
It is well known that activation of the PSNS decreases heart rate (negative chronotropic effect) and cardiac conductivity (negative dromotropic effect). Therefore, suppressed PSNS function in cardiovascular diseases was believed to lead to tachycardia and arrhythmia, thus contributing to mortality in these cardiovascular diseases. Recently, studies indicate that PSNS action also affects ventricular function through indirect (by counteracting β-adrenergic action) (27, 28) or direct (by inhibiting L-type calcium channel) (41) mechanisms. However, whether this PSNS effect on ventricular function plays a significant role in physiological and pathophysiological states remains unclear.
PSNS control of the heart is primarily mediated by the M2 muscarinic acetylcholine receptor (M2-AChR) (9, 18). M2-AChR belongs to the superfamily of G protein-coupled receptors. Upon stimulation, M2-AChR activates heterotrimeric G proteins of the Gi/o family. G
i/o elicits an inhibitory effect on adenylyl cyclase, thus counteracting cAMP-PKA-dependent signaling pathways (58). G
i/o also directly increases potassium channel activity, resulting in hyperpolarization of sinoatrial node and atrioventricular node (51). Additionally, G protein β
subunits can directly activate the muscarinic-gated potassium channel (38) and play a role for parasympathetic heart rate control (23). Recent studies also indicate that PSNS activity, via stimulation of M2-AChR, can inhibit L-type calcium channel and, consequently, reduce contractility of ventricular myocytes (41, 52). The lack of specific M2-AChR agonists and antagonists has been an obstacle for detailed investigations of the physiological role of the M2-AChR signal in ventricular physiology and pathophysiology. Recently, mutant mice deficient in the M2-AChR gene [M2-AChR knockout (KO) mice] (26, 57) have emerged as a powerful new tool for the study of cardiac function. In this study, we used M2-AChR KO mice to test the effect of a lack of M2-AChR on ventricular function. We hypothesize that lack of M2-AChR-mediated PSNS action may elicit adverse effects on cardiac ventricular function.
 |
METHODS
|
|---|
Animals.
Homozygous M2-AChR KO mice (M2–/–, genetic background: 129J1 x CF1) were generated as described previously (26, 57). Male mice aged 2–3 mo were used in this study. Age-matched male wild-type (WT) mice of the same genetic background were used as controls. Mice were maintained on commercially available normal mouse chow (Harlan) and tap water in an environment with a 12:12-h light-dark cycle and ambient temperature (22°C). All experimental procedures in the present study were approved by Institutional Animal Care and Use Committee of the University of South Dakota, and all of the procedures were in accordance with the Guide for the Care and Use of Laboratory Animals [National Institutes of Health (NIH)].
Measurement of left ventricular function.
The mice were anesthetized with inactin (100–150 mg/kg) plus a low rate of isoflurane inhalation (1%). The trachea was intubated and connected to a rodent ventilator (Harvard) to maintain constant breathing. The left ventricle was catheterized with Millar pressure-volume (P-V) catheter (Millar, Houston, TX) through the right common carotid artery. In addition, the left common jugular vein was isolated and cannulated to facilitate intravenous injections of test substances. The animals were allowed recovery from the surgery for 20 min. Then left ventricular function [heart rate, left ventricular volume and pressure, and change in pressure over time (dP/dt)] was measured by the P-V catheter, and the data were recorded using the PowerLab data-acquisition system (ADIstruments). The major parameters of cardiac function were calculated and analyzed using Millar P-V software (PVAN, Millar). The left ventricular functions were recorded at rest (baseline) and in response to intravenous injection of the β-adrenergic agonist isoproterenol (Iso; 14–56 ng/kg) or the
-adrenergic agonist phenylephrine (PE; 56 µg/kg). The responses to the drugs were evaluated as peak change values from the baselines, i.e., change (
) in value = peak response – baseline.
Chronic administration of the β-adrenergic agonist Iso.
Under sterile conditions, an osmotic minipump (Alzet, Palo Alto, CA) was implanted subcutaneously in a mouse anesthetized by isoflurane inhalation. The osmotic pumps delivered chronic infusions of Iso (10 mg·kg–1·day–1) or saline for 1 wk. At the end of experiments, the minipumps were recovered, and the remaining drug volume was measured to validate success of the infusion.
Primary culture of neonatal cardiac cells.
One- to three-day-old neonatal Sprague-Dawley rat pups were decapitated, and left ventricular tissues were obtained. The tissues were chopped into small pieces and digested using trypsin and then collagenase, respectively. The mixed fibroblast cells and cardiomyocytes were cultured in six-well plates in Dulbecco's modification of Eagle's medium containing 10% fetal bovine serum (FBS) and penicillin (100 U/ml) and streptomycin (100 µg/ml) (Cambrex Bio Science, Walkersville, MD). Before the drug treatments, the media was changed to FBS-free Dulbecco's modification of Eagle's medium containing penicillin-streptomycin, and the cells were cultured for 24 h. The cells were then treated with PE (10 µM) in the presence or absence of the muscarinic cholinergic agonist bethanechol (Beth) (10 µM) for 24 h. After washes with PBS, the cells were collected using scrapers. Following centrifugation, the cell pellets were suspended into 50 µl RIPA buffer for protein extraction.
Gelatin zymography to measure matrix metalloproteinase activity.
For animal tissues, frozen left ventricles of the different groups were dissected and homogenized in RIPA buffer on ice. For cultured cells, the collected cell pellets were suspended into 50 µl RIPA buffer and homogenized on ice. After centrifugation, the protein concentration of the extract was determined using the bicinchoninic acid assay kit (Pierce). Gelatin zymography was carried out, as described in literature (25) with some minor changes. Briefly, 10% polyacrylamide SDS gels containing 1% gelatin were prepared and allowed to polymerize overnight at 4°C. Equal amounts of protein were loaded on the gels. After being run at 80 mA for 1–1.5 h, the gels were washed in 2.5% Triton X-100 wash solution twice, 30 min each time, to remove SDS to allow renaturation of proteins. Gels were then incubated in a solution containing 10 mM (1.47 g/l) CaCl2, 50 mM (6.057 g/l) Tris-acetic acid, pH 7.5, plus 10 µl 10 mM ZnCl overnight (18–20 h) at 37°C. Gels were then stained for 1 h in a solution containing 0.2% Coomassie brilliant blue R-250, 10% acetic acid, 30% methanol, followed by a destaining twice, for 1.5 h each, in 10% acetic acid, 10% methanol solution. Matrix metalloproteinase (MMP) activity was evident as clear, unstained bands within the gel. Gels were scanned, and the intensities (gray values) of the bands were quantified using NIH Image J software.
Western blots.
Protein samples of heart tissues were subjected to standard Western blot procedures, as described previously (37). The primary antibodies against extracellular-regulated kinase (ERK) 1/2 and phosphorylated ERK1/2 (Cell Signaling) were diluted in Aquablock buffer (EastCoast Bio, 1:500). Fluorescence-conjugated secondary antibodies (Invitrogen) were used, and the fluorescent signals were scanned and quantified using a LI-COR imaging system. The ratio of phosphorylated ERK1/2 vs. total ERK1/2 was used as an index of ERK1/2 activation.
RT-PCR to assess tissue inhibitor of MMP-1 and -2 expression.
Total RNA was extracted from dissected left ventricular tissues or cultured cells using TRI Reagent (Molecular Research Center). The same amount of the total RNA from each sample was subjected to reverse transcription for 50 min at 37°C in the presence of 1.5 µM of random hexamers (Amersham) and 100 units of Moloney murine leukemia virus-RTase. PCR was conducted with 30 cycles of 95°C for 15 s, 60°C for 1 min. PCR primers for tissue inhibitors of MMP (TIMP) 1 and TIMP2 were as follows: TIMP1, forward primer, CATGGAAAGCCTCTGTGGATATG; reverse primer, AAGCTGCAGGCACTGATGTG; TIMP2, forward primer, CCAGAAGAAGAGCCTGAACC; reverse primer, GTCCATCCAGAGGCACTCATC. The PCR products were fractionated in a 1% agarose gel. The bands were visualized via UV light after 0.5 µg/ml ethidium bromide staining. The intensities (gray value) of the bands were quantified using NIH Image J software.
Statistical analysis.
All measured values in each group were expressed as means ± SE. Baseline values of cardiac parameters between M2-AChR KO and WT groups were compared using unpaired Student's test. Responses to the treatments were compared using two-factor ANOVA followed by Student-Newman Keuls test. Statistically significant differences were accepted when P < 0.05.
 |
RESULTS
|
|---|
Baseline cardiac function.
In untreated animals, there was no statistically significant difference in baselines of blood pressure and major parameters of ventricular function between M2-AChR KO and WT mice (Table 1). Nevertheless, maximum dP/dt and minimum dP/dt showed trends toward reduction in M2-AChR KO mice compared with WT mice. Surprisingly, basal heart rate was similar in M2-AChR KO and WT mice. A possible explanation for the absence of tachycardia in M2-AChR KO mice may be that tonic PSNS inhibition of the heart rate is low in mice, and, therefore, deletion of M2-AChR does not significantly affect baseline of heart rate.
Previous work has shown that muscarinic effects on heart rate were abolished in M2-AChR KO mice (21). To confirm these findings, we injected animals with the cholinergic muscarinic agonist Beth (0.15 mg/kg iv), or triggered the baroreflex by rapidly increasing blood pressure using a bolus injection of PE (56 µg/kg iv). As seen in Fig. 1, muscarinic stimulation and baroreflex stimulation induced bradycardic responses in WT mice. These responses were absent in M2-AChR KO mice, confirming that PSNS control of heart rate was abolished in M2-AChR KO mice.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 1. Representative recordings of parasympathetic nervous system (PSNS)-dependent negative chronotropic responses. A: PSNS component of the baroreflex. A bolus injection of phenylephrine (PE) induced a rapid increase in arterial blood pressure (aBP) that triggered a drop of heart rate (HR) in wild-type (WT) mice (left). This response was absent in M2 muscarinic acetylcholine receptor (M2-AChR) knockout (KO) mice (right). B: muscarinic agonist-induced bradycardia. A bolus injection of the muscarinic receptor agonist bethanechol (Beth; 0.15 mg/kg) induced a rapid decrease in HR in WT mice (left) but not in M2-AChR KO mice (right). This test was repeated in 3 M2-AChR and 3 WT mice. LVP, left ventricular pressure; dP/dt, change in pressure over time; bpm, beats/min.
|
|
Cardiac responses to Iso injection.
Acute stimulation of β-adrenergic receptors with Iso injection dose-dependently increased heart rate and ±dP/dt in both M2-AChR KO and WT mice. The heart rate response to Iso was significantly increased in M2-AChR KO mice compared with that in WT mice (Fig. 2B), indicating that the β-adrenergic receptor-mediated positive chronotropic effect was enhanced in the absence of cardiac PSNS activity. Surprisingly, however, Iso-induced increases in ±dP/dt in M2-AChR KO mice were not significantly greater compared with those in WT mice (Fig. 2, C and D).

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 2. Effects of the β-adrenergic agonist isoproterenol (Iso) on HR and dP/dt. A: representative recordings of the responses to Iso injection (56 ng/kg iv) in LVP (top), HR (middle), and dP/dt (bottom) in M2-AChR KO (left) and WT (right) mice. B: summary data for Iso dose-response in HR. C: summary data of dose-responses in maximum and minimum dP/dt (dP/dtmax and dP/dtmin, respectively). The change ( ) value = peak value – baseline value. Values are means ± SE; n = 6 for each group.
|
|
Effect of chronic infusion of Iso on cardiac function.
To test whether heart function becomes more susceptible to cardiac stress in the absence of PSNS activity, the M2-AChR KO and WT mice were given a chronic infusion of Iso (10 mg·kg–1·day–1) or saline for 1 wk. After the chronic Iso infusion, cardiac function was evaluated under anesthesia using a Millar P-V catheter. Basal levels of heart rate and +dP/dt were significantly increased in both M2-AChR KO and WT mice after the chronic Iso infusion compared with the saline controls. However, there was no significant difference between the M2-AChR KO and WT groups (Table 2). Other major hemodynamic parameters showed no significant difference among the various groups (Table 2). The Iso infusion caused increases in the ratio of heart weight vs. body weight in M2-AChR KO and WT mice to a similar extent (Fig. 3).

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 3. The ratio of heart weight (HW; mg) vs. body weight (BW; g). Values are means ± SE; n = 7 or 8. *P < 0.05 compared with the M2-AChR KO saline group. #P < 0.05 compared with the WT saline group. There was no significance between M2-AChR KO Iso and WT Iso groups.
|
|
We then tested the responses of ventricular function to an increase in afterload. The systolic blood pressure was transiently increased to 150–160 mmHg by a bolus injection of PE (56 µg/kg iv) in both M2-AChR KO and WT mice after the 1-wk chronic infusion with Iso or saline. As seen in Figs. 4 and 5, in response to the increased afterload, contractile function was increased in WT-Iso mice as well as in saline-infused mice, as indicated by the increased ±dP/dt. However, this response was significantly attenuated in M2-AChR KO mice with Iso infusion (Fig. 4, A and B, and Fig. 5, A and B). Furthermore, during increased afterload, the elevation of end-diastolic pressure was significantly greater in M2-AChR KO mice with Iso infusion than that in WT mice with Iso infusion (Fig. 5C). These results indicate that M2-AChR KO mice, despite normal baseline cardiac function, exhibit impaired cardiac function after chronic Iso infusion.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 4. Representative raw recordings of the responses in LVP, HR, and ±dP/dt to increased cardiac afterload. A: compressed recording tracings showing that ±dP/dt was increased in the WT mouse (left), but reduced in the M2-AChR KO mouse in response to a rapid increase in afterload induced by bolus injection of PE (56 µg/kg iv) (right). B: zoom-in view expanded recordings of the boxed areas in A, showing more details of alterations of dP/dt at time point of peaked afterload.
|
|
Alterations of MMP activity and TIMP expression in the heart and cultured cardiac cells.
The MMPs are responsible for the degradation and turnover of extracellular matrix (ECM) and affect cell-cell adhesion (4). Recent studies indicated that increased MMP activity was associated with impaired cardiac dysfunction in hypertension (1) and heart failure (39). In rats, chronic Iso infusion increased MMP activity that was responsible for cardiac hypertrophy (40). Therefore, we further determined the MMP activity in left ventricular tissues from infused mice using gelatin-zymography. The activities of both MMP-9 and MMP-2 were significantly increased in M2-AChR KO mice with Iso infusion, compared with WT mice with Iso infusion and WT and M2-AChR KO mice with saline infusion (Fig. 6).

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 6. Activity of matrix metalloproteinase (MMP) in left ventricular tissues. A: representative gelatin zymography image showing increased MMP-9 and MMP-2 activity in M2-AChR KO or WT mice with Iso vs. saline infusions. Mean data are shown of intensities (gray value) of MMP-9 (B) and MMP-2 (C) bands in zymography gels, as measured using NIH Image J. Values are means ± SE; n = 3 for each group. *P < 0.05 compared with M2-AChR saline and WT Iso groups.
|
|
MMP activity is controlled by the endogenous TIMPs. We, therefore, determined the expression of TIMP1 and TIMP2, the two major TIMP types in the heart, using RT-PCR. As shown in Fig. 7, TIMP1 mRNA levels were significantly decreased in M2-AChR KO mice after Iso infusion compared with the WT-Iso and saline groups. TIMP2 expression, however, was not significantly different among the groups. These data suggest that increased MMP activity seen in the M2-AChR KO-Iso group may be due to downregulation of TIMP1 expression.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 7. Expression of tissue inhibitor of MMP (TIMP) in left ventricular tissues studied by RT-PCR. A: representative gel images of RT-PCR products of TIMP1, TIMP2, and GAPDH, as visualized by a charge-coupled device camera under UV light after 0.5 µg/ml ethidium bromide staining. Mean data are shown for TIMP1 (B) and TIMP2 (C) expression, as quantified by the ratio of band intensities of TIMP1 or TIMP2 vs. GAPDH. Values are means ± SE; n = 3.
|
|
Overall, these data suggest a possibility that M2-AChR may mediate an inhibitory effect on MMP function and TIMP1 expression. We then further tested this possibility using primary cultured neonatal cardiac fibroblast and cardiomyocyte mixture. As shown in Fig. 8, treatment with adrenergic agonist PE increased MMP-9 activity in the cultured cells. Cotreatment with muscarinic agonist Beth abolished the PE-induced increase in MMP-9 activity. RT-PCR results showed that PE treatment inhibited the gene expression of TIMP1 but not TIMP2. Cotreatment with Beth reversed this PE inhibition of TIMP1 expression. Mirroring the in vivo study, these in vitro results further suggest that M2-AChR signaling pathway mediates an inhibitory effect on MMP function.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 8. MMP activity and TIMP expression in primary cultured neonatal rat cardiac fibroblasts and cardiomyocytes mixture. A: MMP-9 activity measured by gelatin zymography in cells with different treatments, showing that treatment with an adrenergic agonist, PE, increased MMP-9 activity, whereas cotreatment with a muscarinic cholinergic agonist, Beth, reversed the PE effect. The mean data were obtained from four independent experiments. B: representative RT-PCR image showing that PE treatment attenuated TIMP1 but not TIMP2 gene expression and that cotreatment with Beth reversed PE effect on TIMP1 expression.
|
|
Phosphorylation of ERK1/2 in the heart.
ERK1/2 is involved in cardiac hypertrophy and remodeling (6, 56). It was also reported that ERK1/2 promoted MMP expression and activation in cardiac fibroblasts (48, 59). Therefore, we attempted to determine whether ERK activation was altered in M2-AChR KO mice. Western blot showed that the levels of phosphorylation of ERK1/2 were at comparable low levels in both M2-AChR KO-saline and WT-saline groups. Iso infusion increased ERK1/2 phosphorylation in WT mice. Surprisingly, Iso infusion did not increase the ERK1/2 phosphorylation in M2-AChR KO mice (Fig. 9). This result suggests ERK1/2 is not involved in increase of MMP activity in M2-AChR KO mice induced by Iso infusion. How M2-AChR deficiency leads to blunted ERK1/2 activation is unclear at this time.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 9. Western blotting of phosphorylation of extracellular-regulated kinase (phos-ERK) 1/2 in left ventricular tissues from the M2-AChR KO or WT mice with Iso or saline infusion. Top: representative Western blot images of phosphorylated and total ERK1/2. Bottom: mean ± SE data for ratios of phosphorylated (p) ERK1/2 vs. total ERK1/2, showing that Iso infusion increased ERK1/2 phosphorylation in WT mice but not in M2-AChR KO mice.
|
|
 |
DISCUSSION
|
|---|
In this study, we tested the effects of M2-AChR deficiency on cardiac function. Our data indicate that 1) baseline cardiac function remains normal in the mice lacking M2-AChR; 2) after 1 wk of chronic Iso infusion, M2-AChR KO mice exhibited impaired ventricular contractile function in response to increased afterload; and 3) the chronic Iso infusion significantly increased MMP activity in the heart in M2-AChR KO mice. Overall, these data suggest that M2-AChR deficiency results in an increased susceptibility of ventricular function to stresses. These results support our hypothesis that M2-AChR-mediated PSNS action may play a protective role in cardiac ventricular function.
Using M2-AChR KO mice, we attempted to specifically evaluate the effect of M2-AChR on ventricular function. M2-AChR is the dominant receptor in the heart and mediates PSNS negative chronotropic and dromotropic effects (18). Increasing evidence suggests that M2-AChR signaling may also have a significant effect on ventricular function via both an indirect (i.e., counteraction of β-adrenergic receptor) (27, 28) and a direct mechanism (i.e., inhibition of L-type calcium channel activity) (41). A study in humans indicated that stimulation of M2-AChR significantly reduced Iso-induced inotropic effect, while blockade of M2-AChR using atropine did not significantly augment this inotropic effect (54). This result suggests that PSNS cholinergic function exerts little tonic effect on ventricular function, but can potentially affect ventricular contractility when the sympathetic drive increases. Consistent with the above report, we found that M2-AChR deficiency affects neither baseline ventricular contractility nor the contractile response to Iso. However, after chronic β-adrenergic stimulation, the M2-AChR KO mice exhibited impaired ventricular function. This result suggests that, in addition to the effect on the heart rate, M2-AChR-mediated PSNS activity also counteracts sympathetic adrenergic action on ventricular function. This ventricular effect of the PSNS can effectively protect against ventricular damage and remodeling during sympathoexcitation that exists in many cardiovascular diseases. The impaired ventricular function found in M2-AChR KO mice was evidently not secondary to changes in heart rate, because M2-AChR KO and WT mice showed no significant differences in heart rate after Iso infusion. Instead, the results suggest that the impaired ventricular function in M2-AChR KO mice after the chronic Iso infusion may be a direct consequence of altered cholinergic and adrenergic interaction in the ventricle.
The direct mechanism underlying the impaired ventricular function in M2-AChR KO mice after Iso infusion is not clear at this time. In this study, we found that chronic infusion of Iso significantly increased the activity of MMP-2 and MMP-9 in M2-AChR KO mice compared with WT mice. The link between cardiac dysfunction and increased MMP activity found in M2-AChR KO mice needs further study. However, there are increasing data suggesting that increased MMP activity may contribute to ventricular dysfunction. For example, elevated MMP activity was associated with ventricular dysfunction in patients with hypertension (1) and heart failure (39, 60). In an animal study, it was found that acute cardiac ischemia-reperfusion increased MMP-2 production, whereas inhibition of MMP activity improved the recovery of mechanical function during reperfusion (11). In a transgenic model, overexpression of MMP-2 in the heart resulted in impaired ventricular contractility (55). These studies demonstrated that altered MMP activity was a causal factor for cardiac dysfunction. In the heart, cardiomyocytes are surrounded and supported by an appropriately structured ECM (5, 14). The normal structural interaction between cardiomyocytes and ECM provides a basis for normal cardiomyocyte contraction (5, 8). Excessive MMP activity may cause loss of normal collagen components and disruption of ECM and cardiomyocyte connection (14). Thus we reason that the observed increased MMP activity in the heart of M2-AChR KO mice after Iso infusion may be responsible for the impaired cardiac contractility.
In M2-AChR KO mice, Iso infusion induced a more robust increase in MMP activity, suggesting that M2-AChR may mediate inhibitory effects on MMP function. To further test this possibility, we carried out an in vitro experiment using primary culture of mixed cardiac fibroblasts and cardiomyocytes. The results showed that cotreatment with the muscarinic agonist, Beth, reversed the increase in MMP activity induced by the adrenergic agonist PE. These data confirm a cholinergic inhibitory effect on MMP regulation. This effect may be one of the mechanisms underlying PSNS-mediated cardiac protection. In M2-AChR KO mice, lack of this protective mechanism results in an excessive MMP activation during cardiac stress, which, in turn, causes interruption of ECM-cardiomyocyte interactions and thus leads to cardiac dysfunction.
Some studies have indicated that MAP kinase ERK1/2 positively regulates MMP expression and activation in cardiac fibroblasts (48, 59). However, in our study, Iso infusion-induced increase of ERK1/2 phosphorylation, as seen in WT mice, was actually abolished in M2-AChR KO mice. This result suggests that ERK1/2 does not mediate the increase in MMP activity in M2-AChR KO mice with Iso infusion. This result is consistent with some other studies that indicated that ERK1/2 elicited inhibitory effects on MMP expression and activation (10, 20). Therefore, it is possible that Iso infusion-induced increase of ERK1/2 activation is a compensatory response that may inhibit MMP activation. Accordingly, the blunted ERK1/2 activation in M2-AChR KO mice may contribute to the robust MMP activation observed after Iso infusion. However, more studies are needed to address this question.
The findings in this study may have important clinical implications. Suppressed PSNS function has been commonly found in a variety of cardiovascular diseases, including hypertension (29, 35), myocardial infarction (17, 19), and heart failure (31, 44, 53). The role of impaired PSNS activity in the development of these diseases remains to be studied. It is generally accepted that reduced PSNS control of the heart may cause tachycardia and increase the risk of arrhythmia and sudden death in the diseased heart (34, 44). The results from the present study further suggest that suppression of PSNS function in cardiac disease may also have direct adverse effects on ventricular structure and function. Without the important PSNS cardiac protection, the heart becomes more susceptible to stress and prone to development of ventricular dysfunction. Thus restoration of impaired PSNS function should be a rational therapeutic approach to preserve and improve ventricular function in these cardiovascular diseases.
It should be pointed out that mice have a very low basal parasympathetic tone. We have observed that blockade of muscarinic receptors by atropine does not increase heart rate in mice (data not shown). This observation may explain why the basal heart rate in M2-AChR mice is not significantly increased. However, as shown in Fig. 1A, in WT mice, a rapid increase in blood pressure induced a PSNS-mediated bradycardic response (baroreflex), indicating the potential PSNS control of the heart in mice. This PSNS may provide effective protection to the heart during stress. Consistent with this notion, the baroreflex bradycardic response was abolished in the M2-AChR KO mice (Fig. 1A). Therefore, M2-AChR KO mice represent a very valuable tool for the study of PSNS effects on the heart.
In humans, there is tonic PSNS control of the heart. Thus the human heart may rely more on PSNS protection and be more sensitive to loss of this protection. Therefore, the suppression of PSNS function commonly found in heart failure and hypertension may contribute to the progression of ventricular dysfunction in these diseases. Notably, impaired PSNS function and ventricular dysfunction also coexist in many other different states, such as aging (46, 49), obesity (2, 45), diabetes (22, 42), and the transplanted heart (32, 50). In all of these conditions, a gradually developing ventricular dysfunction is a common complication, even without major myocardial injury and hemodynamic stress. Based on our findings that suggest a cardiac protective role of PSNS function, we hypothesize that loss of PSNS protection may be an important contributor to the development of ventricular dysfunction found in these states. Therefore, preservation and restoration of PSNS function may be a common strategy to prevent and improve ventricular dysfunction in different pathophysiological conditions.
We would also like to raise several caveats. First, in the present study, we only monitored the effects of the short-term (1 wk) Iso infusion. Whether longer infusion can cause more significant cardiac dysfunction needs to be tested in future experiments. Second, in this initial study, only the maximal and minimal dP/dt and end-diastolic pressure of the left ventricle were measured as indexes of cardiac function. The influences of cardiac load and heart rate on dP/dt have been previously studied and discussed (30). The impact of M2-AChR deficiency on ventricular function might be more robustly revealed by using load-independent parameters, such as end-systolic and diastolic pressure-volume relationships and maximal left ventricular elastance (Emax). Third, it is possible that other not yet identified factors contribute to the contractile dysfunction found in M2-AChR KO mice. Of particular importance is whether the calcium handling function is altered in M2-AChR KO mice before or after Iso infusion. Fourth, systemic effects of the global M2-AChR deficiency cannot be completely excluded. However, this and previous studies (21) have confirmed that baseline hemodynamic and cardiac parameters are normal in M2-AChR KO mice. Therefore, it is unlikely that the cardiac phenotype of the M2-AChR KO mice described in the present study is due to altered hemodynamics. The data from our in vitro studies further suggest a direct effect of muscarinic cholinergic signaling pathway on the cardiac cells. Certainly, this possibility needs to be further confirmed using cardiac cells from WT and M2-AChR mice. Furthermore, our in vitro work used mixed cardiac cells. This is a limitation in terms of identifying the cellular component targeted by the cholinergic regulation. Nevertheless, it suggests possible interaction between fibroblasts and myocytes in the response to cholinergic stimulation. Future studies will be important to further define whether PSNS cholinergic signaling can directly act on cardiac fibroblasts, or, through myocyte-fibroblast communication, to regulate ECM metabolism.
In summary, in this study, we found for the first time that mice lacking M2-AChR retain normal baseline cardiac function, but develop impaired ventricular contractility after chronic β-adrenergic stimulation. These data suggest that M2-AChR-mediated PSNS control of the heart may play a protective role in ventricular function against cardiac stresses. Further investigation of underlying mechanisms of this PSNS cholinergic cardioprotection may suggest new avenues for prevention and treatment of cardiac diseases.
 |
GRANTS
|
|---|
This work was partly supported by American Heart Association Beginning Grant-in Aid 0460063Z, National Institutes of Health (NIH) Centers Of Biomedical Research Excellence Grant 5 P20 RR017662, and NIH IDeA Network of Biomedical Research Excellence Grant 2 P20 RR016479.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: Y.-F. Li, Division of Basic Biomedical Sciences, Sanford School of Medicine, Univ. of South Dakota, 414 E. Clark St., Vermillion, SD 57069 (e-mail: yli01{at}usd.edu)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- Ahmed SH, Clark LL, Pennington WR, Webb CS, Bonnema DD, Leonardi AH, McClure CD, Spinale FG, Zile MR. Matrix metalloproteinases/tissue inhibitors of metalloproteinases: relationship between changes in proteolytic determinants of matrix composition and structural, functional, and clinical manifestations of hypertensive heart disease. Circulation 113: 2089–2096, 2006.[Abstract/Free Full Text]
- Amano M, Kanda T, Ue H, Moritani T. Exercise training and autonomic nervous system activity in obese individuals. Med Sci Sports Exerc 33: 1287–1291, 2001.
- Bohm M, Ettelbruck S, Flesch M, van Gilst WH, Knorr A, Maack C, Pinto YM, Paul M, Teisman AC, Zolk O. Beta-adrenergic signal transduction following carvedilol treatment in hypertensive cardiac hypertrophy. Cardiovasc Res 40: 146–155, 1998.[Abstract/Free Full Text]
- Brauer PR. MMPs–role in cardiovascular development and disease. Front Biosci 11: 447–478, 2006.[Web of Science][Medline]
- Brown RD, Ambler SK, Mitchell MD, Long CS. The cardiac fibroblast: therapeutic target in myocardial remodeling and failure. Annu Rev Pharmacol Toxicol 45: 657–687, 2005.[CrossRef][Web of Science][Medline]
- Bueno OF, Molkentin JD. Involvement of extracellular signal-regulated kinases 1/2 in cardiac hypertrophy and cell death. Circ Res 91: 776–781, 2002.[Abstract/Free Full Text]
- Bunag RD, Krizsan D, Itoh H. Diminished cardiovascular responsiveness to vagal stimulation in obese rats. Am J Physiol Regul Integr Comp Physiol 259: R842–R848, 1990.[Abstract/Free Full Text]
- Camelliti P, Borg TK, Kohl P. Structural and functional characterisation of cardiac fibroblasts. Cardiovasc Res 65: 40–51, 2005.[Abstract/Free Full Text]
- Caulfield MP. Muscarinic receptors–characterization, coupling and function. Pharmacol Ther 58: 319–379, 1993.[CrossRef][Web of Science][Medline]
- Chan CY, Chen YS, Lee HH, Huang HS, Lai YL, Chen CF, Ma MC. Erythropoietin protects post-ischemic hearts by preventing extracellular matrix degradation: role of Jak2-ERK pathway. Life Sci 81: 717–723, 2007.[CrossRef][Web of Science][Medline]
- Cheung PY, Sawicki G, Wozniak M, Wang W, Radomski MW, Schulz R. Matrix metalloproteinase-2 contributes to ischemia-reperfusion injury in the heart. Circulation 101: 1833–1839, 2000.[Abstract/Free Full Text]
- Cohn JN. Abnormalities of peripheral sympathetic nervous system control in congestive heart failure. Circulation 82: I59–I67, 1990.[Medline]
- Communal C, Singh K, Pimentel DR, Colucci WS. Norepinephrine stimulates apoptosis in adult rat ventricular myocytes by activation of the beta-adrenergic pathway. Circulation 98: 1329–1334, 1998.[Abstract/Free Full Text]
- D'Armiento J. Matrix metalloproteinase disruption of the extracellular matrix and cardiac dysfunction. Trends Cardiovasc Med 12: 97–101, 2002.[CrossRef][Web of Science][Medline]
- Dabrowska B, Dabrowski A, Skrobowski A. Parasympathetic withdrawal precedes spontaneous blood pressure elevations in women with primary hypertension. Cardiology 87: 119–124, 1996.[CrossRef][Web of Science][Medline]
- Dall'ago P, D'Agord Schaan B, da Silva VO, Werner J, da Silva Soares PP, de Angelis K, Irigoyen MC. Parasympathetic dysfunction is associated with baroreflex and chemoreflex impairment in streptozotocin-induced diabetes in rats. Auton Neurosci 131: 28–35, 2007.[CrossRef][Web of Science][Medline]
- Dambrink JH, Tuininga YS, van Gilst WH, Peels KH, Lie KI, Kingma JH. Association between reduced heart rate variability and left ventricular dilatation in patients with a first anterior myocardial infarction. CATS Investigators Captopril and Thrombolysis Study. Br Heart J 72: 514–520, 1994.[Abstract/Free Full Text]
- Dhein S, van Koppen CJ, Brodde OE. Muscarinic receptors in the mammalian heart. Pharmacol Res 44: 161–182, 2001.[CrossRef][Web of Science][Medline]
- Du XJ, Cox HS, Dart AM, Esler MD. Depression of efferent parasympathetic control of heart rate in rats with myocardial infarction: effect of losartan. J Cardiovasc Pharmacol 31: 937–944, 1998.[CrossRef][Web of Science][Medline]
- Esparza J, Vilardell C, Calvo J, Juan M, Vives J, Urbano-Marquez A, Yague J, Cid MC. Fibronectin upregulates gelatinase B (MMP-9) and induces coordinated expression of gelatinase A (MMP-2) and its activator MT1-MMP (MMP-14) by human T lymphocyte cell lines. A process repressed through RAS/MAP kinase signaling pathways. Blood 94: 2754–2766, 1999.[Abstract/Free Full Text]
- Fisher JT, Vincent SG, Gomeza J, Yamada M, Wess J. Loss of vagally mediated bradycardia and bronchoconstriction in mice lacking M2 or M3 muscarinic acetylcholine receptors. FASEB J 18: 711–713, 2004.[Abstract/Free Full Text]
- Galderisi M. Diastolic dysfunction and diabetic cardiomyopathy: evaluation by Doppler echocardiography. J Am Coll Cardiol 48: 1548–1551, 2006.[Abstract/Free Full Text]
- Gehrmann J, Meister M, Maguire CT, Martins DC, Hammer PE, Neer EJ, Berul CI, Mende U. Impaired parasympathetic heart rate control in mice with a reduction of functional G protein β
-subunits. Am J Physiol Heart Circ Physiol 282: H445–H456, 2002.[Abstract/Free Full Text] - Girgis I, Chakko S, de Marchena E, Jara C, Diaz P, Castellanos A, Myerburg RJ. Effect of clonidine on heart rate variability in congestive heart failure. Am J Cardiol 82: 335–337, 1998.[CrossRef][Web of Science][Medline]
- Gogly B, Groult N, Hornebeck W, Godeau G, Pellat B. Collagen zymography as a sensitive and specific technique for the determination of subpicogram levels of interstitial collagenase. Anal Biochem 255: 211–216, 1998.[CrossRef][Web of Science][Medline]
- Gomeza J, Shannon H, Kostenis E, Felder C, Zhang L, Brodkin J, Grinberg A, Sheng H, Wess J. Pronounced pharmacologic deficits in M2 muscarinic acetylcholine receptor knockout mice. Proc Natl Acad Sci USA 96: 1692–1697, 1999.[Abstract/Free Full Text]
- Hare JM, Keaney JF Jr, Balligand JL, Loscalzo J, Smith TW, Colucci WS. Role of nitric oxide in parasympathetic modulation of beta-adrenergic myocardial contractility in normal dogs. J Clin Invest 95: 360–366, 1995.[Web of Science][Medline]
- Henning RJ, Khalil IR, Levy MN. Vagal stimulation attenuates sympathetic enhancement of left ventricular function. Am J Physiol Heart Circ Physiol 258: H1470–H1475, 1990.[Abstract/Free Full Text]
- Julius S. Autonomic nervous system dysregulation in human hypertension. Am J Cardiol 67: 3B–7B, 1991.[CrossRef][Medline]
- Kass DA, Maughan WL, Guo ZM, Kono A, Sunagawa K, Sagawa K. Comparative influence of load vs. inotropic states on indexes of ventricular contractility: experimental and theoretical analysis based on pressure-volume relationships. Circulation 76: 1422–1436, 1987.[Abstract/Free Full Text]
- Kinugawa T, Dibner-Dunlap ME. Altered vagal and sympathetic control of heart rate in left ventricular dysfunction and heart failure. Am J Physiol Regul Integr Comp Physiol 268: R317–R323, 1995.[Abstract/Free Full Text]
- Koglin J, Uberfuhr P, von Scheidt W. Parasympathetic denervation supersensitivity of the transplanted human ventricle in vivo. Am J Physiol Heart Circ Physiol 271: H435–H439, 1996.[Abstract/Free Full Text]
- La Rovere MT, Bigger JT Jr, Marcus FI, Mortara A, Schwartz PJ. Baroreflex sensitivity and heart-rate variability in prediction of total cardiac mortality after myocardial infarction ATRAMI (Autonomic Tone and Reflexes After Myocardial Infarction) Investigators. Lancet 351: 478–484, 1998.[CrossRef][Web of Science][Medline]
- La Rovere MT, Mortara A, Pantaleo P, Maestri R, Cobelli F, Tavazzi L. Scopolamine improves autonomic balance in advanced congestive heart failure. Circulation 90: 838–843, 1994.[Abstract/Free Full Text]
- Langewitz W, Ruddel H, Schachinger H. Reduced parasympathetic cardiac control in patients with hypertension at rest and under mental stress. Am Heart J 127: 122–128, 1994.[CrossRef][Web of Science][Medline]
- Li M, Zheng C, Sato T, Kawada T, Sugimachi M, Sunagawa K. Vagal nerve stimulation markedly improves long-term survival after chronic heart failure in rats. Circulation 109: 120–124, 2004.[Abstract/Free Full Text]
- Li YF, Cornish KG, Patel KP. Alteration of NMDA NR1 receptors within the paraventricular nucleus of hypothalamus in rats with heart failure. Circ Res 93: 990–997, 2003.[Abstract/Free Full Text]
- Logothetis DE, Kurachi Y, Galper J, Neer EJ, Clapham DE. The beta gamma subunits of GTP-binding proteins activate the muscarinic K+ channel in heart. Nature 325: 321–326, 1987.[CrossRef][Medline]
- Martos R, Baugh J, Ledwidge M, O'Loughlin C, Conlon C, Patle A, Donnelly SC, McDonald K. Diastolic heart failure: evidence of increased myocardial collagen turnover linked to diastolic dysfunction. Circulation 115: 888–895, 2007.[Abstract/Free Full Text]
- Miura S, Ohno I, Suzuki J, Suzuki K, Okada S, Okuyama A, Nawata J, Ikeda J, Shirato K. Inhibition of matrix metalloproteinases prevents cardiac hypertrophy induced by beta-adrenergic stimulation in rats. J Cardiovasc Pharmacol 42: 174–181, 2003.[CrossRef][Web of Science][Medline]
- Nagata K, Ye C, Jain M, Milstone DS, Liao R, Mortensen RM. Galpha(i2) but not Galpha(i3) is required for muscarinic inhibition of contractility and calcium currents in adult cardiomyocytes. Circ Res 87: 903–909, 2000.[Abstract/Free Full Text]
- Oberhauser V, Schwertfeger E, Rutz T, Beyersdorf F, Rump LC. Acetylcholine release in human heart atrium: influence of muscarinic autoreceptors, diabetes, and age. Circulation 103: 1638–1643, 2001.[Abstract/Free Full Text]
- Pedretti RF, Prete G, Foreman RD, Adamson PB, Vanoli E. Autonomic modulation during acute myocardial ischemia by low-dose pirenzepine in conscious dogs with a healed myocardial infarction: a comparison with beta-adrenergic blockade. J Cardiovasc Pharmacol 41: 671–677, 2003.[CrossRef][Web of Science][Medline]
- Porter TR, Eckberg DL, Fritsch JM, Rea RF, Beightol LA, Schmedtje JF Jr, Mohanty PK. Autonomic pathophysiology in heart failure patients. Sympathetic-cholinergic interrelations. J Clin Invest 85: 1362–1371, 1990.[Web of Science][Medline]
- Powell BD, Redfield MM, Bybee KA, Freeman WK, Rihal CS. Association of obesity with left ventricular remodeling and diastolic dysfunction in patients without coronary artery disease. Am J Cardiol 98: 116–120, 2006.[CrossRef][Web of Science][Medline]
- Redfield MM. Understanding "diastolic" heart failure. N Engl J Med 350: 1930–1931, 2004.[Free Full Text]
- Schlaich MP, Kaye DM, Lambert E, Sommerville M, Socratous F, Esler MD. Relation between cardiac sympathetic activity and hypertensive left ventricular hypertrophy. Circulation 108: 560–565, 2003.[Abstract/Free Full Text]
- Spallarossa P, Altieri P, Garibaldi S, Ghigliotti G, Barisione C, Manca V, Fabbi P, Ballestrero A, Brunelli C, Barsotti A. Matrix metalloproteinase-2 and -9 are induced differently by doxorubicin in H9c2 cells: the role of MAP kinases and NAD(P)H oxidase. Cardiovasc Res 69: 736–745, 2006.[Abstract/Free Full Text]
- Stratton JR, Levy WC, Caldwell JH, Jacobson A, May J, Matsuoka D, Madden K. Effects of aging on cardiovascular responses to parasympathetic withdrawal. J Am Coll Cardiol 41: 2077–2083, 2003.[Abstract/Free Full Text]
- Studeli R, Jung S, Mohacsi P, Perruchoud S, Castiglioni P, Wenaweser P, Heimbeck G, Feller M, Hullin R. Diastolic dysfunction in human cardiac allografts is related with reduced SERCA2a gene expression. Am J Transplant 6: 775–782, 2006.[CrossRef][Web of Science][Medline]
- Szabo G, Otero AS. Muscarinic activation of potassium channels in cardiac myocytes: kinetic aspects of G protein function in vivo. Trends Pharmacol Sci, Suppl 46–49, 1989.
- Valenzuela D, Han X, Mende U, Fankhauser C, Mashimo H, Huang P, Pfeffer J, Neer EJ, Fishman MC. G alpha(o) is necessary for muscarinic regulation of Ca2+ channels in mouse heart. Proc Natl Acad Sci USA 94: 1727–1732, 1997.[Abstract/Free Full Text]
- Vatner DE, Lee DL, Schwarz KR, Longabaugh JP, Fujii AM, Vatner SF, Homcy CJ. Impaired cardiac muscarinic receptor function in dogs with heart failure. J Clin Invest 81: 1836–1842, 1988.[Web of Science][Medline]
- Von Scheidt W, Bohm M, Stablein A, Autenrieth G, Erdmann E. Antiadrenergic effect of M-cholinoceptor stimulation on human ventricular contractility in vivo. Am J Physiol Heart Circ Physiol 263: H1927–H1931, 1992.[Abstract/Free Full Text]
- Wang GY, Bergman MR, Nguyen AP, Turcato S, Swigart PM, Rodrigo MC, Simpson PC, Karliner JS, Lovett DH, Baker AJ. Cardiac transgenic matrix metalloproteinase-2 expression directly induces impaired contractility. Cardiovasc Res 69: 688–696, 2006.[Abstract/Free Full Text]
- Wang Y. Mitogen-activated protein kinases in heart development and diseases. Circulation 116: 1413–1423, 2007.[Abstract/Free Full Text]
- Wess J, Duttaroy A, Zhang W, Gomeza J, Cui Y, Miyakawa T, Bymaster FP, McKinzie L, Felder CC, Lamping KG, Faraci FM, Deng C, Yamada M. M1-M5 muscarinic receptor knockout mice as novel tools to study the physiological roles of the muscarinic cholinergic system. Receptors Channels 9: 279–290, 2003.[CrossRef][Web of Science][Medline]
- Wettschureck N, Offermanns S. Mammalian G proteins and their cell type specific functions. Physiol Rev 85: 1159–1204, 2005.[Abstract/Free Full Text]
- Xie Z, Singh M, Singh K. Differential regulation of matrix metalloproteinase-2 and -9 expression and activity in adult rat cardiac fibroblasts in response to interleukin-1beta. J Biol Chem 279: 39513–39519, 2004.[Abstract/Free Full Text]
- Yan AT, Yan RT, Spinale FG, Afzal R, Gunasinghe HR, Arnold M, Demers C, McKelvie RS, Liu PP. Plasma matrix metalloproteinase-9 level is correlated with left ventricular volumes and ejection fraction in patients with heart failure. J Card Fail 12: 514–519, 2006.[CrossRef][Web of Science][Medline]
- Zamotrinsky AV, Kondratiev B, de Jong JW. Vagal neurostimulation in patients with coronary artery disease. Auton Neurosci 88: 109–116, 2001.[CrossRef][Web of Science][Medline]
Copyright © 2008 by the American Physiological Society.