AJP - Heart AJP citation statistics
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Heart Circ Physiol 294: H1933-H1938, 2008. First published February 22, 2008; doi:10.1152/ajpheart.00260.2007
0363-6135/08 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/4/H1933    most recent
00260.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wen, Y.
Right arrow Articles by Nadler, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wen, Y.
Right arrow Articles by Nadler, J. L.

Role of 12/15-lipoxygenase in the expression of MCP-1 in mouse macrophages

Yeshao Wen, Jiali Gu, George E. Vandenhoff, Xiaoping Liu, and Jerry L. Nadler

Diabetes and Hormone Center, University of Virginia, Charlottesville, Virginia

Submitted 2 March 2007 ; accepted in final form 29 January 2008


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Monocyte chemoattractant protein (MCP)-1 plays a key role in atherosclerosis and inflammation associated with visceral adiposity by inducing mononuclear cell migration. Evidence shows that mouse peritoneal macrophages (MPM) express a 12-lipoxygenase (12/15-LO) that has been clearly linked to accelerated atherosclerosis in mouse models and increased monocyte endothelial interactions in both rodent and human cells. However, the role of 12/15-LO products in regulating MCP-1 expression in macrophages has not been clarified. In this study, we tested the role of 12/15-LO products using MPM and the mouse macrophage cell line, J774A.1 cells. We found that 12(S)-hydroxyeicosatetraenoic acid [12(S)-HETE] increased MCP-1 mRNA and protein expression in J774A.1 cells and MPM. In contrast, 12(R)-HETE, a lipid not derived from 12/15-LO, did not affect MCP-1 expression. 15(S)-HETE also increased MCP-1 mRNA expression, but the effect was less compared with 12(S)-HETE. MCP-1 mRNA expression was upregulated in a macrophage cell line stably overexpressing 12/15-LO (Plox-86 cells) and in MPM isolated from a 12/15-LO transgenic mouse. In addition, the expression of MCP-1 was downregulated in MPM isolated from 12/15-LO knockout mice. 12(S)-HETE-induced MCP-1 mRNA expression was attenuated by specific inhibitors of protein kinase C (PKC) and p38 mitogen-activated protein kinase (p38). 12(S)-HETE also directly activated NADPH oxidase activity. Two NADPH oxidase inhibitors, apocynin and diphenyleneiodonium chloride, blocked 12(S)-HETE-induced MCP-1 mRNA. Apocynin attenuated 12(S)-HETE-induced MCP-1 protein secretion. These data show that 12(S)-HETE increases MCP-1 expression by inducing PKC, p38, and NADPH oxidase activity. These results suggest a potentially important mechanism linking 12/15-LO activation to MCP-1 expression that induces inflammatory cell infiltration.

12/15-lipoxygenase; monocyte chemoattractant protein-1; J774A.1 cells; mouse peritoneal macrophages

MONOCYTE CHEMOATTRACTANT PROTEIN (MCP)-1 (also known as CCL2) is one of the most thoroughly characterized CC chemokines (25, 2). MCP-1 can be induced in numerous cell types, including vascular endothelial cells (EC), smooth muscle cells, monocytes/macrophages, and cardiac myocytes, in response to various stimuli. MCP-1 is a potent agonist for monocytes, memory T cells, and basophils (2). The interaction of MCP-1 with its receptor CCR2 facilitates monocyte diapedeses into the tunica intima, where the monocyte acquires characteristics of the tissue macrophage that can become a foam cell (11). MCP-1 also participates in macrophage recruitment to adipose tissue (17, 27), which accelerates the development of inflammation and systemic insulin resistance (27). MCP-1 plays a key role in neutrophil activation and recruitment in cardiac myocytes in ischemia-reperfusion injury (8). Therefore, MCP-1 directs the migration of circulating leukocytes to sites of inflammation or injury and induces the activation of inflammatory cells.

There is supporting evidence that mouse peritoneal macrophages (MPM) and murine macrophage cell lines contain a lipoxygenase (LO) that possesses both 12- and 15-LO activity (12/15-LO) (21, 25). 12/15-LO can hydrolyze arachidonic acid to form predominately 12(S)-hydroperoxy-5Z, -8Z, and -10E, 14Z-eicosatetraenoic acid [12(S)-HPETE], 12(S)-hydroxyeicosatetraenoic acid [12(S)-HETE], and smaller quantities of 15(S)- HPETE. 12(S)-HPETE and 12(S)-HETE have been shown to increase interleukin (IL)-6, tumor necrosis factor-{alpha}, IL-1β, and IL-12 mRNA and protein expression in macrophages (28). 12/15-LO can also catalyze stereoselective oxidation of linoleic acid at position 13 over position 9 to preferentially form 13-(S)-hydroperoxyoctadecadienoic acid (13-HPODE), which is the predominant oxidized fatty acid in low-density lipoprotein (LDL). Evidence has shown that 13-HPODE upregulates the expression of MCP-1 in vascular smooth muscle cells (VSMC) (16, 3). There are several differences between 13-HPODE and 12(S)-HPETE. 13-HPODE is esterified to cholesterol as cholesteryl-HPODE in LDL particles, leading to the oxidative modification of LDL (32, 33, 1). In contrast, 12(S)-HETE is not typically taken up in LDL. Oxidation of LDL is believed to contribute to foam cell formation and lipid accumulation in lesions as well as to the formation of necrotic areas in the core of the plaque (31). 12(S)-HETE has been shown to increase monocyte binding to EC (18, 22) and VSMC (10). Because MCP-1 plays a role in the chemotaxis and binding of monocytes with EC or VSMC, it is possible that 12/15-LO products can regulate MCP-1 expression. However, it is unclear whether arachidonic acid metabolites of 12/15-LO participate in the regulation of MCP-1 expression in macrophages.

In this study, we tested the role of 12/15-LO products in the regulation of MCP-1 expression using MPM and the mouse macrophage cell line J774A.1. Our results demonstrate that treatment of MPM or J774A.1 cells with a low concentration of 12(S)-HETE increases MCP-1 mRNA and protein expression, whereas treatment of higher concentrations of 15(S)-HETE increase MCP-1 mRNA expression. We also observed increased MCP-1 expression in MPM from 12/15-LO transgenic (12/15-LO Tg) mice and in J774A.1 cells stably overexpressing 12/15-LO. In addition, reduced MCP-1 expression was observed in MPM from 12/15-LO null mice compared with that in MPM from control mice. These data suggest that the 12/15-LO pathway participates in the regulation of MCP-1 expression in mouse macrophages.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
J774A.1 cells were purchased from The American Type Culture Collection (ATCC; Manassas, VA). C57BL6 mice were from Jackson Laboratory (Bar Harbor, ME). 12/15-LO knockout (12/15-LO null) mice were originally a generous gift from Dr. Colin Funk and have been backcrossed to the C57BL6 background. 12/15-LO Tg mice on the C57BL6 background were generated as previously described (22). 12/15-LO null and 12/15-LO Tg mice are maintained in the mouse core of the Cardiovascular Research Center in the University of Virginia. Thioglycollate, apocynin, diphenyleneiodonium chloride (DPI), cytochrome c, NADPH, and superoxide dismutase (SOD) were purchased from Sigma (St. Louis, MO). 12(S)-HETE and 15(S)-HETE (>98%) were purchased from Biomol (Plymouth Meeting, PA). The RNeasy Mini Kit was obtained from Qiagen (Valencia, CA). Mouse MCP-1 immunoassay kits were obtained from R & D System (Minneapolis, MN). Culture media and Dulbecco's modified Eagle's medium (DMEM) were purchased from ATCC; RPMI-1640 and Hanks' balanced salt solution (HBSS) were from Invitrogen (Carlsbad, CA). BSA (fraction V, fatty acid free) was obtained from ICN Biomedicals (Aurora, OH).

J774A.1 cell culture. J774A.1 cells were cultured following the instructions from ATCC. Plox-86 cells, which stably overexpress 12/15-LO on the J774A.1 cell background, and mock-transfected J774A.1 cells were established and kindly provided by Dr. Yoshimoto in Kanazawa (24). Before treatment with various agonists, cells were cultured in DMEM containing 0.5% FBS and 0.2% BSA (fraction V, fatty acid free) overnight. Cells were then cultured in the depletion medium, which was DMEM with 4 mM L-glutamine adjusted to contain 1.5 g/l sodium bicarbonate and 4.5 g/l glucose, and 0.2% BSA (free of fatty acid) without FBS for 2 h.

MPM isolation and culture. Eight- to ten-week-old male C57BL6 mice, 12/15-LO Tg mice, or 12/15-LO null mice (both on C57BL6 background) were injected intraperitoneally with 2 ml 4% thioglycollate solution. Later (3 days), the ascites of these mice were collected, and MPM were isolated and cultured as described previously (28). MPM were then treated with various agonists in RPMI 1640 medium containing 10% heat-inactivated FBS and penicillin-streptomycin for certain periods of time. In experiments with 12-HETE treatments, MPM were incubated another 2 h in RPMI 1640 medium containing 0.2% BSA and P/S. The animal protocol was approved by the Institutional Animal Safety Committee of the University of Virginia.

RNA extraction, cDNA synthesis, and quantitative real-time PCR. The details of these procedures were described previously (28). Briefly, total RNA was extracted from cells using the RNeasy kit followed by DNase I treatment according to the manufacturer's protocol (Qiagen). cDNA was synthesized from 1 µg of total RNA using an oligo(dT)15 primer and the SuperScript II reverse transcriptase (Invitrogen, Life Technologies) according to the manufacturer's protocol. For quantitation, a double-stranded DNA dye, SYBR Green I (Molecular Probes, Eugene, OR), was used along with AmpliTaq Gold and 0.1 µM of each primer. All reactions were performed in triplicate in an iCycler iQ Real-Time PCR Detection System (Bio-Rad Laboratory, Hercules, CA). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an endogenous reference to correct for differences in the amount of total RNA added to the reaction and to compensate for different levels of inhibition during reverse transcription of RNA and during PCR. Data are calculated by the 2Formula method (4, 12) and are presented as the degree of transcript induction, which was normalized to GAPDH of target genes in cells treated with agonists, compared with the transcript induction, which was normalized to GAPDH of the genes in cells treated with vehicle (defined as 1.0-fold in each case).

Primers. The sequences of forward (5' to 3') and reverse (5' to 3') primers used for quantitative real-time PCR analysis of mouse MCP-1 are cttctgggcctgctgttca and ccagcctactcattgggatca. The sequences of mouse leukocyte-type 12/15-LO are ctctcaaggcctgttcagga and gtccattgtccccagaacct (1). The sequences of mouse housekeeping gene (GAPDH) are tcaccaccatggagaaggc and gctaagcagttggtggtgca. Primers were synthesized from Integrated DNA Technologies (Coralville, OA).

MCP-1 protein release measurement using ELISA. Cells were seeded on 24-well plates with each well containing 2 x 105 cells of J774A.1 or MPM in 1 ml medium. After depletion for 24 h, cells were then treated with 12(S)-HETE, or vehicle ethanol, at 37°C for the indicated time in a CO2 incubator. The conditioned medium was collected in a sequential fashion (e.g., 0–16, 16–24, and 24–36 h) with changes of 1 ml fresh medium containing 12(S)-HETE at each time point. The collected culture-conditioned medium was centrifuged to separate floating cells in the medium, and the supernatant was stored at –80°C. MCP-1 protein levels were measured using specific mouse MCP-1 ELISA kits (R & D System) following their instruction.

NADPH oxidase activity measurement. NADPH oxidase-dependent superoxide production was measured by the SOD-inhibitable cytochrome c reduction method described previously (19). J774A.1 cells were treated with vehicle, ethanol, or 12(S)-HETE for different time periods, and then the J774A.1 cells were lysed in lysis buffer. Protein (100 µg) was distributed in 96-well flat-bottom culture plates (final volume 200 µl/well). Cytochrome c (500 µmol/l) and NADPH (100 µmol/l) were added in the presence or absence of SOD (200 U/ml) and incubated at room temperature for 30 min. Cytochrome c reduction was measured by reading absorbance at 550 nm on a microplate reader.

Data analysis. The results are expressed as means ± SE from three batches of cultured MPM with each batch of MPM from six to eight mice as noted in the legends for Figs. 1GoGo–4. For the J774A.1 cells, results are expressed as means ± SE from three batches of cultured cells. For experiments running at one time period, the control and experimental samples were analyzed using the two-tailed Student's t-test. These comparisons are based on a minimum of three experiments in triplicate per treatment. For multiple time periods of conditions, analysis of variance was used with appropriate corrections.


Figure 1
View larger version (11K):
[in this window]
[in a new window]

  		Fig. 1. The stimulatory effect of 12(S)-hydroxyeicosatetraenoic acid [12(S)-HETE] on monocyte chemoattractant protein (MCP)-1 mRNA levels in J774A.1 cells and in mouse peritoneal macrophages (MPM). Cells were treated with 0.1 or 10 nmol/l 12(S)-HETE for the indicated time course with the controls treated with the same volume of vehicle, ethanol. Total RNA was extracted, and cDNA was synthesized. Aliquots of cDNA were used as template reactions containing primers either for MCP-1 or for glyceraldehyde-3-phosphate dehydrogenase (GAPDH). cDNA derived from 25 ng of RNA was used for real-time RT-PCR analysis. Data were calculated by the 2

Formula method and presented as the degree of induction of transcripts for cytokine genes normalized to GAPDH in cells treated with 12(S)-HETE over that treated with vehicle, ethanol. A: MCP-1 mRNA expression changes in J774A.1 cells. B: MCP-1 mRNA expression changes in MPM. C: no effect by 12(R)-HETE. Mean ± SE was calculated based on 3 individual experiments with samples from 3 batches of J774A.1 cells or MPM. In each experiment, each sample run 3 wells in PCR reactions. For experiments running at one time period, the control and experimental samples were analyzed using two-tailed Student's t-test. *P < 0.05 and **P < 0.01 vs. control.

 

Figure 2
View larger version (17K):
[in this window]
[in a new window]

  		Fig. 2. Effects of overexpression or deficiency of 12/15- lipoxygenase (LO) on MCP-1 mRNA expression. A: MCP-1 mRNA expression in Plox-86 and mock-transfected cells. B: MCP-1 mRNA expression in MPM from control C57BL6 mice, 12/15-LO null mice, or 12/15-LO transgenic (Tg) mice. Total cellular RNA was extracted for real-time RT-PCR analysis and analyzed as described in the legend of Fig. 1. Data are presented as the degree of induction of transcripts for MCP-1 mRNA normalized to GAPDH in Plox-86 cells over that in mock-transfected cells (A) or in MPM from either 12/15-LO KO mice or from 12/15-LO Tg mice over that in MPM from control C57BL6 mice (B). Mean ± SE was calculated based on 3 individual experiments with samples from 3 batches of J774A.1 cells or MPM. **P < 0.01 and ***P < 0.001 vs. control.

 

Figure 3
View larger version (29K):
[in this window]
[in a new window]

  		Fig. 3. The inhibitory effects of protein kinase C (PKC) and p38 inhibitors on 12(S)-HETE-induced MCP-1 mRNA expression. J774A.1 cells were pretreated with calphostin C (100 nmol/l), GF-109203X (100 nmol/l), or SB-202190 (3 µM) for 30 min. The cells were then incubated in ethanol (EtOH) or 12(S)-HETE for an additional 4 h. Total cellular RNA was extracted for real-time RT-PCR analysis as in Fig. 1. Results are means ± SE of 3 independent experiments run in triplicate. **P < 0.01 vs. EtOH. #P < 0.03 vs. 12(S)-HETE.

 

Figure 4
View larger version (27K):
[in this window]
[in a new window]

  		Fig. 4. The role of NADPH oxidase in 12(S)-HETE-induced MCP-1 mRNA expression. A: J774A.1 cells were pretreated without or with 1 mM apocynin for 30 min. The cells were then incubated in the presence of EtOH or 1 nM 12(S)-HETE or 12(R)-HETE for 4 h. The cytosol proteins were extracted, 100 µg of protein were used, and NADPH oxidase-dependent superoxide production was measured by superoxide dismutase (SOD)-inhibitable cytochrome c reduction as described in MATERIALS AND METHODS. B: J774A.1 cells were pretreated without or with 0.1 nM and 1 mM apocynin or for 30 min. The cells were then treated with EtOH or 1 nM 12(S)-HETE for 4 h. C: J774A.1 cells were pretreated without or with 0.1 and 1 µM diphenyleneiodonium chloride (DPI) for 30 min. D: apocynin inhibits 12(S)-HETE-induced protein secretion. The cells were pretreated with apocynin and then treated with EtOH or 1 nM 12(S)-HETE for 4 h. The 12(S)-HETE-treated cells were used for protein extraction and MCP-1 protein secretion as measured using a specific mouse MCP-1 ELISA kit. RNA extraction and MCP-1 mRNA measurement were performed by real-time RT-PCR as described in the legend of Fig. 1. Results are means ± SE of 3 independent experiments run in triplicate. **P < 0.01 and ***P < 0.001 vs. control. #P < 0.05 and ##P < 0.01 vs. 12(S)-HETE.

 

   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
Stimulatory effects of 12(S)-HETE on MCP-1 mRNA expression in macrophage cells. J774A.1 cells were cultured as described and treated with vehicle, ethanol, or 12(S)-HETE for 2 or 4 h. Figure 1A shows that 12(S)-HETE at 10 nM increased MCP-1 mRNA expression ~1.5-fold (P < 0.01) at 2 h with a further increase in MCP-1 expression to 3.0-fold (P < 0.01) at 4 h of treatment. 12(S)-HETE also increased MCP-1 mRNA expression in MPM isolated from wild-type C57Bl6 mice (Fig. 1B). 12(S)-HETE (0.1 nM) increased MCP-1 mRNA expression 3.9-fold (P < 0.01) at 4 h. 12(S)-HETE (0.1 nM) seemed to be an optimal concentration since increases in MCP-1 mRNA expression were not as prominent when the concentration went up to 1 or 10 nM. In contrast, 12(R)-HETE, an inactive analog of 12(S)-HETE, did not have any effect on MCP-1 mRNA expression (Fig. 1C). 12(S)-HETE also increased MCP-1 protein secretion from J774A.1 cells 1.52 ± 0.2-fold (P < 0.05, n = 3) and ~2-fold in MPM (P < 0.01, n = 3). Another 12/15-LO product, 15(S)-HETE, also slightly increased MCP-1 mRNA expression in isolated mouse macrophages. Results showed that 1 nM 15(S)-HETE induced a 1.5 ± 0.10-fold increase in MCP-1 mRNA expression (n = 3, P < 0.03). The mRNA expression was not further increased (1.44 ± 0.34-fold over basal level, n = 3, P < 0.05) when the concentration increased to 10 nM, although the expression was similar to control levels when the 15(S)-HETE concentration declined to 0.1 nM (1.1 ± 0.02-fold over basal, n = 3).

Effects of overexpression or deficiency of 12/15-LO gene on MCP-1 mRNA expression in macrophages. We next evaluated the MCP-1 mRNA expression in Plox-86 cells, a J774A.1 cell line stably overexpressing porcine leukocyte-type 12/15-LO. Figure 2A shows that MCP-1 mRNA expression in Plox-86 cells was more than threefold (P < 0.01) higher than MCP-1 expression in mock-transfected cells. We then evaluated MCP-1 mRNA expression in macrophages isolated from 12/15-LO Tg mice (Fig. 2B). Macrophages isolated from 12/15-LO Tg mice expressed ~2.3-fold higher MCP-1 mRNA expression over that in MPM from wild-type C57BL6 mice. Interestingly, macrophages isolated from 12/15-LO null mice showed a significantly (P < 0.01) reduced MCP-1 mRNA expression (Fig. 2B).

Role of protein kinase C activity in 12(s)-HETE-induced MCP-1 mRNA expression. Our previous data have shown that 12(S)-HETE activates protein kinase C (PKC) activity in J774A.1 cells. To determine whether PKC activity is involved in 12(S)-induced MCP-1 expression, the relatively specific PKC inhibitors calphostin C (100 nM) and GF-109203X (100 nM) were used. Both calphostin C and GF-109203X at 100 nM concentration completely suppressed 12(S)-HETE-induced MCP-1 mRNA expression (Fig. 3).

Role of p38 mitogen-activated protein kinase in 12(S)-HETE-induced MCP-1 mRNA expression. Previous studies have shown that 12(S)-HETE activates p38 mitogen-activated protein kinase (MAPK) activity. To determine whether p38 MAPK activity is important for 12(S)-induced MCP-1 expression, the p38 MAPK inhibitor SB-202190 was used. The results (Fig. 3) show that 3 µM of SB-202190 completely suppressed 12(S)-HETE-induced MCP-1 mRNA expression. The SB-202190 compound did not affect basal MCP-1 mRNA expression.

NADPH oxidase activity is implicated in 12(S)-HETE-induced MCP-1 mRNA expression. We tested whether 12(S)-HETE activates NADPH oxidase activity by measuring SOD-inhibitable cytochrome c reduction in macrophages. Figure 4A shows that 4 h treatment of 12(S)-HETE (1 nM) significantly increased NADPH oxidase activity ~24-fold over that in J774A.1 cells treated with vehicle alone. Figure 4 also shows that pretreatment with 1 mM apocynin completely suppressed 12-HETE-induced NADPH oxidase activity (P < 0.01). Although 1 mM apocynin alone increased basal superoxide release, 12(R)-HETE did not stimulate superoxide release. To determine whether NADPH oxidase-mediated oxidative stress plays a role in 12(S)-HETE-induced MCP-1 mRNA expression, two structurally distinct NADPH oxidase inhibitors, apocynin and DPI, were used. Figure 4B shows that 1 nM 12(S)-HETE increased MCP-1 mRNA expression in J774A.1 cells, and 0.1 mM apocynin significantly suppressed ~50% of 12(S)-HETE-induced effects (P < 0.02) without affecting basal MCP-1 expression. When the concentration of apocynin was increased to 1 mM, 12(S)-HETE-induced MCP-1 mRNA expression was fully suppressed, but this drug concentration reduced basal MCP-1 expression (Fig. 4B). We also tested another NADPH oxidase inhibitor (DPI). Figure 4C clearly indicates that 0.1 µM completely inhibited 12(S)-HETE-induced MCP-1 mRNA expression (P = 0.004). These data suggest for the first time that NADPH oxidase is implicated in 12(S)-HETE-induced MCP-1 mRNA expression. We next evaluated the effect of apocynin on 12(S)-HETE-induced MCP-1 protein secretion in MPM. Primary cultured MPM were treated with 12(S)-HETE (1 nM) in the absence or presence of apocynin for 24 h, and the supernatants were collected for analysis of MCP-1 protein. Figure 4D shows that 12(S)-HETE induced MCP-1 protein secretion twofold (P < 0.001) in MPM, and apocynin suppressed 12(S)-HETE-induced MCP-1 protein secretion. Apocynin alone did not affect basal MCP-1 protein secretion.


   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
In this study, we have demonstrated a link between the 12/15-LO pathway and the expression of a major proinflammatory chemokine in macrophages. The 12/15-LO product 12(S)-HETE has been recognized as an inflammatory compound (15, 29), and 12/15-LO in macrophages is clearly linked to atherosclerosis in the mouse (7). In this study, we first demonstrated that direct addition of 12(S)-HETE to either the J774A.1 macrophage cell line or primary cultured MPM induced a significant increase in MCP-1 mRNA expression. 12-HETE also increased MCP-1 protein secretion from both J774A.1 and cultured MPM. In contrast, 12(R)-HETE, an inactive analog of 12(S)-HETE, had no effect on MCP-1 mRNA expression, clearly suggesting a specific effect of 12/15-LO derived lipids. We then demonstrated that another 12/15(S)-LO product, 15(S)-HETE, also increases MCP-1 mRNA level 1.5-fold in mouse macrophages. Evidence has shown that MPM and murine macrophage cell lines contain a LO that possesses both 12- and 15-LO activity (12/15-LO) (21, 25, 28). The results suggest that both 12-LO and 15-LO activities contribute stimulatory effects on MCP-1 regulation, thus, the inflammatory effects on macrophages. To further demonstrate a stimulatory effect of the 12/15-LO pathway in the regulation of MCP-1 expression, we tested the effect of 12/15-LO overexpression on MCP-1 expression. We found that there was a significant increase of MCP-1 mRNA in Plox-86 cells, which are cultured J774A.1 cells stably overexpressing 12/15-LO. We also found that there was a significant increase of MCP-1 expression in primary cultured MPM isolated from 12/15-LO Tg mice compared with that in MPM isolated from control C57BL6 mice. In addition, MCP-1 mRNA expression was significantly reduced in MPM from 12/15-LO null mice compared with that in MPM from control C57BL6 mice.

These in vitro and in vivo data clearly demonstrate that the 12/15-LO pathway has direct regulatory effects on MCP-1 expression. To our knowledge, this is the first study demonstrating a link of the 12/15-LO pathway to MCP-1 expression in macrophages. In a recent preliminary study, we found that macrophage infiltration in visceral fat is reduced in 12/15 null mice fed a high-fat diet (unpublished observation).

We next conducted studies on possible mechanisms of 12(S)-HETE-induced MCP-1 expression. Previous data have shown that 12-(S)-HETE activates PKC (14) and p38 MAPK (30) in adrenal cells and cardiac fibroblasts stably overexpressing 12/15-LO. It has recently been shown that 12(S)-HETE activates these kinases in J774A.1 macrophage cells (28). To study whether PKC and p38 are important for 12(S)-HETE activation of MCP-1 mRNA expression, two structurally distinct PKC inhibitors, calphostin C (100 nM) and GF-109203X (100 nM), and the accepted p38 inhibitor SB-202190 (3 µM) were used. The data (Fig. 3) showed that the blockade of these two kinases inhibited 12(S)-HETE-induced MCP-1 mRNA expression without affecting basal MCP-1 expression. These results suggest that PKC and p38 are two key mediators of 12(S)-HETE-induced MCP-1 expression. Our results are consistent with previous studies showing a role of PKC and p38 MAPK in regulating MCP-1 expression in other cell types (5, 26). Because the 12/15-LO pathway is involved in IL-12 production in macrophages (28), it is possible that IL-12 participates in 12/15-LO action to increase MCP-1 expression since IL-12p40 can increase MCP-1 expression (29). However, additional studies will be needed to explore this hypothesis.

There is evidence demonstrating that the 12/15-LO pathway induces superoxide generation in the presence of NADP and NADPH, indicating a direct link of 12/15-LO to superoxide generation (2). Evidence also indicates that levels of superoxide were reduced in 12/15-LO KO mouse mesangial cells compared with that in mesangial cells from wild-type mice (9). Therefore, we evaluated whether 12(S)-HETE activates NADPH oxidase activity. Our results demonstrated that 12(S)-HETE activated NADPH oxidase activity in J744A.1 cells; in contrast, 12-HETE did not stimulate NADPH oxidase activity. The 12(S)-HETE-induced increase in NADPH oxidase activity was almost suppressed by pretreatment of 1 mM apocynin, which is a well-characterized inhibitor of NADPH oxidase (19). These data are consistent with the results in mesangial cells from 12/15-LO null mice (9). Our data that pretreatment of J774A.1 cells with NADPH oxidase inhibitors apocynin and DPI suppressed 12(S)-HETE-induced MCP-1 mRNA expression in J774A.1 cells and apocynin suppressed 12(S)-HETE-induced MCP-1 mRNA and protein expression clearly suggest an involvement of NADPH oxidase in 12(S)-HETE regulation on MCP-1 expression.

We have found in this study that PKC, p38, and oxidative stress were involved in the regulation of 12(S)-HETE-induced MCP-1 expression. There are data showing either a linear signaling cascade or cross talk among some of these signaling cascades. However, we have not pursued the relationship among these signaling cascades in this study.

Because increased reactive oxygen species have been shown to be an important trigger for insulin resistance, type 2 diabetes, and atherosclerosis (13, 6), the results may suggest a possible mechanism of 12/15-LO products in the development of insulin resistance and type 2 diabetes. However, further detailed studies will be needed to test this hypothesis.

Summary

This is the first study that demonstrates that 12/15-LO products regulate for MCP-1 expression in macrophages. MCP-1 plays an important role not only in atherosclerosis but also in the inflammatory state seen in visceral obesity. The results suggest a potentially important mechanism linking 12/15-LO activation to MCP-1 expression and inflammatory cell infiltration.


   GRANTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
This study was supported by National Institutes of Health Grants P01 HL-55798 and RO1 DK-55240.


   ACKNOWLEDGMENTS
 
We thank Starr Palmore for secretarial help and James Fredrick for figure preparation.


   FOOTNOTES
 

Address for reprint requests and other correspondence: L. J. Nadler, 450 Ray C. Hunt Dr., Charlottesville, VA 22908 (e-mail: jln2n{at}virginia.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Cathcard MK, Folcik VA. Lipoxygenase and atherosclerosis: Protection versus pathogenesis. Free Rad Biol Med 28: 1726–1734, 2000.[CrossRef][Web of Science][Medline]
  2. Charo IF, Taubman MB. Chemokines in the pathogenesis of vascular disease. Circ Res 95: 858–866, 2004.[Abstract/Free Full Text]
  3. Dwaralamath RS, Sahar S, Reddy MA, Castanotto D, Rossi JJ, Natarajan R. Regulation of monocyte chemo attractant protein-1 by the oxidized lipid, 12-hydroperoxyoctadecadienic acid, in vascular smooth muscle cells via nuclear factor-kappa B (NF-kB). J Mol Cell Cardiol 36: 585–595, 2004.[CrossRef][Web of Science][Medline]
  4. Giulietti A, Overbergh L, Valckx D, Decallonne B, Bouillon R, Mathieu C. An overview of real-time quantitative PCR: application to quantify cytokine gene expression. Methods 25: 386–401, 2001.[CrossRef][Web of Science][Medline]
  5. Haslinger B, Mandle-Weber S, Sellmayer A, Lederer SR, Sitter T. Effect of high glucose concentration on the synthesis of monocyte-chemoattractant protein-1 in human peritoneal mesothelial cells, Involvement of protein kinase C. Nephron 87: 346–351, 2001.[CrossRef][Web of Science][Medline]
  6. Houstis N, Rosen ED, Lander ES. Reactive oxygen species have a casual role in multiple forms of insulin resistance. Nature 440: 944–948, 2006.[CrossRef][Medline]
  7. Huo Y, Zhao L, Hyman MC, Shashkin P, Harry BL, Burcin T, Forlow SB, Stark MA, Smith DF, Clarke S, Srinivasan S, Hedrick CC, Pratico D, Witztum JL, Nadler JL, Funk CD, Ley K. Critical role of macrophage 12/15-lipoxygenase for antherosclerosis in apolipoprotein E-deficient mice. Circulation 110: 2024–2031, 2004.[Abstract/Free Full Text]
  8. Kaminski KA, Bonda TA, Korecki J, Musial WJ. Oxidative stress and neutrophil activation-the two keystones of ischemia/reperfusion injury. Int J Cardiol 86: 41–59, 2002.[CrossRef][Web of Science][Medline]
  9. Kim YS, Reddy MA, Lanting L, Adler SG, Natarajan R. Differential behavior of mesangial cells derived from 12/15-lipoxygenase knockout mice relative to control mice. Internat Society Nephrol 64: 1702–1714, 2003.
  10. Li SL, Reddy MA, Qiangiun C, Li M, Hang Y, Lanting L, Natarajan R. Enhanced proatherogenic responses in macrophages and vascular smooth muscle cells derived from diabetic db/db mice. Diabetes 55: 2611–2619, 2006.[Abstract/Free Full Text]
  11. Libby P. Inflammation in atherosclerosis. Nature 420: 686–674, 2002.[CrossRef][Medline]
  12. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-{Delta}{Delta}CT method. Methods 25: 402–408, 2001.[CrossRef][Web of Science][Medline]
  13. Meyer ME, Schmitt J. A central role for the endothelial NADPH oxidase in atherosclerosis. FEBS Lett: 472: 1–4, 2000.[CrossRef][Web of Science][Medline]
  14. Natarajan R, Lanting L, Xu L, Nadler JL. Role of specific isoforms of protein kinase C in angiotensin II and lipoxygenase action in rat adrenal glomerulosa cells. Mol Cell Endocrinol 101: 59–66, 1994.[CrossRef][Web of Science][Medline]
  15. Natarajan R, Nadler JL. Lipid inflammatory mediators in diabetic vascular disease. Arterioscler Thromb Vasc Biol 24: 1542–1548, 2004.[Abstract/Free Full Text]
  16. Natarajan R, Reddy MA, Malik KU, Fatima S, Kahn BV. Signaling mechanisms of nuclear factor-kappab-mediated activation of inflammatory genes by 13 hydroperoxyoctadecadienoic acid in cultured vascular smooth muscle cells. Aterioscler Thromb Vasc Biol 21: 1408–1413, 2001.[Abstract/Free Full Text]
  17. Neels JG, Olefsky JM. Inflamed fat: what starts the fire? J Clin Invest 116: 33–35, 2006.[CrossRef][Web of Science][Medline]
  18. Patricia MK, Natarajan R, Dooley AN, Hernandez F, Gu J, Berliner JA, Rossi JJ, Nadler JL, Meidell RS, Hedrick CC. Adenoviral deliver of leukocyte-type 12-lipoxygenase adenoviral delivery of leukocyte-type 12-lipoxygenase ribozyme inhibits effects of glucose and platelet-derived growth factor in vascular endothelial and smooth muscle cells. Circ Res 88: 659–665, 2001.[Abstract/Free Full Text]
  19. Qin F, Patel R, Yan C, Liu W. NADPH oxidase is involved in angiotensin II-induced apoptosis in H9C2 cardiac muscle cells: effects of apocynin. Free Rad Med 40: 236–246, 2006.[CrossRef]
  20. Reape TJ, Groot PHE. Chemokines and atherosclerosis. Atheroscleosis 147: 213–225, 1999.[CrossRef]
  21. Reddy RG, Yoshimoto T, Yamamoto S, Funk CD, Marnett LJ. Expression of pocine leukocyte 12-lipoxygenase in baculovirus/insect cell system and its characterization. Arch Biochem Biophys 312: 219–226, 1994.[CrossRef][Web of Science][Medline]
  22. Reilly KB, Srinivasan S, Hatley ME, Patricia MK, Lannigan J, Bolick DT, Vandenhoff G, Pei H, Natarajan R, Nadler JL, Hedrick CC. 12/15-Lipoxygenase activity mediates inflammatory monocyte/endothelial interactions and atherosclerosis in vivo. J Biol Chem 279: 9440–9450, 2004.[Abstract/Free Full Text]
  23. Roy P, Roy SK, Mirtra A, Kulkarni AP. Superoxide generation by lipoxygenase in the presence of NADH and NADPH. Biochem Biophys Acta 1214: 1171–1179, 1994.
  24. Sakashita T, Takahashi Y, Kinoshita T, Yoshimoto T. Essential involvement of 12-lipoxygenase in regiospecific and stereospecific oxidation of low density lipoprotein by macrophages. Eur J Biochem 265: 825–831, 1999.[Web of Science][Medline]
  25. Sun D, Funk C. Disruption of 12/15-Lipoxygenase expression in peritoneal macrophages. J Biol Chem 271: 24055–24062, 1996.[Abstract/Free Full Text]
  26. Toichi E, Torres G, McCormick TS, Chang T, Mascelli MA, Kauffman CL, Aria N, Gottlieb AB, Everitt DE, Frederick B, Pendley CE, Cooper KD. An anti-IL012p40 antibody down-regulates type 1 cytokines, chemokines, and IL-12/IL-23 in psoriasis. J Immunol 177: 4917–4926, 2006.[Abstract/Free Full Text]
  27. Weisberg SP, Hunter D, Huber R, Lemieux J, Slaymaker S, Vaddi K, Charo I, Leibel R, Ferrante AW. CCR2 modulates inflammatory and metabolic effects of high-fat feeding. J Clin Invest 115: 115–124, 2006.
  28. Wen Y, Gu J, Chakrabarti SK, Aylor K, Marshall J, Takahashi Y, Yoshimoto T, Nadler JL. The role of 12/15-lipoxygenase in the expression of IL-6 and TNF-{alpha} in macrophages. Endocrinology 148: 1313–1322, 2007.[Abstract/Free Full Text]
  29. Wen Y, Gu J, Peng X, Zhang G, Nadler JL. Overexpression of 12-lipoxygenase and cardiac fibroblast hypertrophy. Trends Cardiovasc Med 13: 129–136, 2003.[CrossRef][Web of Science][Medline]
  30. Wen Y, Gu J, Liu Y, Wang PH, Sun Y, Nadler JL. Overexpression of 12-lipoxygenase causes cardiac fibroblast cell growth. Cir Res 88: 70–76, 2001.[Abstract/Free Full Text]
  31. Yla-Herttuala S. Oxidized LDL and atherogenesis. Ann NY Acad Sci 874: 134–137, 1999.[CrossRef][Web of Science][Medline]
  32. Yoshimoto T, Takahashi Arachidonate 12-lipoxygenases Y. Prostaglandins and other lipid Mediators. 68–69: 245–262, 2002.
  33. Zhu H, Takahashi Y, Xu W, Kawajiri H, Murakami T, Yamamoto M, Iseki S, Iwasaki T, Hattori T, Hattori H, Yosjimoto T. Low density lipoprotein receptor-related protein-mediated membrane translocation of 12/15-lipoxygenase is required for oxidation of low density lipoprotein by macrophages. J Biol Chem 278: 13350–13355, 2003.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Nutr.Home page
S. Jiang, Z. Wang, J.-J. Riethoven, Y. Xia, J. Miner, and M. Fromm
Conjugated Linoleic Acid Activates AMP-Activated Protein Kinase and Reduces Adiposity More Effectively When Used with Metformin in Mice
J. Nutr., December 1, 2009; 139(12): 2244 - 2251.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
V. A. Blaho, M. W. Buczynski, C. R. Brown, and E. A. Dennis
Lipidomic Analysis of Dynamic Eicosanoid Responses during the Induction and Resolution of Lyme Arthritis
J. Biol. Chem., August 7, 2009; 284(32): 21599 - 21612.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
Y. Kayama, T. Minamino, H. Toko, M. Sakamoto, I. Shimizu, H. Takahashi, S. Okada, K. Tateno, J. Moriya, M. Yokoyama, et al.
Cardiac 12/15 lipoxygenase-induced inflammation is involved in heart failure
J. Exp. Med., July 6, 2009; 206(7): 1565 - 1574.
[Abstract] [Full Text] [PDF]

Home page
 J. Lipid Res.Home page
M. W. Buczynski, D. S. Dumlao, and E. A. Dennis
Thematic Review Series: Proteomics. An integrated omics analysis of eicosanoid biology
J. Lipid Res., June 1, 2009; 50(6): 1015 - 1038.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
C. S. Nunemaker, M. Chen, H. Pei, S. D. Kimble, S. R. Keller, J. D. Carter, Z. Yang, K. M. Smith, R. Wu, M. H. Bevard, et al.
12-Lipoxygenase-knockout mice are resistant to inflammatory effects of obesity induced by western diet
Am J Physiol Endocrinol Metab, November 1, 2008; 295(5): E1065 - E1075.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
H. Yuan, L. Lanting, Z.-G. Xu, S.-L. Li, P. Swiderski, S. Putta, M. Jonnalagadda, M. Kato, and R. Natarajan
Effects of cholesterol-tagged small interfering RNAs targeting 12/15-lipoxygenase on parameters of diabetic nephropathy in a mouse model of type 1 diabetes
Am J Physiol Renal Physiol, August 1, 2008; 295(2): F605 - F617.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/4/H1933    most recent
00260.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wen, Y.
Right arrow Articles by Nadler, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wen, Y.
Right arrow Articles by Nadler, J. L.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2008 by the American Physiological Society.