|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Diabetes and Hormone Center, University of Virginia, Charlottesville, Virginia
Submitted 2 March 2007 ; accepted in final form 29 January 2008
| ABSTRACT |
|---|
|
|
|---|
12/15-lipoxygenase; monocyte chemoattractant protein-1; J774A.1 cells; mouse peritoneal macrophages
There is supporting evidence that mouse peritoneal macrophages (MPM) and murine macrophage cell lines contain a lipoxygenase (LO) that possesses both 12- and 15-LO activity (12/15-LO) (21, 25). 12/15-LO can hydrolyze arachidonic acid to form predominately 12(S)-hydroperoxy-5Z, -8Z, and -10E, 14Z-eicosatetraenoic acid [12(S)-HPETE], 12(S)-hydroxyeicosatetraenoic acid [12(S)-HETE], and smaller quantities of 15(S)- HPETE. 12(S)-HPETE and 12(S)-HETE have been shown to increase interleukin (IL)-6, tumor necrosis factor-
, IL-1β, and IL-12 mRNA and protein expression in macrophages (28). 12/15-LO can also catalyze stereoselective oxidation of linoleic acid at position 13 over position 9 to preferentially form 13-(S)-hydroperoxyoctadecadienoic acid (13-HPODE), which is the predominant oxidized fatty acid in low-density lipoprotein (LDL). Evidence has shown that 13-HPODE upregulates the expression of MCP-1 in vascular smooth muscle cells (VSMC) (16, 3). There are several differences between 13-HPODE and 12(S)-HPETE. 13-HPODE is esterified to cholesterol as cholesteryl-HPODE in LDL particles, leading to the oxidative modification of LDL (32, 33, 1). In contrast, 12(S)-HETE is not typically taken up in LDL. Oxidation of LDL is believed to contribute to foam cell formation and lipid accumulation in lesions as well as to the formation of necrotic areas in the core of the plaque (31). 12(S)-HETE has been shown to increase monocyte binding to EC (18, 22) and VSMC (10). Because MCP-1 plays a role in the chemotaxis and binding of monocytes with EC or VSMC, it is possible that 12/15-LO products can regulate MCP-1 expression. However, it is unclear whether arachidonic acid metabolites of 12/15-LO participate in the regulation of MCP-1 expression in macrophages.
In this study, we tested the role of 12/15-LO products in the regulation of MCP-1 expression using MPM and the mouse macrophage cell line J774A.1. Our results demonstrate that treatment of MPM or J774A.1 cells with a low concentration of 12(S)-HETE increases MCP-1 mRNA and protein expression, whereas treatment of higher concentrations of 15(S)-HETE increase MCP-1 mRNA expression. We also observed increased MCP-1 expression in MPM from 12/15-LO transgenic (12/15-LO Tg) mice and in J774A.1 cells stably overexpressing 12/15-LO. In addition, reduced MCP-1 expression was observed in MPM from 12/15-LO null mice compared with that in MPM from control mice. These data suggest that the 12/15-LO pathway participates in the regulation of MCP-1 expression in mouse macrophages.
| MATERIALS AND METHODS |
|---|
|
|
|---|
J774A.1 cell culture. J774A.1 cells were cultured following the instructions from ATCC. Plox-86 cells, which stably overexpress 12/15-LO on the J774A.1 cell background, and mock-transfected J774A.1 cells were established and kindly provided by Dr. Yoshimoto in Kanazawa (24). Before treatment with various agonists, cells were cultured in DMEM containing 0.5% FBS and 0.2% BSA (fraction V, fatty acid free) overnight. Cells were then cultured in the depletion medium, which was DMEM with 4 mM L-glutamine adjusted to contain 1.5 g/l sodium bicarbonate and 4.5 g/l glucose, and 0.2% BSA (free of fatty acid) without FBS for 2 h.
MPM isolation and culture. Eight- to ten-week-old male C57BL6 mice, 12/15-LO Tg mice, or 12/15-LO null mice (both on C57BL6 background) were injected intraperitoneally with 2 ml 4% thioglycollate solution. Later (3 days), the ascites of these mice were collected, and MPM were isolated and cultured as described previously (28). MPM were then treated with various agonists in RPMI 1640 medium containing 10% heat-inactivated FBS and penicillin-streptomycin for certain periods of time. In experiments with 12-HETE treatments, MPM were incubated another 2 h in RPMI 1640 medium containing 0.2% BSA and P/S. The animal protocol was approved by the Institutional Animal Safety Committee of the University of Virginia.
RNA extraction, cDNA synthesis, and quantitative real-time PCR.
The details of these procedures were described previously (28). Briefly, total RNA was extracted from cells using the RNeasy kit followed by DNase I treatment according to the manufacturer's protocol (Qiagen). cDNA was synthesized from 1 µg of total RNA using an oligo(dT)15 primer and the SuperScript II reverse transcriptase (Invitrogen, Life Technologies) according to the manufacturer's protocol. For quantitation, a double-stranded DNA dye, SYBR Green I (Molecular Probes, Eugene, OR), was used along with AmpliTaq Gold and 0.1 µM of each primer. All reactions were performed in triplicate in an iCycler iQ Real-Time PCR Detection System (Bio-Rad Laboratory, Hercules, CA). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an endogenous reference to correct for differences in the amount of total RNA added to the reaction and to compensate for different levels of inhibition during reverse transcription of RNA and during PCR. Data are calculated by the 2
method (4, 12) and are presented as the degree of transcript induction, which was normalized to GAPDH of target genes in cells treated with agonists, compared with the transcript induction, which was normalized to GAPDH of the genes in cells treated with vehicle (defined as 1.0-fold in each case).
Primers. The sequences of forward (5' to 3') and reverse (5' to 3') primers used for quantitative real-time PCR analysis of mouse MCP-1 are cttctgggcctgctgttca and ccagcctactcattgggatca. The sequences of mouse leukocyte-type 12/15-LO are ctctcaaggcctgttcagga and gtccattgtccccagaacct (1). The sequences of mouse housekeeping gene (GAPDH) are tcaccaccatggagaaggc and gctaagcagttggtggtgca. Primers were synthesized from Integrated DNA Technologies (Coralville, OA).
MCP-1 protein release measurement using ELISA. Cells were seeded on 24-well plates with each well containing 2 x 105 cells of J774A.1 or MPM in 1 ml medium. After depletion for 24 h, cells were then treated with 12(S)-HETE, or vehicle ethanol, at 37°C for the indicated time in a CO2 incubator. The conditioned medium was collected in a sequential fashion (e.g., 0–16, 16–24, and 24–36 h) with changes of 1 ml fresh medium containing 12(S)-HETE at each time point. The collected culture-conditioned medium was centrifuged to separate floating cells in the medium, and the supernatant was stored at –80°C. MCP-1 protein levels were measured using specific mouse MCP-1 ELISA kits (R & D System) following their instruction.
NADPH oxidase activity measurement. NADPH oxidase-dependent superoxide production was measured by the SOD-inhibitable cytochrome c reduction method described previously (19). J774A.1 cells were treated with vehicle, ethanol, or 12(S)-HETE for different time periods, and then the J774A.1 cells were lysed in lysis buffer. Protein (100 µg) was distributed in 96-well flat-bottom culture plates (final volume 200 µl/well). Cytochrome c (500 µmol/l) and NADPH (100 µmol/l) were added in the presence or absence of SOD (200 U/ml) and incubated at room temperature for 30 min. Cytochrome c reduction was measured by reading absorbance at 550 nm on a microplate reader.
Data analysis.
The results are expressed as means ± SE from three batches of cultured MPM with each batch of MPM from six to eight mice as noted in the legends for Figs. 1![]()
–4. For the J774A.1 cells, results are expressed as means ± SE from three batches of cultured cells. For experiments running at one time period, the control and experimental samples were analyzed using the two-tailed Student's t-test. These comparisons are based on a minimum of three experiments in triplicate per treatment. For multiple time periods of conditions, analysis of variance was used with appropriate corrections.
|
|
|
|
| RESULTS |
|---|
|
|
|---|
1.5-fold (P < 0.01) at 2 h with a further increase in MCP-1 expression to 3.0-fold (P < 0.01) at 4 h of treatment. 12(S)-HETE also increased MCP-1 mRNA expression in MPM isolated from wild-type C57Bl6 mice (Fig. 1B). 12(S)-HETE (0.1 nM) increased MCP-1 mRNA expression 3.9-fold (P < 0.01) at 4 h. 12(S)-HETE (0.1 nM) seemed to be an optimal concentration since increases in MCP-1 mRNA expression were not as prominent when the concentration went up to 1 or 10 nM. In contrast, 12(R)-HETE, an inactive analog of 12(S)-HETE, did not have any effect on MCP-1 mRNA expression (Fig. 1C). 12(S)-HETE also increased MCP-1 protein secretion from J774A.1 cells 1.52 ± 0.2-fold (P < 0.05, n = 3) and
2-fold in MPM (P < 0.01, n = 3). Another 12/15-LO product, 15(S)-HETE, also slightly increased MCP-1 mRNA expression in isolated mouse macrophages. Results showed that 1 nM 15(S)-HETE induced a 1.5 ± 0.10-fold increase in MCP-1 mRNA expression (n = 3, P < 0.03). The mRNA expression was not further increased (1.44 ± 0.34-fold over basal level, n = 3, P < 0.05) when the concentration increased to 10 nM, although the expression was similar to control levels when the 15(S)-HETE concentration declined to 0.1 nM (1.1 ± 0.02-fold over basal, n = 3).
Effects of overexpression or deficiency of 12/15-LO gene on MCP-1 mRNA expression in macrophages.
We next evaluated the MCP-1 mRNA expression in Plox-86 cells, a J774A.1 cell line stably overexpressing porcine leukocyte-type 12/15-LO. Figure 2A shows that MCP-1 mRNA expression in Plox-86 cells was more than threefold (P < 0.01) higher than MCP-1 expression in mock-transfected cells. We then evaluated MCP-1 mRNA expression in macrophages isolated from 12/15-LO Tg mice (Fig. 2B). Macrophages isolated from 12/15-LO Tg mice expressed
2.3-fold higher MCP-1 mRNA expression over that in MPM from wild-type C57BL6 mice. Interestingly, macrophages isolated from 12/15-LO null mice showed a significantly (P < 0.01) reduced MCP-1 mRNA expression (Fig. 2B).
Role of protein kinase C activity in 12(s)-HETE-induced MCP-1 mRNA expression. Our previous data have shown that 12(S)-HETE activates protein kinase C (PKC) activity in J774A.1 cells. To determine whether PKC activity is involved in 12(S)-induced MCP-1 expression, the relatively specific PKC inhibitors calphostin C (100 nM) and GF-109203X (100 nM) were used. Both calphostin C and GF-109203X at 100 nM concentration completely suppressed 12(S)-HETE-induced MCP-1 mRNA expression (Fig. 3).
Role of p38 mitogen-activated protein kinase in 12(S)-HETE-induced MCP-1 mRNA expression. Previous studies have shown that 12(S)-HETE activates p38 mitogen-activated protein kinase (MAPK) activity. To determine whether p38 MAPK activity is important for 12(S)-induced MCP-1 expression, the p38 MAPK inhibitor SB-202190 was used. The results (Fig. 3) show that 3 µM of SB-202190 completely suppressed 12(S)-HETE-induced MCP-1 mRNA expression. The SB-202190 compound did not affect basal MCP-1 mRNA expression.
NADPH oxidase activity is implicated in 12(S)-HETE-induced MCP-1 mRNA expression.
We tested whether 12(S)-HETE activates NADPH oxidase activity by measuring SOD-inhibitable cytochrome c reduction in macrophages. Figure 4A shows that 4 h treatment of 12(S)-HETE (1 nM) significantly increased NADPH oxidase activity
24-fold over that in J774A.1 cells treated with vehicle alone. Figure 4 also shows that pretreatment with 1 mM apocynin completely suppressed 12-HETE-induced NADPH oxidase activity (P < 0.01). Although 1 mM apocynin alone increased basal superoxide release, 12(R)-HETE did not stimulate superoxide release. To determine whether NADPH oxidase-mediated oxidative stress plays a role in 12(S)-HETE-induced MCP-1 mRNA expression, two structurally distinct NADPH oxidase inhibitors, apocynin and DPI, were used. Figure 4B shows that 1 nM 12(S)-HETE increased MCP-1 mRNA expression in J774A.1 cells, and 0.1 mM apocynin significantly suppressed
50% of 12(S)-HETE-induced effects (P < 0.02) without affecting basal MCP-1 expression. When the concentration of apocynin was increased to 1 mM, 12(S)-HETE-induced MCP-1 mRNA expression was fully suppressed, but this drug concentration reduced basal MCP-1 expression (Fig. 4B). We also tested another NADPH oxidase inhibitor (DPI). Figure 4C clearly indicates that 0.1 µM completely inhibited 12(S)-HETE-induced MCP-1 mRNA expression (P = 0.004). These data suggest for the first time that NADPH oxidase is implicated in 12(S)-HETE-induced MCP-1 mRNA expression. We next evaluated the effect of apocynin on 12(S)-HETE-induced MCP-1 protein secretion in MPM. Primary cultured MPM were treated with 12(S)-HETE (1 nM) in the absence or presence of apocynin for 24 h, and the supernatants were collected for analysis of MCP-1 protein. Figure 4D shows that 12(S)-HETE induced MCP-1 protein secretion twofold (P < 0.001) in MPM, and apocynin suppressed 12(S)-HETE-induced MCP-1 protein secretion. Apocynin alone did not affect basal MCP-1 protein secretion.
| DISCUSSION |
|---|
|
|
|---|
These in vitro and in vivo data clearly demonstrate that the 12/15-LO pathway has direct regulatory effects on MCP-1 expression. To our knowledge, this is the first study demonstrating a link of the 12/15-LO pathway to MCP-1 expression in macrophages. In a recent preliminary study, we found that macrophage infiltration in visceral fat is reduced in 12/15 null mice fed a high-fat diet (unpublished observation).
We next conducted studies on possible mechanisms of 12(S)-HETE-induced MCP-1 expression. Previous data have shown that 12-(S)-HETE activates PKC (14) and p38 MAPK (30) in adrenal cells and cardiac fibroblasts stably overexpressing 12/15-LO. It has recently been shown that 12(S)-HETE activates these kinases in J774A.1 macrophage cells (28). To study whether PKC and p38 are important for 12(S)-HETE activation of MCP-1 mRNA expression, two structurally distinct PKC inhibitors, calphostin C (100 nM) and GF-109203X (100 nM), and the accepted p38 inhibitor SB-202190 (3 µM) were used. The data (Fig. 3) showed that the blockade of these two kinases inhibited 12(S)-HETE-induced MCP-1 mRNA expression without affecting basal MCP-1 expression. These results suggest that PKC and p38 are two key mediators of 12(S)-HETE-induced MCP-1 expression. Our results are consistent with previous studies showing a role of PKC and p38 MAPK in regulating MCP-1 expression in other cell types (5, 26). Because the 12/15-LO pathway is involved in IL-12 production in macrophages (28), it is possible that IL-12 participates in 12/15-LO action to increase MCP-1 expression since IL-12p40 can increase MCP-1 expression (29). However, additional studies will be needed to explore this hypothesis.
There is evidence demonstrating that the 12/15-LO pathway induces superoxide generation in the presence of NADP and NADPH, indicating a direct link of 12/15-LO to superoxide generation (2). Evidence also indicates that levels of superoxide were reduced in 12/15-LO KO mouse mesangial cells compared with that in mesangial cells from wild-type mice (9). Therefore, we evaluated whether 12(S)-HETE activates NADPH oxidase activity. Our results demonstrated that 12(S)-HETE activated NADPH oxidase activity in J744A.1 cells; in contrast, 12-HETE did not stimulate NADPH oxidase activity. The 12(S)-HETE-induced increase in NADPH oxidase activity was almost suppressed by pretreatment of 1 mM apocynin, which is a well-characterized inhibitor of NADPH oxidase (19). These data are consistent with the results in mesangial cells from 12/15-LO null mice (9). Our data that pretreatment of J774A.1 cells with NADPH oxidase inhibitors apocynin and DPI suppressed 12(S)-HETE-induced MCP-1 mRNA expression in J774A.1 cells and apocynin suppressed 12(S)-HETE-induced MCP-1 mRNA and protein expression clearly suggest an involvement of NADPH oxidase in 12(S)-HETE regulation on MCP-1 expression.
We have found in this study that PKC, p38, and oxidative stress were involved in the regulation of 12(S)-HETE-induced MCP-1 expression. There are data showing either a linear signaling cascade or cross talk among some of these signaling cascades. However, we have not pursued the relationship among these signaling cascades in this study.
Because increased reactive oxygen species have been shown to be an important trigger for insulin resistance, type 2 diabetes, and atherosclerosis (13, 6), the results may suggest a possible mechanism of 12/15-LO products in the development of insulin resistance and type 2 diabetes. However, further detailed studies will be needed to test this hypothesis.
Summary
This is the first study that demonstrates that 12/15-LO products regulate for MCP-1 expression in macrophages. MCP-1 plays an important role not only in atherosclerosis but also in the inflammatory state seen in visceral obesity. The results suggest a potentially important mechanism linking 12/15-LO activation to MCP-1 expression and inflammatory cell infiltration.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|

CT method. Methods 25: 402–408, 2001.[CrossRef][Web of Science][Medline]
in macrophages. Endocrinology 148: 1313–1322, 2007.This article has been cited by other articles:
![]() |
V. A. Blaho, M. W. Buczynski, C. R. Brown, and E. A. Dennis Lipidomic Analysis of Dynamic Eicosanoid Responses during the Induction and Resolution of Lyme Arthritis J. Biol. Chem., August 7, 2009; 284(32): 21599 - 21612. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kayama, T. Minamino, H. Toko, M. Sakamoto, I. Shimizu, H. Takahashi, S. Okada, K. Tateno, J. Moriya, M. Yokoyama, et al. Cardiac 12/15 lipoxygenase-induced inflammation is involved in heart failure J. Exp. Med., July 6, 2009; 206(7): 1565 - 1574. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. W. Buczynski, D. S. Dumlao, and E. A. Dennis Thematic Review Series: Proteomics. An integrated omics analysis of eicosanoid biology J. Lipid Res., June 1, 2009; 50(6): 1015 - 1038. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Nunemaker, M. Chen, H. Pei, S. D. Kimble, S. R. Keller, J. D. Carter, Z. Yang, K. M. Smith, R. Wu, M. H. Bevard, et al. 12-Lipoxygenase-knockout mice are resistant to inflammatory effects of obesity induced by western diet Am J Physiol Endocrinol Metab, November 1, 2008; 295(5): E1065 - E1075. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yuan, L. Lanting, Z.-G. Xu, S.-L. Li, P. Swiderski, S. Putta, M. Jonnalagadda, M. Kato, and R. Natarajan Effects of cholesterol-tagged small interfering RNAs targeting 12/15-lipoxygenase on parameters of diabetic nephropathy in a mouse model of type 1 diabetes Am J Physiol Renal Physiol, August 1, 2008; 295(2): F605 - F617. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |