AJP - Heart Add DOIs to your references at manuscript stage!
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 294: H2327-H2335, 2008. First published March 28, 2008; doi:10.1152/ajpheart.00993.2007
0363-6135/08 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/5/H2327    most recent
00993.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ding, G.
Right arrow Articles by Wagner, M. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ding, G.
Right arrow Articles by Wagner, M. B.

Dopamine increases L-type calcium current more in newborn than adult rabbit cardiomyocytes via D1 and β2 receptors

Guoliang Ding, Rob F. Wiegerinck, Ming Shen, Anca Cojoc, Carlo M. Zeidenweber, and Mary B. Wagner

Todd Franklin Cardiac Research Laboratory, Department of Pediatrics, Emory University School of Medicine, Atlanta, Georgia

Submitted 28 August 2007 ; accepted in final form 24 March 2008


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Dopamine is used to treat heart failure, particularly after cardiac surgery in infants, but the mechanisms of action are unclear. We investigated differences in the effect of dopamine on L-type calcium current (ICa) between newborn (NB, 1–4 days) and adult (AD, 3–4 mo) rabbit ventricular myocytes. Myocytes were enzymatically dissociated from NB and AD rabbit hearts. ICa was recorded by using the whole cell patch-clamp technique. mRNA levels of cardiac dopamine receptor type 1 (D1), type 2 (D2), and β-adrenergic receptors (β-ARs) were measured by real-time RT-PCR. Dopamine (100 µM) increased ICa more in NB (Emax 87 ± 10%) than in AD ventricular cells (Emax 21 ± 3%). Further investigation of this difference showed that mRNA levels of the D1 receptor were significantly higher in NB, and, with β-AR blockade, dopamine increased ICa more in NB than AD cells. Additionally, SKF-38393 (selective D1 receptor agonist) significantly increased ICa by 55 ± 4% in NB (P < 0.05, n = 4) and by 11 ± 1% in AD (P < 0.05, n = 6). Dopamine in the presence of SCH-23390 (D1 receptor antagonist) increased ICa in NB cells by 67 ± 5% and by 22 ± 2% in AD cells, suggesting a role for β-AR stimulation. Selective blockade of β1- or β2-receptors (with block of D1 receptors) showed that the β-AR action of dopamine in the NB was largely mediated via β2-AR activation. Dopamine produces a larger increase in ICa in NB cardiomyocytes compared with ADs. The mechanism of action is not only through β2-ARs but also due to higher expression of cardiac D1 receptor in NB.

development; β-adrenergic receptors; ventricle


DOPAMINE IS WIDELY USED TO treat heart failure, particularly after cardiac surgery in infants (3, 25, 48). It is thought that dopamine acts directly on the heart via β-adrenergic receptors (β-ARs) and indirectly due to effects on the vasculature via dopamine and {alpha}-adrenergic receptors (4, 10, 25, 34, 42). A large body of evidence has demonstrated that the expression and function of β-ARs in heart is age dependent (1, 18, 50). Furthermore, there are developmental changes in β-AR modulation of the L-type calcium current (ICa) in newborn (NB) and adult (AD) rabbit ventricular cells, with isoproterenol producing a greater increase in ICa in AD than in NB cells (38). Although there have been several studies on the effect of dopamine on ICa in AD cardiomyocytes, there are no studies in NB cardiomyocytes. Habuchi et al. (20) reported no effect of low concentrations of dopamine on ICa in cardiomyocytes of AD rat and rabbit heart. Zhao et al. (54) reported that dopamine increased ICa via β-ARs in rat single atrial myocytes at low concentration and in ventricular myocytes at higher concentrations (20–100 µM). However, there are no reports that examine which β-AR subtypes are involved in the increase of ICa in cardiomyocytes, particularly in NB cardiomyocytes.

Furthermore, it is not known if dopamine receptor type 1 (D1) and type 2 (D2) are involved in the mediation of the dopamine effect on ICa in cardiac tissue. Molecular techniques have revealed that D1 and D2 receptors are present in rat heart tissue, human atrium and human ventricle (40, 41). Other studies have shown that activation of D1 receptors leads to variable changes in ICa in different types of neurons (2, 53). It is unknown whether there is a developmental difference in the expression and action of dopamine receptors in cardiomyocytes.

Dopamine is frequently used for inotropic support in the postoperative period following surgery for congenital heart defects, but it is unclear whether the effectiveness of dopamine is due to direct effects on the myocardium. In this study we show that dopamine increases ICa more in NB compared with AD rabbit ventricular myocytes, and we examine which receptor subtypes are responsible for this developmental difference in the action of dopamine. Furthermore, we measured mRNA levels of D1 and D2 receptors in NB compared with AD cardiomyocytes and the effect of dopamine on ICa mediated by specific D1 and D2 receptor activation. We also compared the contribution of β1-ARs, β2-ARs, and D1 receptors to the increase of ICa by dopamine in NB and AD cardiomyocytes by using specific receptor blockers.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Cell preparation. New Zealand White AD (3- to 4-mo-old) and NB (1- to 4-day-old) rabbits of either sex were used in the experiments. Experimental procedures were conducted in compliance with the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health and approved by the Emory University Institutional Animal Care and Use Committee. Single ventricular cells were obtained from AD and NB hearts by enzymatic dissociation as we previously described (37). In brief, AD rabbits were heparinized (500 IU/kg iv) and anesthetized with pentobarbital sodium (50 mg/kg iv). For NB rabbits, the same drugs were given intraperitoneally. The heart was rapidly removed via thoracotomy, and the aorta was cannulated. The dissected heart was mounted on a Langendorff apparatus and was perfused with oxygenated, Ca2+-free solution for 5 min at 36–37°C, followed by the same solution containing 0.28 mg/ml collagenase (type I; Worthington Biochemical) and 0.03 mg/ml protease (type XIV; Sigma) for AD and 0.25 mg/ml collagenase (Yakult Honshu) and 0.05 mg/ml protease (type XIV; Sigma) for NB. The ventricle was cut into small pieces and triturated in Kraft-Brühe (KB) solution, and the suspension of isolated ventricular cells was stored at 4°C until use (within 8 h of dissociation). For transcript analysis, cells in KB solution were allowed to settle by gravity, the supernatant was replaced with fresh KB solution, and the cells were allowed to settle again (15). The cell pellet was used for real-time RT-PCR.

Whole cell voltage-clamp recording. Experiments were carried out at room temperature (21–23°C). Voltage-clamp experiments were performed in the whole cell configuration with an Axopatch 200B patch-clamp amplifier (Axon Instruments, Molecular Devices) as previously described (47, 49). Briefly, pipette resistance was 1.0–2.0 M{Omega} for AD cardiomyocytes and 3.5–4.5 M{Omega} for NB cardiomyocytes. The liquid junction potential between the pipette and the bath solutions was corrected just before the seal formation. A tight seal (3–5 G{Omega}) was established in test solution, and ICa was measured 5–8 min after the membrane was broken, when the recording was stable. ICa was elicited by depolarizing every 10 s from a holding potential of –45 mV to a test potential of +10 mV for 360 ms. To obtain current-voltage relations, a series of test steps of 360-ms duration was applied with 10-mV increments (–40 to +60 mV) from a holding potential of –45 mV. In our experimental conditions, K+ currents were eliminated with Cs+ and tetraethyl ammonium chloride in the pipette and Cs+ in the external test solution. Sodium current was inactivated by using a holding potential of –45 mV.

Solutions and drugs. Ca2+-free solution for AD rabbit dissociation contained (in mM) 126 NaCl, 4.5 KCl, 5 MgCl2, 1 NaH2PO4, 23 HEPES, 21 glucose, 5 Na-pyruvate, 5 creatine, and 60 taurine, pH 7.4 with NaOH. Ca2+-free solution for NB rabbit dissociation contained (in mM) 100 NaCl, 10 KCl, 1.2 KH2PO4, 5 MgSO4, 50 taurine, 20 glucose, and 10 HEPES, pH 7.2 with NaOH. KB solution for cell storage contained (in mM) 140 potassium glutamate, 5 MgCl2, 1 EGTA, 10 glucose, and 10 HEPES, pH 7.4 with KOH. Test solution for recording ICa contained (in mM) 130 NaCl, 1.8 CaCl2, 20 CsCl2, 0.53 MgCl2, 5 HEPES, and 5 glucose, pH 7.4 with NaOH. Pipette solution for recording ICa contained (in mM) 110 CsOH, 90 aspartic acid, 20 CsCl, 10 tetraethylammonium chloride, 5 HEPES, 10 EGTA, 5 MgATP, 5 Na2-creatine phosphate, 0.4 GTP(Tris), and 0.1 leupeptin, pH 7.4 with CsOH. Dopamine, propranolol, SCH-23390 hydrochloride (SCH), SKF-38393 hydrochloride (SKF), R(–)-2,10,11-trihydroxy-N-propyl-noraporphine hydrobromide (TNPA), CGP-20712A methanesulfonate salt (CGP), and ICI-118551 hydrochloride (ICI) (Sigma-Aldrich) were dissolved in water to make fresh stock solutions each day.

Transcript analyses. Total RNA was extracted from AD and NB ventricular cell pellets by using the RNA isolation kit RNeasy (Qiagen) and were reverse transcribed by using a SuperScript III First-Strand Synthesis kit with random hexamers (Invitrogen) according to the manufacturer's instructions. The quality of each RNA sample was confirmed by an Agilent 2100 bioanalyzer. The mRNA levels were measured by real-time RT-PCR (ABI 7500 PCR system). Specific primers were designed for each gene of interest on the basis of GenBank data and were followed by standard PCR reaction chemistry with the addition of the fluorescent DNA-binding dye, SYBR Green I (ABI). Forward and reverse primers for amplification were ATCTCTTGGTGGCTGTCTTGG and TACCTGTCCACGCTGATCACA for D1 receptor, TCAGATGCTTGCCATTGTTC and AACTCGATGTTGAAGGTGGTG for D2 receptor, AATGTGCTGGTGATCGTGG and AAGAAGGAGCCGTACTCCCA for β1-AR, and TCTTCACGAACCAAGCCTATG and ATCCTGCTCCACCTGGCTAA for β2-AR. The level of the 18S rRNA was determined by using the forward primer GGTGAAATTCTTGGACCGGC and reverse primer GACTTTGGTTTCCCGGAAGC. Product sizes for each primer pair were confirmed by gel electrophoresis. Real-time RT-PCR results for D1 receptor, D2 receptor, β1-AR, and β2-AR mRNA were normalized to results of 18S rRNA. Many studies have validated by using 18S rRNA for loading control under a number of experimental conditions (6, 26, 32, 43). To compare how the mRNA levels of each gene changed with developmental age, results were normalized to the mean value from AD. Samples in duplicate were used.

Determination of D1 receptor protein levels by Western blot. Protein preparation and Western blot analysis were performed as we previously described (31, 47). Briefly, on removal of the heart, ventricular tissue was separated and immediately frozen in liquid nitrogen. Frozen tissue was homogenized in lysis buffer [20 mM Tris·HCl, 1 mM EDTA pH 7.4, protease Inhibitor Cocktail (Roche Applied Science)]. The supernatant, after low-speed centrifugation (2 x 10 min, 1,000 g), was then centrifuged at 100,000 g for 10 min to obtain membrane proteins. Protein concentration was measured by using the Bio-Rad protein assay, based on the method of Bradford (7).

Membrane proteins (30 µg) were separated on a 12% SDS gel. Proteins from five NB and five AD rabbit hearts were loaded in alternating lanes. To determine levels of D1 receptor proteins, blots were incubated with rat monoclonal anti-D1 antibody (dilution 1:1,000; Sigma-Aldrich) overnight at 4°C, followed by a secondary antibody (goat anti-rat IgG-horseradish peroxidase, dilution 1:5,000; Santa Cruz Biotechnology) and detection by an enhanced chemiluminescence assay (Pierce ECL Western Blotting Substrate; Thermo Scientific). After exposure to X-ray film, the bands were quantified by densitometry with ImageJ (NIH, Bethesda, MD). The blot was stripped by using Restore Western Blot Stripping buffer (Thermo Scientific) and then incubated with mouse anti-GAPDH (IgG, dilution 1:150; Chemicon International) for 3 h at room temperature followed by incubation with a secondary antibody (goat anti-mouse IgG-horseradish peroxidase; Santa Cruz Biotechnology).

Statistical analysis. Statistical significance was determined by Student's t-test for paired or unpaired data. Values of P < 0.05 were regarded as significant. Data are presented as means ± SE.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Greater effect of dopamine on ICa in NB compared with AD ventricular myocytes. To determine whether there was an age-dependent difference in the effect of dopamine on ICa, we tested the effect of increasing concentrations of dopamine on ICa recorded from AD and NB rabbit ventricular cells. Examples of the time course of the current amplitude (Fig. 1, A and B, top) and current traces in control and in response to 100 µM dopamine (Fig. 1, A and B, bottom) are shown in Fig. 1 for AD (A) and for NB (B) cells. The mean basal current for the AD was 6.0 ± 0.5 pA/pF, which increased to 7.0 ± 0.7 pA/pF (n = 7, P < 0.05) with dopamine (100 µM). Under the same conditions, the basal current was 2.6 ± 0.2 pA/pF in the NB, which nearly doubled with dopamine to 4.9 ± 0.4 pA/pF (n = 6, P < 0.05). The larger basal current in the AD is consistent with our previous studies (35, 39). The concentration-dependent effects of dopamine are summarized in Fig. 1C as dose-response curves for AD and NB rabbit ventricular cells. The maximal effect of dopamine (Emax) and the concentration required for half-maximal stimulation (EC50) were 21 ± 3% and 44 ± 6 µM, respectively, for AD cells and 87 ± 10% and 26 ± 7 µM, respectively, for NB cells. Dopamine was significantly more effective in NB cells for concentrations >10 µM. We examined the current-voltage relationships for AD cells (n = 7) and NB cells (n = 6) before treatment (control) and after treatment with 100 µM dopamine, and these results are shown in Fig. 1D. The voltage dependence of ICa was not changed by the application of dopamine for either the AD or NB cells.


Figure 1
View larger version (23K):
[in this window]
[in a new window]

 
Fig. 1. Dopamine is more effective in increasing L-type calcium current (ICa) in newborn (NB) compared with adult (AD) rabbit ventricular cells. ICa was elicited by depolarizing voltage steps from a holding potential of –45 mV to a test potential of +10 mV every 10 s in AD (A, capacitance 61 pF) and NB (B, capacitance 20 pF) ventricular cells. A and B, top: time course of current density in control solution and after application of 100 µM dopamine. A and B, bottom: example of current measured in control (thick line) and in presence of dopamine. C: dose-response curves of effect of dopamine on ICa for AD ({blacksquare}) and NB ({blacktriangleup}) rabbit ventricular cells. Number of cells used for each dose is indicated near symbol. For each dose, cells are from 3–5 rabbits, with exception of 50 µM dose for NB, where 2 rabbits were used. *P < 0.05 for NB vs. AD. D: current-voltage relations for AD cells (n = 7, 5 rabbits, {square} and {blacksquare}, solid line) and NB cells (n = 6, 4 rabbits, {triangleup} and {blacktriangleup}, dashed line) before treatment (control, open symbols) and after treatment (100 µM dopamine, closed symbols). *P < 0.05 for dopamine vs. control.

 
Determination of mRNA levels of D1, D2, β1-, and β2-receptors in NB and AD myocytes and protein levels of D1 receptors. The direct effects of dopamine on the myocardium are thought to be mediated through β-ARs, although dopamine receptors have been shown to be present in cardiac tissue (40, 41). To begin to determine whether the differential effect of dopamine on ICa in AD and NB cells is due to activation of different receptor subtypes, we measured the relative expression of D1 receptor, D2 receptor, β1-AR, and β2-AR mRNA in AD and NB ventricular cells (Fig. 2A). Results are normalized to the mean determined from AD cells for ease of comparison. The level of D1 receptor mRNA is sevenfold larger in the NB rabbit myocytes compared with the AD (n = 8 rabbits for each age; P < 0.05), whereas the level of the D2 receptor is smaller in the NB compared with the AD (n = 8 rabbits for each age; P < 0.05). The β1- and β2-AR mRNA also show age-dependent changes, with the NB cells having less β1-AR mRNA and more β2-AR mRNA than the AD cells (n = 8 rabbits for each age; P < 0.05).


Figure 2
View larger version (33K):
[in this window]
[in a new window]

 
Fig. 2. Developmental changes in levels of dopamine type 1 and type 2 receptors (D1 and D2) and β1- and β2-adrenergic receptors (β1-AR and β2-AR). A: mRNA levels measured by real-time RT-PCR, normalized to 18S rRNA, and expressed compared with mean level in AD. D1 receptor and β2-AR mRNA levels were upregulated in NB ventricular myocytes (n = 8 rabbits, gray bars) compared with AD ventricular myocytes (n = 8 rabbits, open bars), whereas D2 and β1-AR levels were downregulated in NB. B: Western blot probed with D1 receptor antibody (top) and GAPDH antibody (bottom) for NB and AD ventricular homogenates (alternating lanes, n = 5 rabbits for each age). Right: densitometric analysis of D1 receptor protein normalized to GAPDH showing much lower levels in AD vs. NB. *P < 0.05.

 
We confirmed that the mRNA levels of the D1 receptor corresponded to a change in the protein levels by Western blot analysis. Figure 2B shows a section of a blot of protein from ventricular tissue from NB and AD rabbits in alternating lanes, probed for D1 receptor and GAPDH. D1 receptor protein level for AD (n = 5 hearts) and NB (n = 5 hearts) was normalized to GAPDH. Note that the protein levels for D1 receptor are 6.7-fold higher in the NB compared with the AD, consistent with the mRNA levels of the D1 receptor.

Greater increase in ICa in NB than in AD myocytes via D1 receptor activation. The higher level of D1 receptor mRNA and protein in NB compared with AD suggests that the greater response to dopamine in the NB may be through D1 receptor activation. Thus we compared the effects of 1 µM SKF, a potent D1 receptor agonist, on ICa from NB compared with AD ventricular cells (Fig. 3). Examples of the time course of current amplitude (Fig. 3, A and B, top) and current traces (Fig. 3, A and B, bottom) are shown for an AD (Fig. 3A) and NB (Fig. 3B) cell. The effect of SKF was greater in the NB cell. In Fig, 3C, mean current density in control and SKF for AD and NB are shown. There is a significant positive effect of SKF in both AD and NB cells, but note that the percent increase of ICa by SKF is significantly larger in NB cells than in AD cells (Fig. 3D).


Figure 3
View larger version (31K):
[in this window]
[in a new window]

 
Fig. 3. D1 agonist SKF-38393 (SKF) was more effective in NB ventricular myocytes. Representative time course of current density (A and B, top) and example traces of ICa (A and B, bottom) are shown for AD (A, capacitance 80 pF) and NB (B, capacitance 29 pF) in absence (control) and presence of 1 µM SKF. C: average ICa density for AD and NB in control (open bars) and SKF (gray bars). D: percent increase in ICa in response to SKF in AD (n = 6 cells, 3 rabbits) and NB (n = 4 cells, 3 rabbits) ventricular cells. *P < 0.05.

 
An alternate method to examine the role of D1 receptors is to apply dopamine in the presence of β1- and β2-AR blockade. These results are shown in Fig. 4. When we pretreated the cells with 1 µM propranolol (β-AR blockade), the effect of dopamine was nearly abolished in the AD (Fig. 4, A and C, no significant increase), whereas a small but significant effect was still present in the NB cells (Fig. 4, B and C). The percent increase in ICa in NB cells with dopamine in the presence of β-AR blockade was significantly larger than the increase in the AD cells as shown in Fig. 4D. To exclude the possibility that dopamine is acting through D2 receptors, we examined the effects of a specific D2 agonist (TNPA, 1 µM) on ICa in NB and AD cells. TNPA did not alter ICa in either NB (–4 ± 2%, n = 7) or AD (3 ± 2%, n = 7) cells.


Figure 4
View larger version (28K):
[in this window]
[in a new window]

 
Fig. 4. Effect of dopamine on ICa in presence of β-AR blockade with propranolol. A: representative trace of ICa in an AD ventricular cell (capacitance 91 pF) with 1 µM propranolol and with propranolol plus 100 µM dopamine. B: representative trace of ICa in a NB ventricular cell (capacitance 24 pF) with 1 µM propranolol and with propranolol plus 100 µM dopamine. C: average ICa density for AD and NB in propranolol (open bars) and propranolol plus dopamine (gray bars). D: percent increase in ICa in response to dopamine in presence of propranolol in AD (n = 6 cells, 2 rabbits) and NB (n = 7 cells, 2 rabbits) ventricular cells. *P < 0.05. Note that propranolol blocks effect of dopamine on ICa in AD cells, but there is still a small effect of dopamine on ICa in NB cells.

 
Effect of dopamine on ICa other than via D1 activation. To determine whether blockade of the D1 receptor altered the effect of dopamine in NB and AD cells, we applied dopamine after pretreatment with 10 µM SCH (a selective D1 receptor antagonist), and these results are shown in Fig. 5. Figure 5A is a representative trace from an AD cell, and Fig. 5B is a representative trace from a NB cell. Figure 5C is a summary of the results, which shows the mean effects on AD and NB cells of dopamine applied after pretreatment with SCH, with a small, significantly positive effect on AD cells (from 4.9 ± 0.2 pA/pF to 5.9 ± 0.1 pA/pF, n = 7, P < 0.05) and a larger, significantly positive effect for NB cells (from 2.4 ± 0.3 pA/pF to 3.9 ± 0.6 pA/pF, n = 6, P < 0.05). Figure 5D shows the relative effect on AD vs. NB cells of dopamine after pretreatment with SCH, with a significantly larger effect on NB cells (67 ± 5% increase). In the NB, the effect of dopamine in the presence of D1 receptor blockade is smaller but not significantly different (P = 0.086) from the percent increase due to 100 µM dopamine alone (87%, Fig. 1C). These results suggest that the effectiveness of dopamine in the NB is not solely due to the greater amount of D1 receptor and that this differential effect is partially mediated through β-AR activation.


Figure 5
View larger version (27K):
[in this window]
[in a new window]

 
Fig. 5. Effect of dopamine on ICa after treatment with D1 receptor antagonist SCH-23390 (SCH). A: representative trace of ICa in an AD ventricular cell (capacitance 51 pF) with 10 µM SCH and with SCH plus 100 µM dopamine. B: representative trace of ICa in a NB ventricular cell (capacitance 20 pF) with 10 µM SCH and with SCH plus 100 µM dopamine. C: average ICa density for AD and NB in SCH (open bars) and SCH plus dopamine (gray bars). D: percent increase in ICa in response to dopamine in presence of SCH in AD (n = 7 cells, 3 rabbits) and NB (n = 6 cells, 2 rabbits) ventricular cells. *P < 0.05. Blockade of D1 receptors does not change response to dopamine in AD cells, and response in NB cells is still significantly larger than response in AD cells.

 
Greater increase of ICa in NB vs. AD myocytes is due to β2-AR activation. To determine whether the differential action of dopamine via β-ARs contributes to the greater effect of dopamine in the NB, we applied dopamine while blocking combinations of β1-ARs (blocked by 300 nM CGP), β2-ARs (blocked by 50 nM ICI), and D1 (blocked by 10 µM SCH). Figure 6 summarizes the results for AD and NB cells with combinations of these receptor blockers. Figure 6A shows the values of ICa obtained before and after application of 100 µM dopamine, and Figure 6B shows the percent increase in ICa under the same conditions. The left-most group shows the results for application of 100 µM dopamine while blocking β1 and D1 receptors (with CGP and SCH). Under these conditions, dopamine increases ICa significantly for both the AD and NB cells, but the increase was much larger in the NB. In the middle group we blocked β2 and D1 receptors (with ICI and SCH). Dopamine increased ICa significantly in both the AD and the NB, and the percent increase was ~20% and not different between the two ages. To confirm that the action of dopamine was via β-ARs and D1 receptors and to further exclude activation of D2 receptors, we blocked β1, β2, and D1 receptors with 1 µM propranolol and 10 µM SCH. There was no increase in ICa in response to dopamine in either the AD or NB cells (far right group in Fig. 6). In summary, the greatest effect of dopamine was in the NB via β2-receptor activation (56 ± 8% increase). This was significantly smaller than the effect of dopamine alone (87%, P = 0.026, Fig. 1C).


Figure 6
View larger version (46K):
[in this window]
[in a new window]

 
Fig. 6. Effects of 100 µM dopamine in the presence of combinations of specific blockers of β1- and β2-ARs and D1 receptors. ICa was elicited by depolarizing voltage steps from a holding potential of –45 mV to a test potential of +10 mV every 10 s in AD and NB ventricular cells. Bars indicate average ICa (A) and percent increase of ICa (B) in AD and NB ventricular cells in absence (solid) and presence (hashed) of 100 µM dopamine after treatment with combinations of 300 nM CGP-20712A (CGP, β1-AR blockade), 50 nM ICI-118551 (ICI, β2-AR blockade), 1 µM propranolol (PRO, β1- and β2-AR blockade), and 10 µM SCH (D1 blockade). For SCH+CGP: NB, n = 7 cells, 3 rabbits and AD, n = 5 cells, 2 rabbits. For SCH+ICI: NB, n = 7 cells, 3 rabbits and AD, n = 5 cells, 2 rabbits. For SCH+PRO: NB, n = 3 cells, 2 rabbits and AD, n = 6 cells, 2 rabbits. *P < 0.05. Dopamine action via β2-ARs was significantly larger in NB compared with AD.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
In this study, we show for the first time that dopamine is more effective in increasing ICa in NB rabbit ventricular myocytes compared with AD myocytes. Using specific receptor agonists and antagonists, we show that the greater effectiveness of dopamine in the NB is due in part to activation of D1 receptors and also due to activation of β-ARs, in particular β2-ARs. These findings correlate with higher D1 receptor and β2-AR mRNA levels and higher D1 receptor protein levels in NB compared with AD.

The myocardial effects of dopamine are primarily thought to occur via β-AR stimulation (34, 46). In isolated adult rat ventricular myocytes, Zhao et al. (54) showed that dopamine increased ICa and that this effect was blocked by propranolol, suggesting that the effect of dopamine was mediated by β-ARs. These results are similar to what we have now shown in AD rabbit ventricular myocytes (Fig. 4). In contrast, we show that propranolol does not completely block the effect of dopamine in NB rabbit ventricular cells, suggesting that there is an additional mode of action for dopamine in the NB, possibly through dopamine receptors. The presence of D1 and D2 receptors has been reported in rat and human cardiac tissue (36, 40, 44). Competitive PCR analysis showed that the D1A receptor mRNA level was significantly higher at 4 wk than at 8 and 20 wk of age in rat ventricular tissue (28). Similar studies in the newborn have not been shown. Thus we examined the mRNA levels of D1 and D2 receptors and found that NB rabbit ventricle had higher levels of D1 receptor mRNA and protein and lower levels of D2 receptor mRNA than AD (see Fig. 2). Furthermore, functional greater expression of D1 receptors in NB was demonstrated by specific stimulation with SKF, which increased ICa more in NB compared with AD cells. Activation of D2 receptors (TNPA) produced no significant change of ICa in either NB or AD cells.

Specific activation of D1 receptors in NB increased ICa by 55% but had a small effect on AD cells. This may suggest that most of the 87% increase in ICa by dopamine in NB cells (Fig. 1) can be accounted for by direct stimulation of D1 receptors. However, when we pretreated the cells with propranolol (to block β1- and β2-ARs) followed by the application of dopamine to determine the D1 receptor contribution, we found an increase of only 18% in ICa. This may be attributed to the lower binding affinity to the D1 receptor for dopamine than for SKF, as was shown in sheep ventromedial hypothalamic nucleus (13). In addition, when we blocked D1 receptors with SCH, the amount of increase of ICa in NB cells with dopamine was 67%. Together these results suggested a more prominent role of β-receptor activation in the effects of dopamine on ICa in NB cells.

To explore the role of subtypes of β-ARs, we showed significantly less β1-AR mRNA and significantly more β2-AR mRNA for NB cells compared with AD cells. The expression and function of β-ARs have been shown to change with age (12, 50). The number of β-ARs (density) in the heart increases during development from fetal level to the neonatal/young level and then decreases to AD level in different species of animals [rat (22), mouse (11), dog (45), and rabbit (17)]. Effects of the activation of both β1-ARs and β2-ARs were progressively decreased in ventricular myocytes of 2-, 8-, and 24-mo-old rat myocytes (50). Kuznetsov et al. (24) showed that the percent of β2-ARs in freshly dissociated adult rat ventricular cells was not different from cultured neonatal rat cells, although it has been shown that culture alters β-ARs expression (27). To our knowledge, it has not been definitively shown that the ratio of β1- to β2-ARs does not change with age when acutely isolated ventricular cells from NB and AD rabbit heart are used. In the AD rabbit, the percentage of β1-ARs in ventricle has been reported as 92% (8), 85.5% (19), and 77% (29). In this study, we have shown higher levels of β2-AR mRNA in NB vs. AD rabbit ventricular cells. Further experiments on β-AR protein subtype expression in the developing rabbit heart are required.

Because dopamine is thought to act via β-ARs in the heart (34, 46), our results showing that dopamine is more effective in NB than in AD is paradoxical in light of studies showing that isoproterenol (a strong β-AR agonist) increases ICa to a larger degree in AD rabbit ventricular cells compared with NB cells (38). In adult human ventricle, dopamine was less effective than isoproterenol and norepinephrine in augmenting the contraction (9). Furthermore, in human adult atria, Deighton et al. (14) showed that the effect of dopamine was less than that of isoproterenol and that dopamine acted primarily via β1-ARs. In the present study, we show that in the AD rabbit, the effect of dopamine on ICa is smaller than that of isoproterenol and that dopamine acts primarily via β1-ARs. In contrast, in the NB rabbit, we show that dopamine acts via β1- and β2-ARs as well as D1 receptors and that dopamine is more effective than in the AD. Furthermore, dopamine is slightly less effective at increasing ICa (87%) in the NB compared with the effect of isoproterenol (111%) (38). Although dopamine and isoproterenol are both β-AR agonists, isoproterenol is a full β2-AR agonist, whereas dopamine is a partial β2-AR agonist (51).

In this study, we have demonstrated that the difference between the effect of dopamine in NB and AD rabbits is due to a greater effect of dopamine via β2-AR and D1 receptors in the NB compared with the AD. In other cell systems, dopamine has been shown to act via β-ARs. Dopamine acts via β1- and β2-ARs (each partially) in astroglial cells (16) and via D1 receptors as well as β1- and β2-ARs in glioma cells (30). Differential effects of β1- vs. β2 -AR activation have also been shown to vary with developmental age. Kuznetsov et al. (24) found that zinterol (specific agonist of β2-ARs) evoked a substantial increase in cAMP accumulation in rat neonatal cardiomyocytes but only a minor increase in AD cardiomyocytes. In addition, they showed that β2-receptor activation contributed to the positive inotropic response, increasing the amplitude and hastening the kinetics of the twitch in NB but not AD myocytes, and that activation of β2-AR receptors produced a greater increase in ICa in NB compared with AD myocytes. Furthermore, Molenaar et al. (33) showed that both β1- and β2-AR agonists were equally effective in increasing the contraction in infant human ventricle. Our results that dopamine acts in part via β2-AR stimulation are consistent with recent work from Collis et al. (12) that shows that β2-AR stimulation is much more effective in increasing ICa in the NB rabbit ventricular cells compared with AD. Furthermore, they showed that the effect of isoproterenol on ICa in the AD was due to stimulation of β1-ARs only, whereas the isoproterenol effect in the NB was due to stimulation of both β1- and β2-ARs. Recently, Huang et al. (21) has shown a switch in splice variants of the {alpha}1C-subunit of the calcium channel from the IVS3A to the IVS3B variant with development in the rabbit. We have confirmed these studies by RT-PCR in our laboratory (data not shown). They speculate that the different splice variants may determine the localization of the calcium channels because the IVS section of the {alpha}1C-subunit has a possible caveolin binding site. Bajelipelli et al. (5) recently showed that β2-ARs colocalize with caveolin-3, Cav1.2, and Gs and that disruption of caveoli abolishes the stimulatory effect of a β2-AR agonist on ICa. Furthermore, the D1 receptor has been shown to localize with caveolin-1 in brain (23) and caveolin-2 in kidney (52); thus it may localize with caveolin-3 in heart. It is possible that the different splice variants of the {alpha}1C-channel may help localize the receptors 2-ARs or D1 receptors) with the calcium channel and thus result in a greater effect via β2-ARs or D1 receptors in the NB.

We have shown that dopamine is more effective in increasing ICa in isolated rabbit NB cardiomyocytes compared with AD myocytes. Furthermore, we have shown that the greater effect of dopamine in the NB is due to activation of both D1 receptors and β2-ARs. Dopamine and specific stimulation of D1 receptors by SKF both caused a larger increase in ICa in NB compared with AD cells, but SKF produced a larger effect compared with dopamine acting via the D1 receptors (by blocking β-ARs). This study also suggests that the β-AR action of dopamine in NB cells is substantially mediated by activation of β2-ARs. Together, these results suggest that specific activation of D1 receptors and of β2-ARs may be more effective in increasing inotropy in the NB compared with the AD and thus may be useful therapeutic targets for the pediatric cardiac patient.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by National Heart, Lung, and Blood Institute Grant HL-077485, American Heart Association (AHA) Southeast Affiliate Grant in Aid 0755537B, AHA Southeast Affiliate Postdoctoral Fellowship (0725571B, R. F. Wiegerinck), and by financial support from Children's Healthcare of Atlanta.


    FOOTNOTES
 

Address for reprint requests and other correspondence: M. B. Wagner, Dept. of Pediatrics, Emory Univ. School of Medicine, 2015 Uppergate Drive, 336, Atlanta, GA 30322 (e-mail: mary.wagner{at}emory.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Abrass IB, Davis JL, Scarpace PJ. Isoproterenol responsiveness and myocardial beta-adrenergic receptors in young and old rats. J Gerontol 37: 156–160, 1982.[Abstract/Free Full Text]
  2. Aguayo LG, Grossie J. Dopamine inhibits a sustained calcium current through activation of alpha adrenergic receptors and a GTP-binding protein in adult rat sympathetic neurons. J Pharmacol Exp Ther 269: 503–508, 1994.[Abstract/Free Full Text]
  3. Ando M, Takahashi Y, Suzuki N. Open heart surgery for small children without homologous blood transfusion by using remote pump head system. Ann Thorac Surg 78: 1717–1722, 2004.[Abstract/Free Full Text]
  4. Artman M, Mahony L, Teitel DF. Cardiovascular drug therapy. In: Neonatal Cardiology. New York: McGraw-Hill, 2002, p. 209–230.
  5. Balijepalli RC, Foell JD, Hall DD, Hell JW, Kamp TJ. Localization of cardiac L-type Ca(2+) channels to a caveolar macromolecular signaling complex is required for beta(2)-adrenergic regulation. Proc Natl Acad Sci USA 103: 7500–7505, 2006.[Abstract/Free Full Text]
  6. Bas A, Forsberg G, Hammarstrom S, Hammarstrom ML. Utility of the housekeeping genes 18S rRNA, beta-actin and glyceraldehyde-3-phosphate-dehydrogenase for normalization in real-time quantitative reverse transcriptase-polymerase chain reaction analysis of gene expression in human T lymphocytes. Scand J Immunol 59: 566–573, 2004.[CrossRef][Web of Science][Medline]
  7. Bradford M. A rapid and sensitive method for quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248–254, 1976.[CrossRef][Web of Science][Medline]
  8. Brodde OE, Leifert FJ, Krehl HJ. Coexistence of beta 1- and beta 2-adrenoceptors in the rabbit heart: quantitative analysis of the regional distribution by (–)-3H-dihydroalprenolol binding. J Cardiovasc Pharmacol 4: 34–43, 1982.[Web of Science][Medline]
  9. Brodde OE, Vogelsang M, Broede A, Michel-Reher M, Beisenbusch-Schafer E, Hakim K, Zerkowski HR. Diminished responsiveness of Gs-coupled receptors in severely failing human hearts: no difference in dilated versus ischemic cardiomyopathy. J Cardiovasc Pharmacol 31: 585–594, 1998.[CrossRef][Web of Science][Medline]
  10. Brown L. Pharmacological responses to dopamine in isolated guinea-pig cardiovascular tissues: mechanisms of action. Arch Int Pharmacodyn Ther 308: 47–62, 1990.[Web of Science][Medline]
  11. Chen FM, Yamamura HI, Roeske WR. Ontogeny of mammalian myocardial beta-adrenergic receptors. Eur J Pharmacol 58: 255–264, 1979.[CrossRef][Web of Science][Medline]
  12. Collis L, Srivastava S, Coetzee WA, Artman M. Beta2 adrenergic agonists stimulate L-type calcium current independent of PKA in newborn rabbit ventricular myoctes. Am J Physiol Heart Circ Physiol 293: H2826–H2835, 2007.[Abstract/Free Full Text]
  13. Colthorpe KL, Curlewis JD. Localization and characterization of dopamine D1 receptors in sheep hypothalamus and striatum. J Neuroendocrinol 8: 561–568, 1996.[CrossRef][Web of Science][Medline]
  14. Deighton NM, Motomura S, Bals S, Zerkowski HR, Brodde OE. Characterization of the beta adrenoceptor subtype(s) mediating the positive inotropic effects of epinine, dopamine, dobutamine, denopamine and xamoterol in isolated human right atrium. J Pharmacol Exp Ther 262: 532–538, 1992.[Abstract/Free Full Text]
  15. Ding G, Qin Q, He N, Francis-David SC, Hou J, Liu J, Ricks E, Yang Q. Adiponectin and its receptors are expressed in adult ventricular cardiomyocytes and upregulated by activation of peroxisome proliferator-activated receptor gamma. J Mol Cell Cardiol 43: 73–84, 2007.[CrossRef][Web of Science][Medline]
  16. Facchinetti F, Del GE, Furegato S, Passarotto M, Arcidiacono D, Leon A. Dopamine inhibits responses of astroglia-enriched cultures to lipopolysaccharide via a beta-adrenoreceptor-mediated mechanism. J Neuroimmunol 150: 29–36, 2004.[CrossRef][Web of Science][Medline]
  17. Feng ZP, Dryden WF, Gordon T. Postnatal development of adrenergic responsiveness in the rabbit heart. Can J Physiol Pharmacol 67: 883–889, 1989.[Web of Science][Medline]
  18. Fleg JL, Tzankoff SP, Lakatta EG. Age-related augmentation of plasma catecholamines during dynamic exercise in healthy males. J Appl Physiol 59: 1033–1039, 1985.[Abstract/Free Full Text]
  19. Gong H, Sun H, Koch WJ, Rau T, Eschenhagen T, Ravens U, Heubach JF, Adamson DL, Harding SE. Specific beta(2)AR blocker ICI 118,551 actively decreases contraction through a G(i)-coupled form of the beta(2)AR in myocytes from failing human heart. Circulation 105: 2497–2503, 2002.[Abstract/Free Full Text]
  20. Habuchi Y, Lu LL, Komori T, Okamoto S, Nishimura M, Morikawa J, Yoshimura M. Does dopamine act on myocardial cells? Hypertens Res 18 Suppl 1: S157–S159, 1995.[CrossRef][Medline]
  21. Huang J, Xu L, Thomas M, Whitaker K, Hove-Madsen L, Tibbits GF. L-type Ca2+ channel function and expression in neonatal rabbit ventricular myocytes. Am J Physiol Heart Circ Physiol 290: H2267–H2276, 2006.[Abstract/Free Full Text]
  22. Kojima M, Ishima T, Taniguchi N, Kimura K, Sada H, Sperelakis N. Developmental changes in beta-adrenoceptors, muscarinic cholinoceptors and Ca2+ channels in rat ventricular muscles. Br J Pharmacol 99: 334–339, 1990.[Web of Science][Medline]
  23. Kong MM, Hasbi A, Mattocks M, Fan T, O'Dowd BF, George SR. Regulation of D1 dopamine receptor trafficking and signaling by caveolin-1. Mol Pharmacol 72: 1157–1170, 2007.[Abstract/Free Full Text]
  24. Kuznetsov V, Pak E, Robinson RB, Steinberg SF. Beta 2-adrenergic receptor actions in neonatal and adult rat ventricular myocytes. Circ Res 76: 40–52, 1995.[Abstract/Free Full Text]
  25. Latifi S, Lidsky K, Blumer JL. Pharmacology of inotropic agents in infants and children. Prog Pediatr Cardiol 12: 57–79, 2000.[CrossRef][Medline]
  26. Lompre AM, Lambert F, Lakatta EG, Schwartz K. Expression of sarcoplasmic reticulum Ca(2+)-ATPase and calsequestrin genes in rat heart during ontogenic development and aging. Circ Res 69: 1380–1388, 1991.[Abstract/Free Full Text]
  27. Lundgren E, Terracio L, Allen DO, Borg TK. Modulation of beta-receptors as adult and neonatal cardiac myocytes progress into culture. In Vitro Cell Dev Biol 24: 28–34, 1988.[CrossRef]
  28. Matsumoto T, Ozono R, Sasaki N, Oshima T, Matsuura H, Kajiyama G, Carey RM, Kambe M. Type 1A dopamine receptor expression in the heart is not altered in spontaneously hypertensive rats. Am J Hypertens 13: 673–677, 2000.[CrossRef][Web of Science][Medline]
  29. Maurice JP, Shah AS, Kypson AP, Hata JA, White DC, Glower DD, Koch WJ. Molecular beta-adrenergic signaling abnormalities in failing rabbit hearts after infarction. Am J Physiol Heart Circ Physiol 276: H1853–H1860, 1999.[Abstract/Free Full Text]
  30. Mazzio E, Becker A, Soliman KF. Characterization of neurotransmitters and dopamine attenuation of inducible nitric oxide synthase in glioma cells. J Neuroimmunol 131: 70–82, 2002.[CrossRef][Web of Science][Medline]
  31. Mishra M, Wagner MB, Wang Y, Joyner RW, Kumar R. Expression of cGMP-dependent protein kinase in human atrium. J Mol Cell Cardiol 33: 1467–1476, 2001.[CrossRef][Web of Science][Medline]
  32. Moe TK, Ziliang J, Barathi A, Beuerman RW. Differential expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), beta actin and hypoxanthine phosphoribosyltransferase (HPRT) in postnatal rabbit sclera. Curr Eye Res 23: 44–50, 2001.[CrossRef][Web of Science][Medline]
  33. Molenaar P, Bartel S, Cochrane A, Vetter D, Jalali H, Pohlner P, Burrell K, Karczewski P, Krause EG, Kaumann A. Both beta(2)- and beta(1)-adrenergic receptors mediate hastened relaxation and phosphorylation of phospholamban and troponin I in ventricular myocardium of Fallot infants, consistent with selective coupling of beta(2)-adrenergic receptors to G(s)-protein. Circulation 102: 1814–1821, 2000.[Abstract/Free Full Text]
  34. Mugelli A, Ledda F, Mantelli L, Torrini M, Maccioni T. Studies on the positive inotropic effect of dopamine in the guinea-pig heart. Naunyn Schmiedebergs Arch Pharmacol 301: 49–55, 1977.[CrossRef][Web of Science][Medline]
  35. Namiki T, Joyner RW, Wagner MB. Developmental changes in time course of recovery from inactivation in L-type calcium currents of rabbit ventricular myocytes. Am J Physiol Heart Circ Physiol 292: H295–H303, 2007.[Abstract/Free Full Text]
  36. O'Malley KL, Harmon S, Tang L, Todd RD. The rat dopamine D4 receptor: sequence, gene structure, and demonstration of expression in the cardiovascular system. New Biol 4: 137–146, 1992.[Web of Science][Medline]
  37. Osaka T, Joyner RW. Developmental changes in calcium currents of rabbit ventricular cells. Circ Res 68: 788–796, 1991.[Abstract/Free Full Text]
  38. Osaka T, Joyner RW. Developmental changes in the beta-adrenergic modulation of calcium currents in rabbit ventricular cells. Circ Res 70: 104–115, 1992.[Abstract/Free Full Text]
  39. Osaka T, Joyner RW, Kumar R. Postnatal decrease in muscarinic cholinergic influence on Ca2+ currents of rabbit ventricular cells. Am J Physiol Heart Circ Physiol 264: H1916–H1925, 1993.[Abstract/Free Full Text]
  40. Ozono R, O'Connell DP, Vaughan C, Botkin SJ, Walk SF, Felder RA, Carey RM. Expression of the subtype 1A dopamine receptor in the rat heart. Hypertension 27: 693–703, 1996.[Abstract/Free Full Text]
  41. Ozono R, O'Connell DP, Wang ZQ, Moore AF, Sanada H, Felder RA, Carey RM. Localization of the dopamine D1 receptor protein in the human heart and kidney. Hypertension 30: 725–729, 1997.[Abstract/Free Full Text]
  42. Papp JG. Cardiac responses to drugs at the extremes of age. Therapie 46: 283–291, 1991.[Web of Science][Medline]
  43. Qu Y, Boutjdir M. Gene expression of SERCA2a and L- and T-type Ca channels during human heart development. Pediatr Res 50: 569–574, 2001.[Web of Science][Medline]
  44. Ricci A, Bronzetti E, Fedele F, Ferrante F, Zaccheo D, Amenta F. Pharmacological characterization and autoradiographic localization of a putative dopamine D4 receptor in the heart. J Auton Pharmacol 18: 115–121, 1998.[CrossRef][Web of Science][Medline]
  45. Roeske WR, Wildenthal K. Responsiveness to drugs and hormones in the murine model of cardiac ontogenesis. Pharmacol Ther 14: 55–66, 1981.[CrossRef][Web of Science][Medline]
  46. Tabbutt S, Helfaer MA, Nichols DC. Pharmacology of cardiovascular drugs. In: Critical Heart Disease in Infants and Children, edited by Nichols DC, Ungerleider RM, Spevak PJ, Greeley WJ, Cameron DE, Lappe DG, Wetzel RC. Philadelphia: Mosby Elsevier, 2006, p. 173–203.
  47. Tipparaju SM, Kumar R, Wang Y, Joyner RW, Wagner MB. Developmental differences in L-type calcium current of human atrial myocytes. Am J Physiol Heart Circ Physiol 286: H1963–H1969, 2004.[Abstract/Free Full Text]
  48. Varriale P. Role of dopamine in congestive heart failure: a contemporary appraisal. Congest Heart Fail 5: 120–124, 1999.[Medline]
  49. Wang Y, Wagner MB, Joyner RW, Kumar R. cGMP-dependent protein kinase mediates stimulation of L-type calcium current by cGMP in rabbit atrial cells. Cardiovasc Res 48: 310–322, 2000.[Abstract/Free Full Text]
  50. Xiao RP, Tomhave ED, Wang DJ, Ji X, Boluyt MO, Cheng H, Lakatta EG, Koch WJ. Age-associated reductions in cardiac beta1- and beta2-adrenergic responses without changes in inhibitory G proteins or receptor kinases. J Clin Invest 101: 1273–1282, 1998.[Web of Science][Medline]
  51. Yao X, Parnot C, Deupi X, Ratnala VR, Swaminath G, Farrens D, Kobilka B. Coupling ligand structure to specific conformational switches in the beta2-adrenoceptor. Nat Chem Biol 2: 417–422, 2006.[CrossRef][Web of Science][Medline]
  52. Yu P, Yang Z, Jones JE, Wang Z, Owens SA, Mueller SC, Felder RA, Jose PA. D1 dopamine receptor signaling involves caveolin-2 in HEK-293 cells. Kidney Int 66: 2167–2180, 2004.[CrossRef][Web of Science][Medline]
  53. Zhang XF, Cooper DC, White FJ. Repeated cocaine treatment decreases whole-cell calcium current in rat nucleus accumbens neurons. J Pharmacol Exp Ther 301: 1119–1125, 2002.[Abstract/Free Full Text]
  54. Zhao H, Matsuoka S, Fujioka Y, Noma A. Effects of dopamine on L-type Ca2+ current in single atrial and ventricular myocytes of the rat. Br J Pharmacol 121: 1247–1254, 1997.[CrossRef][Web of Science][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/5/H2327    most recent
00993.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ding, G.
Right arrow Articles by Wagner, M. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ding, G.
Right arrow Articles by Wagner, M. B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2008 by the American Physiological Society.