AJP - Heart Calcium Transients and Cell-Sarcomere
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Heart Circ Physiol 295: H361-H365, 2008. First published May 9, 2008; doi:10.1152/ajpheart.00825.2007
0363-6135/08 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figures
Right arrow All Versions of this Article:
295/1/H361    most recent
00825.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Weber, M.
Right arrow Articles by Lösel, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Weber, M.
Right arrow Articles by Lösel, R.

Proteins interact with the cytosolic mineralocorticoid receptor depending on the ligand

Miriam Weber, Martin Wehling, and Ralf Lösel

Clinical Pharmacology Mannheim, Department of Experimental and Clinical Pharmacology, Medical Faculty Mannheim, University of Heidelberg, Mannheim, Germany

Submitted 16 July 2007 ; accepted in final form 6 May 2008


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Steroid receptors belonging to the superfamily of nuclear receptors do not exist as single monomeric proteins but mediate their effects by the interaction with numerous other proteins, e.g., cofactors for transcription, but also other proteins involved in cellular signaling. This interaction may be ligand dependent, which explains the differential effects of receptor ligands. Whereas some receptors, e.g., the estrogen receptor, have been studied in great detail, much less is known about proteins interacting with the mineralocorticoid receptor (MR). In this study, we aimed to identify interacting proteins using a proteomics approach involving tagged receptor constructs. After affinity isolation of MR complexes, blue native electrophoresis revealed the presence of several populations of MR complexes differing in size and composition. During the identification of interacting proteins, various heat shock proteins but also several previously undescribed potential interactors were found, including 14-3-3-{varepsilon}. We also demonstrate here that the cytosolic MR in the presence of detergent interacts in a ligand-selective manner with glucose-regulated protein 78 and propionyl-CoA carboxylase-β precursor, which are found in the unliganded or aldosterone-containing complex but not with spironolactone.

steroid receptor; aldosterone; mineralocorticoid; spironolactone; 14-3-3; proteomics

THE MINERALOCORTICOID RECEPTOR (MR) has regained considerable interest since one of its ligands, aldosterone, has been identified as an independent risk factor for cardiovascular diseases. This points to a role of MR far beyond the traditional perception of being merely a regulator of salt homeostasis in the kidney and exocrine glands and prompts to search for possible additional mechanisms of MR action.

MR is a member of the superfamily of nuclear receptors, which are ligand-dependent transcription factors. MR is located predominantly in the cytosol but, upon binding of an agonist, translocates to the nucleus where it modulates gene transcription. However, steroid receptors do not exist as monomers or exert their effect alone. Many steroid receptors have been demonstrated to differentially recruit cofactors in the nucleus, depending on the kind of ligand bound to the hormone-binding domain. This is the molecular basis for the selectivity of hormone receptor modulators, which are able to elicit defined subsets of the response invoked by the natural ligand (20). Such phenomena have been well studied, e.g., with the estrogen receptor (ER), but little is known about the interactions of MR, although elongation factor (EF) 11-19 lysine-rich leukemia (ELL) has been identified as a novel coregulator (15) and ligand-selective recruitment of RNA helicase was demonstrated (11). However, screening methods such as an automated two-hybrid system did not yield many MR cofactors (1). As an alternative approach, the direct proteomic identification of the MR "interactome" may be tried, which has been done, e.g., for the glucocorticoid receptor (7). MR on the other hand is more difficult to study, since it is expressed at a much lower level and has lower functional stability. The situation is further complicated by the lack of antibodies suitable for immunoprecipitation. Therefore, we employed a model system involving the overexpression of a MR construct bearing an affinity tag, followed by the isolation of the MR complex. In a first step, we aimed at elucidating the constituents of the cytosolic MR complex. As a model system, cardiac myocytes would be the ideal system to elucidate MR interaction in the heart, but they generally do not proliferate in culture. The widely used human cell line HEK293T, although originally derived from embryonic kidney, does not functionally resemble any kidney cell but shares some common properties with the heart, e.g., the very low or absent expression of 11β-hydroxysteroid dehydrogenase 2 (HSD2), which in the "classic" mineralocorticoid responsive tissues serves to protect MR from being activated by cortisol. In the heart, HSD2 activity is two orders of magnitude lower than in the kidney (12), or even absent, which is likely to modulate its function.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS AND DISCUSSION
 REFERENCES
 
Construction of plasmids. The MR coding sequence was amplified by PCR from phMR3750 using the primer pairs ATATATGGTCTCGAATGGAAACCAAAGG and TATGACGGTCTCAGCGCTCTTCCGGTGGAAGTA (reverse), cut by BsaI and ligated into pEXPR-IBA103 (IBA, Göttingen, Germany) encoding the One-STrEP tag to yield a COOH-teminally tagged construct, and with primer pairs ATATATGCGCCGAGACCAAAGGCTACCAC and TATGGTCTCATATCTCACTTCCGGTGGAAGTA (reverse) into pEXPR-IBA105 to make an NH2-terminally fused construct. All constructs were verified by sequencing (MWG Biotech, Ebersberg, Germany).

Cell culture. HEK293T cells were maintained in DMEM (Invitrogen, Karlsruhe, Germany) supplemented with 10% FCS and penicillin-streptomycin. For large scale experiments, 20–30 petri dishes (140 mm) at ~60% confluence were transfected with MR expression plasmid (17.5 µg/dish) using the calcium phosphate method modified as previously described (3). After overnight incubation, the medium was replaced by DMEM + 5% charcoal-treated FCS and the cells were cultivated for an additional 48 h.

Assessment of aldosterone-dependent transactivation. HEK293T cells were transfected with the MR construct, mouse mammary tumor virus-luciferase reporter, and SV40-galactosidase plasmids using FuGene6 or calcium phosphate and kept in DMEM plus 5% charcoal-treated FCS. Twenty-four hours later, the cells were treated with aldosterone (1 nM), aldosterone and RU-486 (1 µM), or vehicle. After another 24 h, cells were lysed and assayed for luciferase and galactosidase. Transactivation is expressed as the ratio of luciferase activity normalized to galactosidase in aldosterone-treated versus vehicle-treated (control) cells.

Isolation of MR complex. Each experiment was performed at least three times in independent runs. Cells were scraped off the dishes in DMEM and resuspended in the same medium and incubated at 37°C. Steroid or vehicle was added, and after incubation, the tube was cooled in ice and the cells were collected by centrifugation. The cell pellet was resuspended in lysis buffer containing 50 mM Tris, 100 mM NaCl, 50 mM NaF, 5 mM EDTA, 40 mM β-glycerophosphate, 200 µM orthovanadate, 1% Triton X-100, 1 mM PMSF, 5 mM DTT, 10 mM molybdate, and Complete protease inhibitor (Roche, 1 tablet/50 ml) (pH 7.5). The lysate was cleared by centrifugation (100,000 g, 20 min) and applied to a 1-ml column of Strep-Tactin agarose (IBA) at 4°C. The column was washed five times with 1 ml each of washing buffer containing (in mM) 100 Tris, 150 NaCl, 1 EDTA, 5 DTT, and 10 ammonium molybdate (pH 8.0), and the protein complex was eluted with 6x 0.5 ml elution buffer (washing buffer supplemented with 2.5 mM desthiobiotin). MR protein is usually eluted in fractions 2 to 4 as judged by immunoblot with Strep-Tactin-horseradish peroxidase. MR containing fractions were pooled, concentrated by Centricon 10 (Amicon), and separated by blue native electrophoresis or SDS gel electrophoresis. The gels was fixed in 10% acetic acid and 40% ethanol and stained with 0.1% Serva blue R250 in the same mixture. After the destaining was completed, the gels were transferred to 1% acetic acid to enhance clarity.

The stoichiometry of heat shock protein (HSP) 90 to MR was estimated by spot densitometry from gel photographs (3 gels each for the unoccupied and the aldosterone containing MR) using the AlphaEase software package (Alpha Innotech).

Matrix-assisted laser desorption/ionization-mass spectrometry identification of proteins. The protein bands were excised from the one-dimensional gels and washed with acetonitrile followed by 50 mM NH4HCO3, which was repeated three times. Protein was reduced by DTT, alkylated by iodoacetamide, and finally digested by incubation with sequencing-grade trypsin (Promega, Mannheim, Germany) for 4 h at 37°C. The crude digests were purified with C18 ZipTips (Millipore, Bedford, MA) and eluted with a saturated solution of hydroxycyano cinnamic acid in 50% acetonitrile/0.1% trifluoroacetic acid onto ground steel Matrix-assisted laser desorption/ionization targets or Anchor targets (both Bruker, Bremen, Germany). Peptide mass spectra were collected in the reflector mode on a BiflexIII instrument (Bruker). Some spectra were recorded on a Ultraflex ToF/ToF (Bruker), which allowed peptide fragmentation. Protein identification was done by MASCOT (http://www.matrixscience.com/), normally with a mass tolerance of 0.2 Da and a fixed carbamidomethylation at Cys residues. Some protein identities were supported by peptide fragmentation spectra collected on an Ultraflex instrument (Bruker).

Western blot estimation of protein quantity. GAPDH was quantified by Western blot analysis and subsequent densitometry. Briefly, the samples from runs containing different amounts of expressed MR construct were separated by SDS-PAGE and transferred to nitrocellulose membranes. After blocking with 3% nonfat milk, the detection used anti-GAPDH (clone 6C5, Biodesign International). Quantification was done after chemiluminescent detection (Lumi-light plus, Roche) using AlphaEase.


   RESULTS AND DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
REFERENCES
 
Initially, we constructed several MR fusion proteins with various tags, including the DYKDDDDK, One-STrEP, and an in vivo biotinylated tag (requiring contransfection of birA from Escherichia coli). All constructs were functional as judged by >10-fold transactivation in the presence of 1 nM aldosterone (see supplementary Fig. 1; note: all supplemental figures my be found with the online version of this article.). After the expression in HEK293T cells, immunoprecipitation experiments using appropriate antibodies, streptavidin (for the biotinylation tag) or Strep-Tactin (for One-STrEP), were performed. In our hands, One-STrEP, which has the sequence WSHPQFEKGGGSGGGSGGGSWSHPQFEK, yielded the best recoveries (results not shown) with very little nonspecific binding (see supplementary Fig. 2). To control artefactual phenomena due to the tag, we constructed both COOH- and NH2-terminal variants. Preliminary experiments revealed that the expression of the MR construct was maximal 48 h after transfection. The lysis procedure used in this study largely destroys the nuclei (but not the mitochondria), but the MR bound to DNA is removed along with chromatin during the workup. Therefore, the samples contain mainly cytosolic MR.

In general, the analysis of cytosolic MR-interacting proteins revealed only minor differences between different durations of aldosterone incubation (5 min, 30 min, and 2 h), although the total amount of MR complex in the cytosol decreased, as expected (data not shown), which led us to use 5 min for all subsequent experiments. We did not aim at determining the exact stoichiometries of interacting proteins in this study.

The cytosolic MR isolated by affinity chromatography was found to exist in several complexes of different sizes at the same time as revealed by blue native electrophoresis (Fig. 1). The closely related glucocorticoid receptor has been previously described to exist in multiple different complexes or receptosomes (7). Although it would be very interesting to examine the composition of the individual complexes, blue native followed by SDS electrophoresis yielded insufficient separation to resolve the majority of constituents in our hands.


Figure 1
View larger version (30K):
[in this window]
[in a new window]

  		Fig. 1. Blue native electrophoresis (top, left) of the affinity isolated mineralocorticoid receptor (MR) complexes from nonactivated (no steroid present) cells. Top lane: molecular weight marker; bottom lane: MR complexes.

 
SDS gel electrophoresis, which has higher resolving power, of the affinity-isolated cytosolic MR complex revealed a considerable number of protein bands (Fig. 2). The stained bands were excised and subjected to trypsin digestion, followed by the identification of proteins by peptide mass fingerprinting. The results of proteins that have been consistently identified in at least three runs are shown in Table 1. Additional proteins, which were found occasionally, are not included in the table.


Figure 2
View larger version (29K):
[in this window]
[in a new window]

  		Fig. 2. Gel image of the proteins comprising the nonactivated MR complexes (MR with NH2-terminal tag) separated by SDS-gel electrophoresis and stained nonselectively. Numbers on right, the numbers of proteins identified (see Table 1); numbers on left, the position of molecular weight markers.

 

View this table:
[in this window]
[in a new window]

  		Table 1. Proteins identified from the 1-D gel in Fig. 1

 
Direct interaction analysis poses the problem of "sticky" proteins, i.e., proteins that interact with a large number of other proteins. Such interaction is usually considered nonspecific, and therefore those molecules are compiled in blacklists. In this MR study, a considerable number of such blacklisted potential interactors have been found (marked with an asterisk in Table 1). However, the majority of them have been demonstrated to interact with steroid receptors in a specific manner. In particular, HSP90 (Nos. 1 and 2 in Table 1) is crucial for maintaining the functionality of the unliganded steroid receptors (2) and has been shown to interact with progesterone, glucocorticoid, mineralocorticoid, androgen, estrogen, and vitamin D receptors. Furthermore, HSP70 (several members of this large family) (5), tubulins (Nos. 9 and 10) (13), and actin (No. 14) (8) reportedly show specific interaction. ER-{alpha} interacts with tubulin-β, whereas both glucocorticoid and vitamin D receptors are reported to interact with microtubules. Actin is reported to bind to MR (8), although we did not observe the ligand modulation. The only protein that is likely to stick nonspecifically, i.e., with no study in the literature of steroid receptor interaction to our knowledge, is ribosomal protein RS40K (No. 15). Another protein that has been previously described to interact with virtually all steroid receptors is p23 (No. 22) (9), which has been found in this study as well.

The amount of HSP90 is in excess of that of MR, as judged from nonspecifically stained gel images. Upon the addition of ligand, the intensity of the HSP90 band decreases although it does not disappear completely. Densitometry revealed HSP90 to MR stoichiometries of 5.3 ± 0.6 in the unliganded state versus 1.6 ± 0.4 with aldosterone. This is in line with data in the literature that report stoichiometries of up to 4:1 (2).

Apart from the decrease in HSP90 binding after the addition of aldosterone, there was little difference in the collection of proteins that copurified in the receptor complex. Even cortisol did not significantly change the protein pattern (data not shown), although it effected the transcriptional activation of MR with or without carbenoxolone added reflecting the absence of HSD2 in HEK cells.

An unexpected finding was the considerable number of metabolic enzymes, most of them linked to glycolysis, attached to MR. Many of them are abundant in the cell, e.g., GAPDH (No. 17); therefore, a simple carryover phenomenon may be suspected. When cells transfected with lower amounts of DNA are worked up as described, the amount of GAPDH in the MR complex preparation appears to decrease more than the amount of MR, as judged by Western blot analysis. This indicates that the interaction between GAPDH and the MR complex, if specific, is not very stable or has a high dissociation rate. The reproducible, consistent detection of GAPDH may indicate that the complex formation also occurs under physiological conditions in the intact cell. Since the cell extract that is applied to the affinity column is more than 20-fold diluted compared with native cytoplasm, thus disfavoring weak interactions, the complex formation in the cytosol in vivo may be assumed, regardless of the functional relevance.

On the other hand, the function of steroid receptors has been linked to cellular redox or energy status, a scenario in which metabolic enzymes binding ATP or NAD+/NADH may have an additional role as "sensors." This is in line with data, e.g., for the E75 receptor, that has been suggested to be a redox sensor in drosophila (17). Many glycolytic enzymes reversibly bind to the cytoskeleton (4), which could be another explanation for their presence in the MR fraction, keeping in mind its interaction with actin; in addition, several glycolytic enzymes have been reported to exert a very unexpected function, i.e., binding to DNA (18).

Protein-L-isoaspartate-O-methyl transferase (No. 20), a repair enzyme, has not yet been described in the context of steroid receptors. However, it has been reported to enhance the activity of other nuclear receptors (peroxisome proliferator-activated receptor-{gamma} and retinoid X receptor-{alpha}; see Ref. 22) and to interact with transcriptional coactivators such as CREB-binding protein/p300 (14).

An interesting finding that may also be important for nongenomic actions mediated by the MR is the presence of 14-3-3-{varepsilon} (No. 19) in the MR complex. 14-3-3 Proteins act as scaffolding proteins for signaling complexes, which may explain signaling events attributed to MR, such as the MAPK cascade (6). With MR, we found the {varepsilon}-isoform, whereas the glucocorticoid receptor has been reported to interact with the isoforms 14-3-3-{eta} and -{sigma} (10, 21). 14-3-3 Proteins interact with numerous other cellular components, including HSP70s, glucose-regulated protein (GRP) 78 (#4), actin, tubulin as well as, the EF-1{gamma} (No. 12) and EF-2 (No. 2) (16), which all have been identified here. Interestingly, the interaction of GAPDH with 14-3-3 seems to be specific (16). Therefore, 14-3-3 interacting with MR could explain the presence of many unexpected proteins in the complex.

Another unexpected finding was the differential interaction of proteins with cytosolic MR that was occupied by different ligands. Figure 3 shows an expanded view of SDS gels of both the COOH- and NH2-terminal tag MR constructs in the unliganded state and occupied by aldosterone or spironolactone. Protein band 1 is visible only if MR is unliganded or occupied by aldosterone but not with spironolactone bearing MR. This protein is the propionyl-CoA-carboxylase-β chain precursor, which is a mitochondrial enzyme although the precursor identified here is synthesized in the cytosol. Propionyl-CoA-carboxylase, like most carboxylases, is a biotinylated enzyme with the {alpha}-subunit bearing the biotin moiety. Since the affinity resin used in this study is an engineered derivative of streptavidin and since the tag is a peptide mimic of biotin, the presence of the propionyl-CoA-carboxylase-β chain precursor could be due to interaction with the {alpha}-subunit that could be suspected to stick to the resin due to its biotin. However, this does not explain why the occurrence of this protein depends on the MR ligand present. Since this phenomenon was seen with both constructs in several runs, we believe that it is not a nonspecific phenomenon, although we do not yet know its physiological implications. Protein band 2 in Fig. 3, which is clearly visible only with the NH2-terminally tagged construct, is GRP78 (also called binding protein or HSPA5), another member of the HSP70 family. Although it is not possible to distinguish between the precursor and the mature protein on the basis of our MS data (as we did not find peptides from amino acids 1–49), the peptide bearing the Lys-Asp-Glu-Leu retention signal was consistently found, indicating that GRP78 should reside in the endoplasmic reticulum. MR has been reported to be located also in or at the endoplasmic reticulum in the kidney (19). However, it must be kept in mind that a detergent (Triton X-100) was present in all experiments during the cell lysis step. Therefore, it is not possible to exclude that the contents of cellular compartments mix, which otherwise would be kept apart. Nevertheless, the differential interaction of MR with GRP78 and propionyl-CoA carboxylase is a valid biochemical finding, since Triton was present in all experiments.


Figure 3
View larger version (35K):
[in this window]
[in a new window]

  		Fig. 3. Proteins that are differentially recruited to the MR complex in the presence of Triton X-100. C, nonactivated MR (control); Aldo, 100 nM aldosterone added; Spiro, 100 nM spironolactone added. Arrows, 2 proteins that are strikingly different in the Spiro-occupied MR compared with Aldo-occupied or nonliganded MR. C-terminal and N-terminal, COOH-terminal and NH2-terminal. respectively.

 
According to the results of the experiments described above, MR appears to be able to interact with many cellular proteins. The stoichiometry of HSP90 binding to MR is hard to reconcile with the assumption that MR is at the center of the complex; rather, it seems fair to postulate that one or more of the scaffolding proteins, such as actin, tubulin, or 14-3-3, act to assemble the complex(es). Future research is needed to elucidate which interactions are relevant for MR function.


   ACKNOWLEDGMENTS
 
We are grateful to Dr. Ronald Evans, Salk Institute, for a gift of plasmid phMR3750, to Dr. Andrew Cato, Universität Karlsruhe, for plasmid MMTV-luc, and to Dr. G. Niedner-Schatteburg, Universität Kaiserslautern, for access to the Ultraflex ToF/ToF instrument.


   FOOTNOTES
 

Address for reprint requests and other correspondence: M. Wehling, Klinische Pharmakologie Mannheim, Klinikum Mannheim, Theodor-Kutzer-Ufer, 68167 Mannheim, Germany (e-mail: martin.wehling{at}pharmtox.uni-heidelberg.de)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 

  1. Albers M, Kranz H, Kober I, Kaiser C, Klink M, Suckow J, Kern R, Koegl M. Automated yeast two-hybrid screening for nuclear receptor-interacting proteins. Mol Cell Proteomics 4: 205–213, 2005.[Abstract/Free Full Text]
  2. Bresnick EH, Dalman FC, Sanchez ER, Pratt WB. Evidence that the 90-kDa heat shock protein is necessary for the steroid binding conformation of the L cell glucocorticoid receptor. J Biol Chem 264: 4992–4997, 1989.[Abstract/Free Full Text]
  3. Chen C, Okayama H. High-efficiency transformation of mammalian cells by plasmid DNA. Mol Cell Biol 7: 2745–2752, 1987.[Abstract/Free Full Text]
  4. Clarke FM, Masters CJ. On the association of glycolytic enzymes with structural proteins of skeletal muscle. Biochim Biophys Acta 381: 37–46, 1975.[Medline]
  5. Diehl EE, Schmidt TJ. Heat shock protein 70 is associated in substoichiometric amounts with the rat hepatic glucocorticoid receptor. Biochemistry 32: 13510–13515, 1993.[CrossRef][Web of Science][Medline]
  6. Grossmann C, Benesic A, Krug AW, Freudinger R, Mildenberger S, Gassner B, Gekle M. Human mineralocorticoid receptor expression renders cells responsive for nongenotropic aldosterone actions. Mol Endocrinol 19: 1697–1710, 2005.[Abstract/Free Full Text]
  7. Hedman E, Widen C, Asadi A, Dinnetz I, Schroder WP, Gustafsson JA, Wikstrom AC. Proteomic identification of glucocorticoid receptor interacting proteins. Proteomics 6: 3114–3126, 2006.[CrossRef][Web of Science][Medline]
  8. Jalaguier S, Mornet D, Mesnier D, Leger JJ, Auzou G. Human mineralocorticoid receptor interacts with actin under mineralocorticoid ligand modulation. FEBS Lett 384: 112–116, 1996.[CrossRef][Web of Science][Medline]
  9. Johnson JL, Toft DO. A novel chaperone complex for steroid receptors involving heat shock proteins, immunophilins, and p23. J Biol Chem 269: 24989–24993, 1994.[Abstract/Free Full Text]
  10. Kino T, Souvatzoglou E, De Martino MU, Tsopanomihalu M, Wan Y, Chrousos GP. Protein 14-3-3sigma interacts with and favors cytoplasmic subcellular localization of the glucocorticoid receptor, acting as a negative regulator of the glucocorticoid signaling pathway. J Biol Chem 278: 25651–25656, 2003.[Abstract/Free Full Text]
  11. Kitagawa H, Yanagisawa J, Fuse H, Ogawa S, Yogiashi Y, Okuno A, Nagasawa H, Nakajima T, Matsumoto T, Kato S. Ligand-selective potentiation of rat mineralocorticoid receptor activation function 1 by a CBP-containing histone acetyltransferase complex. Mol Cell Biol 22: 3698–3706, 2002.[Abstract/Free Full Text]
  12. Lombes M, Alfaidy N, Eugene E, Lessana A, Farman N, Bonvalet JP. Prerequisite for cardiac aldosterone action. Mineralocorticoid receptor and 11 beta-hydroxysteroid dehydrogenase in the human heart. Circulation 92: 175–182, 1995.[Abstract/Free Full Text]
  13. Manavathi B, Acconcia F, Rayala SK, Kumar R. An inherent role of microtubule network in the action of nuclear receptor. Proc Natl Acad Sci USA 103: 15981–15986, 2006.[Abstract/Free Full Text]
  14. Misra P, Qi C, Yu S, Shah SH, Cao WQ, Rao MS, Thimmapaya B, Zhu Y, Reddy JK. Interaction of PIMT with transcriptional coactivators CBP, p300, and PBP differential role in transcriptional regulation. J Biol Chem 277: 20011–20019, 2002.[Abstract/Free Full Text]
  15. Pascual-Le Tallec L, Simone F, Viengchareun S, Meduri G, Thirman MJ, Lombes M. The elongation factor ELL (eleven-nineteen lysine-rich leukemia) is a selective coregulator for steroid receptor functions. Mol Endocrinol 19: 1158–1169, 2005.[Abstract/Free Full Text]
  16. Pozuelo Rubio M, Geraghty KM, Wong BH, Wood NT, Campbell DG, Morrice N, Mackintosh C. 14-3-3-Affinity purification of over 200 human phosphoproteins reveals new links to regulation of cellular metabolism, proliferation and trafficking. Biochem J 379: 395–408, 2004.[CrossRef][Web of Science][Medline]
  17. Reinking J, Lam MM, Pardee K, Sampson HM, Liu S, Yang P, Williams S, White W, Lajoie G, Edwards A, Krause HM. The Drosophila nuclear receptor e75 contains heme and is gas responsive. Cell 122: 195–207, 2005.[CrossRef][Web of Science][Medline]
  18. Ronai Z. Glycolytic enzymes as DNA binding proteins. Int J Biochem 25: 1073–1076, 1993.[CrossRef][Web of Science][Medline]
  19. Sasano H, Fukushima K, Sasaki I, Matsuno S, Nagura H, Krozowski ZS. Immunolocalization of mineralocorticoid receptor in human kidney, pancreas, salivary, mammary and sweat glands: a light and electron microscopic immunohistochemical study. J Endocrinol 132: 305–310, 1992.[Abstract/Free Full Text]
  20. Shang Y, Brown M. Molecular determinants for the tissue specificity of SERMs. Science 295: 2465–2468, 2002.[Abstract/Free Full Text]
  21. Wakui H, Wright AP, Gustafsson J, Zilliacus J. Interaction of the ligand-activated glucocorticoid receptor with the 14-3-3 eta protein. J Biol Chem 272: 8153–8156, 1997.[Abstract/Free Full Text]
  22. Zhu Y, Qi C, Cao WQ, Yeldandi AV, Rao MS, Reddy JK. Cloning and characterization of PIMT, a protein with a methyltransferase domain, which interacts with and enhances nuclear receptor coactivator PRIP function. Proc Natl Acad Sci USA 98: 10380–10385, 2001.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figures
Right arrow All Versions of this Article:
295/1/H361    most recent
00825.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Weber, M.
Right arrow Articles by Lösel, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Weber, M.
Right arrow Articles by Lösel, R.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2008 by the American Physiological Society.