Am J Physiol Heart Circ Physiol 295: H1599-H1607, 2008.
First published August 15, 2008; doi:10.1152/ajpheart.91449.2007
0363-6135/08 $8.00
Morphological and biochemical characterization of basal and starvation-induced autophagy in isolated adult rat cardiomyocytes
Rumi Maruyama,1,*
Kazuko Goto,1,*
Genzou Takemura,1
Koh Ono,2
Kazuya Nagao,2
Takahiro Horie,2
Akiko Tsujimoto,1
Hiromitsu Kanamori,1
Shusaku Miyata,1
Hiroaki Ushikoshi,1
Kenshi Nagashima,1
Shinya Minatoguchi,1
Takako Fujiwara,3 and
Hisayoshi Fujiwara1
1Division of Cardiology, Gifu University Graduate School of Medicine, Gifu; 2Department of Cardiovascular Medicine, Graduate School of Medicine, Kyoto University, Kyoto; and 3Department of Food Science, Kyoto Women's University, Kyoto, Japan
Submitted 12 December 2007
; accepted in final form 9 August 2008
 |
ABSTRACT
|
|---|
Autophagy is simultaneously a mode of programmed cell death and an important physiological process for cell survival, but its pathophysiological significance in cardiac myocytes remains largely unknown. We induced autophagy in isolated adult rat ventricular cardiomyocytes (ARVCs) by incubating them in glucose-free, mannitol-supplemented medium for up to 4 days. Ultrastructurally, intracellular vacuoles containing degenerated subcellular organelles (e.g., mitochondria) were markedly apparent in the glucose-starved cells. Microtubule-associated protein-1 light chain 3 was significantly upregulated among the glucose-starved ARVCs than among the controls. After 4 days, glucose-starved ARVCs showed a significantly worse survival rate (19 ± 5.2%) than the controls (55 ± 8.3%, P < 0.005). Most dead ARVCs in both groups showed features of necrosis, and the rate of apoptosis did not differ between the groups. Two inhibitors of autophagy, 3-methyladenine (3-MA) and leupeptin, significantly and dose-dependently reduced the viability of both control and glucose-starved ARVCs and caused specific morphological alterations; 3-MA reduced autophagic findings, whereas leupeptin greatly increased the numbers and the sizes of vacuoles that contained incompletely digested organelles. The knockdown of the autophagy-related genes with small interfering RNA also reduced the glucose-starved ARVCs viability, but rapamycin, an autophagy enhancer, improved it. Reductions in the ATP content of ARVCs caused by glucose depletion were exacerbated by the inhibitors while attenuated by rapamycin, suggesting that autophagy inhibition might accelerate energy depletion, leading to necrosis. Taken together, our findings suggest that autophagy in cardiomyocytes reflects a prosurvival, compensatory response to stress and that autophagic cardiomyocyte death represents an unsuccessful outcome due to necrosis.
cardiac myocyte; necrosis; ultrastructure
AUTOPHAGY IS A TYPE OF PROGRAMMED cell death that occurs during tissue and organ development to eliminate unnecessary cells (4, 9, 24), but it also has survival-oriented functions, occurring under both basal conditions and conditions of stress, such as starvation (9, 12, 24). During autophagic degeneration, degraded membrane lipids and proteins within autophagosomes are recruited to maintain ATP production and protein synthesis, thereby promoting cell survival. Autophagic cell death is actually a morphological term derived from electron microscopic observations and denotes a form of cell death in which abundant autophagic vacuoles are present in the cytoplasm. But this definition tells us nothing about the pathophysiological significance of autophagy in disease processes. Consequently, although cardiomyocytes showing characteristics of autophagy have recently been reported in failing hearts, suggesting autophagic hyperfunction (6, 10, 11, 23, 27), it is still undetermined whether an abnormal increase in autophagic vacuoles is the primary cause of cardiomyocyte death in heart failure or even whether it reflects hyperfunction or hypofunction of the autophagic process. Danon's disease may epitomize the complicated issue of autophagy in the heart. In this disease, digestion of the contents of autophagic vacuoles is impaired (hypofunction) due to a gene-related deficiency in the lysosomal enzyme lysosome-associated membrane protein-2 (LAMP-2), which results in accumulation of autophagolysosomes with undigested contents in the cytoplasm and cardiomyocyte death, ultimately leading to heart failure (18, 25). Thus, autophagic hypofunction is apparently detrimental in the case of Danon's disease.
Our aim in the present study was to test whether basal and starvation-induced autophagy are protective or detrimental processes in cultured adult rat ventricular cardiomyocytes (ARVCs). For that purpose, we inhibited or enhanced autophagy by using several reagents and small interfering RNA (siRNA) and then assessed the survival rates among the cells and the ultrastructural changes they underwent.
 |
MATERIALS AND METHODS
|
|---|
ARVC isolation and culture.
This study was approved by our Institutional Animal Research Committee and conformed to the animal care guidelines of the American Physiological Society. We isolated ARVCs from male Sprague-Dawley rats (200 to 250 g) as previously described (14). The cells were plated on laminin-coated dishes or slide glass chambers at the concentration of 5.0 x 104 cells/ml and incubated in DMEM containing 50 µg/ml gentamicin in a CO2 incubator (95% room air-CO2).
Cell treatments.
One day after plating, the normal culture medium of some ARVCs was replaced with glucose-free DMEM (No. 11966, GIBCO), in which glucose was substituted with 11 mM mannitol to induce starvation-induced autophagy, and the cells were incubated for up to 4 days. Cells incubated in glucose (11 mM)-containing medium served as controls. In some experiments, an inhibitor of autophagy, either 3-methyladenine (3-MA; an inhibitor of phagophore formation; Sigma-Aldrich) or leupeptin (an inhibitor of lysosomal cysteine protease to suppress subsequent digestion of the contents within autophagolysosomes; Sigma-Aldrich) (27), was added when the medium was changed. Rapamycin (an inhibitor of mammalian target of rapamycin, which negatively controls autophagy by mediating class I phosphatidylinositol 3-kinases, Sigma-Aldrich) was alternatively used in an attempt to enhance autophagy (19). Because 3-MA and leupeptin are not specific inhibitors of autophagy, we attempted the knockdown of ATG5 and LAMP-2 using siRNA delivered by lentivirus. ARVCs were incubated in virus-containing medium for 24 h and then exposed to starvation. The efficiency of transfection (%positive) was calculated by counting green fluorescent protein (GFP)-positive cells in five random high-power fields (x400) of ARVCs transfected with a lentiviral GFP expression vector at 24 h after lentivirus mediated GFP transfection.
Lentivirus-mediated delivery of siRNA.
The oligonucleotides used for siRNA were as follows: ATG5-1 sense, GCGGATTCCAACGTGCTTTA; ATG5-1 antisense, TAAAGCACGTTGGAATCCGC; ATG5-2 sense, GTCAGGTGATCAACGAAAT; ATG5-2 antisense, ATTTCGTTGATCACCTGAC; LAMP-2-1 sense, GCAGTTGTGGCGATGATAA; LAMP-2-1 antisense, TTATCATCGCCACAACTGC; LAMP-2-2 sense, GCTGAACAACAGCCAAATT; and LAMP-2-2 antisense, AATTTGGCTGTTGTTCAGC. A nonsilencing control sequence was designed according to the sequences of a negative-control siRNA purchased from B-Bridge International. Every siRNA construct was made using pSINsi-mU6 vector (Takara Bio), and the siRNA-producing constructs were introduced to lentivirus vector plasmid (pLenti6/V5-D-TOPO vector; Invitrogen). We produced lentiviral stocks in 293FT cells following the manufacturer's protocol (Invitrogen).
The efficiency of knockdown was examined by total RNA isolation, cDNA synthesis, and real-time PCR using the transfected rat cardiomyoblasts H2c9 as previously described (26). Primer sequences used for quantification of ATG5, LAMP-2, and GAPDH were as follows: ATG5 sense, 5'-GACGCTGGTAACTGACAAAGTGA-3'; ATG5 antisense, 5'-TAGGAGATCTCCAAGGGTATGCA-3'; LAMP-2 sense, 5'-CTGGCTACCATGGGGCTGCA-3'; LAMP-2 antisense, 5'-ATCCAGTATGATGGCGCTTGAGA-3'; GAPDH sense, 5'-TTGCCATCAACGACCCCTTC-3'; and GAPDH antisense, 5'-TTGTCATGGATGACCTTGGC-3'. Transfection of ARVCs was performed by replacing the culture medium with virus-containing medium for 24 h.
Cell morphology and membrane permeability.
ARVCs were morphologically classified into two groups according to the cell length-to-cell width ratio. Cells with a cell length-to-cell width ratio of >3 were classified as rod shaped, whereas those with cell length-to-cell width ratios of <3 were deemed not to be rod shaped (8). The latter included square cells and round cells, which in some cases also showed budding or blebbing and cellular fragmentation. The viability of the cells was assessed by exposing them to 0.1% Trypan blue for 5 min, after which the numbers of stained (indicative of sarcolemmal damage) and unstained cells were counted (7). Experiments were done in triplicate in each group.
Electron microscopy.
ARVCs on slide chambers were fixed for 4 h in phosphate-buffered 2.5% glutaraldehyde (pH 7.4) and then postfixed for 1 h in 1% osmium tetroxide. They were then conventionally prepared for transmission electron microscopy (H-800, Hitachi, Tokyo, Japan).
Immunofluorescence microscopy.
After ARVCs were fixed on slide chambers with 4% paraformaldehyde, the cells were double labeled first with anti-microtubule-associated protein-1 light chain 3 (LC3; Santa Cruz Biotechnology) and anti-
-sarcomeric actinin (Sigma) and then, respectively, with Alexa 488- and 568-conjugated secondary antibodies (Molecular Probes). Hoechst 33342 was used for nuclear staining. The immunostained preparations were observed under a confocal microscope (LSM510, Zeiss).
Measurement of ATP content.
The total ATP levels within ARVCs were determined using an ATP Bioluminescent Assay Kit (Sigma), following the manufacturer's instructions. After we harvested the cells by centrifugation at 4,500 g for 5 min at 4°C, ATP was extracted from the cell pellets by incubating with 1% trichloroacetic acid-4 mM EDTA solution for 10 min on ice. The extracts were then collected and centrifuged at 12,000 g for 10 min at 4°C, after which the supernatants were used for ATP determination. Experiments were done in triplicate.
Western blot analysis.
Proteins extracted from ARVCs were subjected to 14% polyacrylamide gel electrophoresis and then transferred onto polyvinylidene difluoride membranes. The membranes were then probed using primary antibodies against LC3 (Santa Cruz Biotechnology) and the cleaved forms of caspase-3 (Cell Signaling), after which the blots were visualized using enhanced chemiluminescence (Amersham).
-Tubulin (analyzed using an antibody from Santa Cruz) served as the loading control. Experiments were done in triplicate.
Statistical Analysis
Values were expressed as means ± SE. Statistical comparisons were made using t-tests or ANOVA followed by Newman-Keuls multiple comparisons test. Values of P < 0.05 were considered significant.
 |
RESULTS
|
|---|
ARVC viability and morphology.
The survival rate among control ARVCs, as indicated by Trypan blue dye exclusion, gradually declined until it reached 55 ± 8.3% after 4 days of incubation (Fig. 1A). Survival declined more steeply among the glucose-starved ARVCs and reached 19 ± 5.2% (P < 0.005 vs. control) after 4 days of incubation (Fig. 1A). Nonetheless, the incidences of apoptosis, as indicated by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) positivity, were similar among the control and glucose-starved cells after 4 days of incubation (Fig. 1B).

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 1. Adult rat ventricular cardiomyocyte (ARVC) viability. A: viability of ARVCs assessed by Trypan blue dye exclusion. A, left: representative photomicrographs of ARVCs from control and glucose-starved groups. Arrows indicate Trypan blue-stained dead ARVCs. Bars, 20 µm. A, right: survival curves for the ARVCs up to 4 days (n = 6 experiments for each group). B: terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL)-positivity rates in the control (G, glucose) and glucose-starved (M, mannitol) groups (n = 3 experiments each). There is no significant (NS) difference between the groups.
|
|
Necrotic ARVCs were often observed in both groups. Under electron microscopic examination, these necrotic cells showed disrupted plasma membranes, mitochondria that were swollen and containing flocculent dense bodies, and sarcomeres that were supercontracted (Fig. 2). In living ARVCs in both groups, membrane-bound autophagic vacuoles were apparent, within which were intracellular organelles (mostly mitochondria) being digested. Notably, these vacuoles were much more numerous in the glucose-starved ARVCs than in the controls (Fig. 2).

View larger version (181K):
[in this window]
[in a new window]
|
Fig. 2. Ultrastructure of ARVCs incubated in glucose-containing (A and B) and glucose-free (C and D) medium. Representative electron micrographs of viable (A and C) and dead (B and D) ARVCs are shown for each group. Note the abundant autophagic vacuoles in the ARVCs from the glucose-starved group (arrows). Arrows indicate autophagic vacuoles. C1, C2, and D1 are highly magnified photographs of the boxed areas of C and D. The vacuoles are surrounded by double membranes (C1 and C2, arrowheads) or a single membrane (D1). N, nucleus. Bars, 1 µm.
|
|
Immunohistochemical analysis revealed that control ARVCs expressed some LC3 (Fig. 3), but comparatively small numbers of LC3-positive "dots" were seen (3.5 ± 0.7 dots/cell). By contrast, glucose-starved cells expressed an abundance of LC3-positive dots (21 ± 1.5 dots/cell, P < 0.05). The dots were also observed in necrotic ARVCs with damaged plasma membranes but were not seen in apoptotic ARVCs (Fig. 3). Western blot analysis revealed that LC3-II was significantly increased in the glucose-starved ARVCs (Fig. 4).

View larger version (49K):
[in this window]
[in a new window]
|
Fig. 4. Western blots for LC3 in ARVCs (top) and the densitometry showing relative intensity of LC3-II expression (bottom, n = 3 experiments each). *P < 0.05 compared with the control (G) group; #P < 0.05 compared with the glucose-starved (Mannitol) group.
|
|
Intervention in ARVC autophagy.
We used 3-MA and leupeptin to examine the effects of inhibiting autophagy in these cells. Both inhibitors dose-dependently reduced viability among control and glucose-starved ARVCs after 3 days of incubation (Fig. 5A), suggesting that the inhibition of either basal or starvation-induced autophagy is detrimental to the isolated ARVCs. In contrast, the treatment with rapamycin significantly attenuated the starvation-induced death of ARVCs in a dose-dependent manner (Fig. 5A).

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 5. Intervention of basal and starvation-induced autophagy. A: both 3-MA and Leu dose-dependently reduced the viability of both control and glucose-starved ARVCs, whereas Rap improved the viability of glucose-starved ARVCs. B and C: apoptosis evaluated by TUNEL assay was not affected by any treatments in the glucose-starved ARVCs (B) and Western blot analysis failed to detect cleaved (active forms of) caspase-3 in all groups (C) (n = 3 experiments each).
|
|
The inhibition of autophagy by 3-MA or leupeptin increased the numbers of necrotic ARVCs but had no effect on apoptosis, i.e., no effect on the incidence of TUNEL-positive cells or caspase-3 activation (Fig. 5, B and C). Rapamicin did not affect apoptosis either. Moreover, the two inhibitors induced ultrastructural changes that were specific to each, particularly in living ARVCs (Fig. 6). Treatment with 3-MA markedly reduced the numbers of autophagic vacuoles in glucose-starved ARVCs, irrespective of whether they were living or dead (Fig. 6, A and B). By contrast, the numbers of autophagic vacuoles and their size were greatly increased in the leupeptin-treated ARVCs (Fig. 6, C–F). Within the enlarged autophagolysosomes was an abundance of incompletely digested mitochondria and other membranous structures. Rapamycin increased the vacuoles containing digested organelles and also empty vacuoles; the latter might be phagophore or autophagolysosome that finished digestion of the contents (Fig. 6G).

View larger version (115K):
[in this window]
[in a new window]
|
Fig. 6. Ultrastructure of glucose-starved ARVCs treated with the autophagy inhibitor 3-MA (A and B) or Leu (C–F) or the autophagy enhancer Rap (G). ARVCs showed reagent-specific ultrastructure. The 3-MA-treated cells had few autophagic vacuoles, whether they were living (A) or necrotic (B). In contrast, Leu-treated ARVCs contained numerous gigantic autophagic vacuoles (C–F). D: various contents of the vacuoles. arrows, partially digested organelles; dotted arrows, nearly intact mitochondria and myelinlike membrane structures; arrowheads, degenerated but not digested mitochondria. E: a gigantic autophagic vacuole. F: the abundance of gigantic autophagic vacuoles within necrotic ARVCs treated with leupeptin. Arrows, autophagic vacuoles in C and F. G: abundant empty vacuoles (arrowheads) as well as autophagolysosomes (arrows). Bars, 1 µm.
|
|
The LC3-immunopositive dots were significantly decreased in the glucose-starved ARVCs by the treatment with 3-MA, whereas they were increased by leupeptin and rapamycin. Such immunofluorescent findings were supported by the Western blot analysis for LC3-II (Fig. 4). The increase of LC3-II in the leupeptin-treated ARVCs may be explained by the accumulation of undigested LC3-II.
We next performed experiments using siRNAs for ATG5 to specifically inhibit the initiation step of autophagy (formation of phagophore) and also siRNAs for LAMP-2 to inhibit the digestion step of autophagy. We generated two siRNA constructs directed against different regions of ATG5 (ATG5-1 and ATG5-2) and two siRNA against LAMP-2 (LAMP-2-1 and LAMP-2-2). ATG5-1 and ATG5-2 decreased the expression of ATG5 at mRNA level, whereas LAMP-2-1 and LAMP-2-2 decreased the expression of LAMP-2 at mRNA level (Fig. 7A). However, the transfection efficiency was relatively low: only 29 ± 2.3% assessed by GFP expression in ARVCs transfected with a lentiviral GFP expression vector. Despite such poor transfection efficiency, all siRNA significantly, though not markedly, decreased the viability of the ARVCs exposed to glucose depletion for 3 days (Fig. 7B), although no effect of siRNAs was seen upon cell survival in nonstarved cells (basal autophagy), probably because basal autophagy is originally low level and because transfection efficiency was substantially low. We evaluated the effect of siRNAs upon autophagy by counting LC3-positive dots in the glucose-starved cardiomyocytes under confocal microscopy. When compared with the control siRNA (23 ± 1.5 dots/cell, n = 6), both ATG5 siRNA significantly reduced the numbers of dots (18 ± 0.62 in ATG5-1, and 19 ± 0.71 in ATG5-2, n = 6 each), whereas both LAMP-2 siRNA significantly increased them (36 ± 0.60 in LAMP-2-1, and 34 ± 0.54 in LAMP-2-2, n = 6 each) (photographs not shown).

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 7. Effect of knockdown of ATG5 or lysosome-associated membrane protein-2 (LAMP-2) with small interfering (si)RNAs. A: real-time PCR revealed that lentivirus-delivered siRNAs (ATG5-1 and ATG-2) inhibited the expression of ATG5 gene and that lentivirus-delivered siRNAs (LAMP-2-1 and LAMP-2-2) did that of LAMP-2 gene. B: any siRNAs for ATG5 and LAMP-2 did not affect the survival rate of ARVCs without glucose depletion (left), but survival rate of ARVCs exposed to glucose starvation was reduced significantly, though not markedly, by lentivirus-mediated transfection of siRNAs (right). Such small effects may be explained by the relatively poor transfection efficiency of lentivirus to ARVCs (29 ± 2.3%). Survival rate of the cardiomyocytes-transfected control siRNA was set at 100% in each experiment. *P < 0.05 compared with the group treated with the control siRNA.
|
|
ATP content in ARVCs.
The reduction in the intracellular ATP content is known to be tightly related to necrosis in cardiomyocytes (21). Since we observed that the incidence in necrosis was increased among glucose-starved ARVCs and that this necrosis was accelerated by inhibition of autophagy, we next measured the ATP contents in the ARVCs. We found the ATP content to be significantly diminished in the glucose-starved ARVCs after 3 days of incubation (1.59 ± 0.14 x10–10 mol/µg protein) compared with controls (2.41 ± 0.06 x10–10 mol/µg protein, P < 0.05). Interestingly, the ATP content was further reduced in both control and glucose-starved cells by treatment with an autophagy inhibitor: in controls, 1.94 ± 0.47 x10–10 mol/µg protein by 3-MA and 2.09 ± 0.21 x10–10 mol/µg protein by leupeptin; and in glucose-starved cells, 1.08 ± 0.11 x10–10 mol/µg protein by 3-MA and 1.18 ± 0.03 x10–10 mol/µg protein by leupeptin (Fig. 8). Conversely, the ATP content was significantly increased by the treatment with rapamycin in the glucose-starved cells (2.11 ± 0.25 x10–10 mol/µg protein). There was thus a significant correlation between reduction in the ATP content of ARVCs and the increase in the incidence of necrosis under both basal conditions and after glucose depletion.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 8. The ATP content of ARVCs. Both 3-MA and Leu significantly reduced the ATP content of control (glucose) and glucose-starved (mannitol) ARVCs, whereas Rap significantly attenuated the ATP reduction in glucose-starved ARVCs (n = 3 experiments each). *P < 0.05 compared with glucose; #P < 0.05 compared with mannitol.
|
|
 |
DISCUSSION
|
|---|
Although autophagy is a form of cell death, it is generally accepted that autophagy is also essential for cell survival in cases of nutrient or growth-factor removal (3, 13). Indeed, Kuma et al. (12) reported that autophagy is necessary for the survival of neonatal mice during periods of starvation after birth. The present study confirmed these findings in ARVCs by showing that two autophagy inhibitors, 3-MA and leupeptin, reduced survival among ARVCs subjected to glucose depletion. Experiments using siRNA for ATG5 and LAMP-2 strengthened the findings in terms of specific inhibition of autophagy. Notably, these inhibitors also reduced survival among control ARVCs without apparent nutrient depletion, suggesting that autophagy plays an essential physiological role necessary for ARVC survival, even under basal culture conditions. That said, the in vitro conditions that the cells experienced in the present study almost certainly differ significantly from the in vivo conditions.
Although both 3-MA and leupeptin inhibit autophagy, their mechanisms of action differ: 3-MA inhibits formation of phagophores, whereas leupeptin suppresses digestion of the contents of autophagolysosomes. The use of leupeptin may mimic the pathophysiological conditions of Danon's disease (18), and we actually observed the accumulation of gigantic autophagolysosomes containing undigested organelles in ARVCs treated with leupeptin. In contrast, ARVCs treated with 3-MA lacked autophagic features. Despite their differences, both inhibitors caused autophagic hypofunction and markedly accelerated ARVC necrosis, accompanied by a reduction in intracellular ATP. ATP depletion upsets the transmembrane balance of electrolytes by disrupting the activities ATP-dependent ion pumps, thereby causing the cells to become edematous (2, 21). In addition, ATP depletion disturbs the homeostasis maintained by mitochondrial ATP energy production and the synthesis of proteins essential for cell survival. Together, these effects could have caused the cells to eventually become necrotic. Thus the necrosis among ARVCs observed in the present study might be the result of energy depletion (primary necrosis) caused by the prevention of recycled energy production via autophagy. This idea might be supported by the fact that the upregulation of autophagy by rapamycin preserved the ATP content and increased cell survival. However, another possibility is that the ATP levels dropped as the result of cell rupture. It is difficult to strictly determine the cause-and-effect relationship between necrosis and ATP loss in the present study protocol, and to resolve this issue, it would be necessary to monitor the morphology and ATP content in a single cell level.
Earlier studies have shown that expression of autophagic genes is needed for autophagic cell death (20, 22, 29). Furthermore, the true function of autophagy, whether protective or detrimental, is still controversial in the context of cardiovascular disease. For instance, Akazawa et al. (1) developed a mouse model of diphtheria toxin-induced heart failure in which the cardiomyocytes showed abundant autophagic vacuoles, and in a hamster cardiomyopathy model induced by
-sarcoglycan deficiency, we observed severe autophagic degeneration in cardiomyocytes and found that treatment with granulocyte colony-stimulating factor mitigated both the heart failure and the associated autophagic findings (16). Autophagy may also be an adaptive or maladaptive feature of hearts subjected to pressure overload (17, 30) and was recently highlighted in ischemic heart disease, where it appears to protect ischemic cardiomyocytes (5, 15, 27). It thus appears that the determination of whether autophagy is protective or detrimental in diseased hearts will require further investigation. However, the findings of the present study suggest that the autophagic degeneration of cultured ARVCs reflects a prosurvival, compensatory response to glucose depletion and that ARVC death may represent the unsuccessful outcome due to necrosis.
 |
GRANTS
|
|---|
This study was supported by research grants from Gifu University.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: G. Takemura, Div. of Cardiology, Gifu Univ. Graduate School of Medicine, 1-1 Yanagido, Gifu 501-1194, Japan (e-mail: gt{at}gifu-u.ac.jp)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
* R. Maruyama and K. Goto contributed equally to this work. 
 |
REFERENCES
|
|---|
- Akazawa H, Komazaki S, Shimomura H, Terasaki F, Zou Y, Takano H, Nagai T, Komuro I. Diphtheria toxin-induced autophagic cardiomyocyte death plays a pathogenic role in mouse model of heart failure. J Biol Chem 279: 41095–41103, 2004.[Abstract/Free Full Text]
- Bersohn MM, Philipson KD, Fukushima JY. Sodium-calcium exchange and sarcolemmal enzymes in ischemic rabbit hearts. Am J Physiol Cell Physiol 242: C288–C295, 1982.[Abstract/Free Full Text]
- Boya P, González-Polo RA, Casares N, Perfettini JL, Dessen P, Larochette N, Métivier D, Meley D, Souquere S, Yoshimori T, Pierron G, Codogno P, Kroemer G. Inhibition of macroautophagy triggers apoptosis. Mol Cell Biol 25: 1025–1040, 2005.[Abstract/Free Full Text]
- Clarke PG. Developmental cell death: morphological diversity and multiple mechanisms. Anat Embryol (Berl) 181: 195–213, 1990.[Medline]
- Hamacher-Brady A, Brady NR, Gottlieb RA. Enhancing macroautophagy protects against ischemia/reperfusion injury in cardiac myocytes. J Biol Chem 281: 29776–29787, 2006.[Abstract/Free Full Text]
- Hein S, Arnon E, Kostin S, Schonburg M, Elsasser A, Polyakova V, Bauer EP, Klövekorn WP, Schaper J. Progression from compensated hypertrophy to failure in the pressure-overloaded human heart: structural deterioration and compensatory mechanisms. Circulation 107: 984–991, 2003.[Abstract/Free Full Text]
- Kato S, Takemura G, Maruyama R, Aoyama T, Hayakawa K, Koda M, Kawase Y, Li Y, Minatoguchi S, Fujiwara T, Fujiwara H. Apoptosis, rather than oncosis, is the predominant mode of spontaneous death of isolated adult rat cardiac myocytes in culture. Jpn Circ J 65: 743–748, 2001.[CrossRef][Medline]
- Khalid MA, Ashraf M. Direct detection of endogenous hydroxyl radical production in cultured adult cardiomyocytes during anoxia and reoxygenation. Is the hydroxyl radical really the most damaging radical species? Circ Res 72: 725–736, 1993.[Abstract/Free Full Text]
- Klionsky DJ, Emr SD. Autophagy as a regulated pathway of cellular degradation. Science 290: 1717–1721, 2000.[Abstract/Free Full Text]
- Knaapen MW, Davies MJ, De Bie M, Haven AJ, Martinet W, Kockx MM. Apoptotic versus autophagic cell death in heart failure. Cardiovasc Res 51: 304–312, 2001.[Abstract/Free Full Text]
- Kostin S, Pool L, Elsasser A, Hein S, Drexler HC, Arnon E, Hayakawa Y, Zimmermann R, Bauer E, Klövekorn WP, Schaper J. Myocytes die by multiple mechanisms in failing human hearts. Circ Res 92: 715–724, 2003.[Abstract/Free Full Text]
- Kuma A, Hatano M, Matsui M, Yamamoto A, Nakaya H, Yoshimori T, Ohsumi Y, Tokuhisa T, Mizushima N. The role of autophagy during the early neonatal starvation period. Nature 432: 1032–1036, 2004.[CrossRef][Web of Science][Medline]
- Lum JJ, Bauer DE, Kong M, Harris MH, Li C, Lindsten T, Thompson CB. Growth factor regulation of autophagy and cell survival in the absence of apoptosis. Cell 120: 237–248, 2005.[CrossRef][Web of Science][Medline]
- Maruyama R, Takemura G, Aoyama T, Hayakawa K, Koda M, Kawase Y, Qiu X, Ohno Y, Minatoguchi S, Miyata K, Fujiwara T, Fujiwara H. Dynamic process of apoptosis in adult rat cardiomyocytes analyzed using 48-hour videomicroscopy and electron microscopy: beating and rate are associated with the apoptotic process. Am J Pathol 159: 683–691, 2001.[Abstract/Free Full Text]
- Matsui Y, Takagi H, Qu X, Abdellatif M, Sakoda H, Asano T, Levine B, Sadoshima J. Distinct roles of autophagy in the heart during ischemia and reperfusion: roles of AMP-activated protein kinase and Beclin 1 in mediating autophagy. Circ Res 100: 914–922, 2007.[Abstract/Free Full Text]
- Miyata S, Takemura G, Kawase Y, Li Y, Okada H, Maruyama R, Ushikoshi H, Esaki M, Kanamori H, Li L, Misao Y, Tezuka A, Toyo-Oka T, Minatoguchi S, Fujiwara T, Fujiwara H. Autophagic cardiomyocyte death in cardiomyopathic hamsters and its prevention by granulocyte colony-stimulating factor. Am J Pathol 168: 386–397, 2006.[Abstract/Free Full Text]
- Nakai A, Yamaguchi O, Takeda T, Higuchi Y, Hikoso S, Taniike M, Omiya S, Mizote I, Matsumura Y, Asahi M, Nishida K, Hori M, Mizushima N, Otsu K. The role of autophagy in cardiomyocytes in the basal state and in response to hemodynamic stress. Nat Med 13: 619–624, 2007.[CrossRef][Web of Science][Medline]
- Nishino I, Fu J, Tanji K, Yamada T, Shimojo S, Koori T, Mora M, Riggs JE, Oh SJ, Koga Y, Sue CM, Yamamoto A, Murakami N, Shanske S, Byrne E, Bonilla E, Nonaka I, DiMauro S, Hirano M. Primary LAMP-2 deficiency causes X-linked vacuolar cardiomyopathy and myopathy (Danon disease). Nature 406: 906–910, 2000.[CrossRef][Web of Science][Medline]
- Noda T, Ohsumi Y. Tor, a phosphatidylinositol kinase homologue, controls autophagy in yeast. J Biol Chem 273: 3963–3966, 1998.[Abstract/Free Full Text]
- Pyo JO, Jang MH, Kwon YK, Lee HJ, Jun JI, Woo HN, Cho DH, Choi B, Lee H, Kim JH, Mizushima N, Oshumi Y, Jung YK. Essential roles of Atg5 and FADD in autophagic cell death: dissection of autophagic cell death into vacuole formation and cell death. J Biol Chem 280: 20722–20729, 2005.[Abstract/Free Full Text]
- Reimer KA, Jennings RB, Hill ML. Total ischemia in dog hearts, in vitro 2. High energy phosphate depletion and associated defects in energy metabolism, cell volume regulation, and sarcolemmal integrity. Circ Res 49: 901–911, 1981.[Free Full Text]
- Shimizu S, Kanaseki T, Mizushima N, Mizuta T, Arakawa-Kobayashi S, Thompson CB, Tsujimoto Y. Role of Bcl-2 family proteins in a non-apoptotic programmed cell death dependent on autophagy genes. Nat Cell Biol 6: 1221–1228, 2004.[CrossRef][Web of Science][Medline]
- Shimomura H, Terasaki F, Hayashi T, Kitaura Y, Isomura T, Suma H. Autophagic degeneration as a possible mechanism of myocardial cell death in dilated cardiomyopathy. Jpn Circ J 65: 965–968, 2001.[CrossRef][Medline]
- Shintani T, Klionsky DJ. Autophagy in health and disease: a double-edged sword. Science 306: 990–995, 2004.[Abstract/Free Full Text]
- Tanaka Y, Guhde G, Suter A, Eskelinen EL, Hartmann D, Lullmann-Rauch R, Janssen PM, Blanz J, von Figura K, Saftig P. Accumulation of autophagic vacuoles and cardiomyopathy in LAMP-2-deficient mice. Nature 406: 902–906, 2000.[CrossRef][Web of Science][Medline]
- Togi K, Yoshida Y, Matsumae H, Nakashima Y, Kita T, Tanaka M. Essential role of Hand2 in interventricular septum formation and trabeculation during cardiac development. Biochem Biophys Res Commun 343: 144–151, 2006.[CrossRef][Web of Science][Medline]
- Yan L, Vatner DE, Kim SJ, Ge H, Masurekar M, Massover WH, Yang G, Matsui Y, Sadoshima J, Vatner SF. Autophagy in chronically ischemic myocardium. Proc Natl Acad Sci USA 102: 13807–13812, 2005.[Abstract/Free Full Text]
- Yoshimori T. Autophagy: a regulated bulk degradation process inside cells. Biochem Biophys Res Commun 313: 453–458, 2004.[CrossRef][Web of Science][Medline]
- Yu L, Alva A, Su H, Dutt P, Freundt E, Welsh S, Baehrecke EH, Lenardo MJ. Regulation of an ATG7-beclin 1 program of autophagic cell death by caspase-8. Science 304: 1500–1502, 2004.[Abstract/Free Full Text]
- Zhu H, Tannous P, Johnstone JL, Kong Y, Shelton JM, Richardson JA, Le V, Levine B, Rothermel BA, Hill JA. Cardiac autophagy is a maladaptive response to hemodynamic stress. J Clin Invest 117: 1782–1793, 2007.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
H. Su and X. Wang
The ubiquitin-proteasome system in cardiac proteinopathy: a quality control perspective
Cardiovasc Res,
January 15, 2010;
85(2):
253 - 262.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Sengupta, J. D. Molkentin, and K. E. Yutzey
FoxO Transcription Factors Promote Autophagy in Cardiomyocytes
J. Biol. Chem.,
October 9, 2009;
284(41):
28319 - 28331.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2008 by the American Physiological Society.