AJP - Heart Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Heart Circ Physiol 295: H2512-H2521, 2008. First published October 31, 2008; doi:10.1152/ajpheart.00233.2008
0363-6135/08 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
295/6/H2512    most recent
00233.2008v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Asada, S.
Right arrow Articles by Oh, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Asada, S.
Right arrow Articles by Oh, H.

Downregulation of Dicer expression by serum withdrawal sensitizes human endothelial cells to apoptosis

Satoshi Asada,1,2 Tomosaburo Takahashi,1,2 Koji Isodono,1,2 Atsuo Adachi,1,2 Hiroko Imoto,1,2 Takehiro Ogata,2 Tomomi Ueyama,2 Hiroaki Matsubara,1,2 and Hidemasa Oh2

1Department of Cardiovascular Medicine, Kyoto Prefectural University of Medicine, and 2Department of Experimental Therapeutics, Translational Research Center, Kyoto University Hospital, Kyoto, Japan

Submitted 4 March 2008 ; accepted in final form 27 October 2008


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Although the modulated expression of Dicer is documented upon neoplastic transformation, little is known of the regulation of Dicer expression by environmental stimuli and its roles in the regulation of cellular functions in primary cells. In this study, we found that Dicer expression was downregulated upon serum withdrawal in human umbilical vein endothelial cells (HUVECs). Serum withdrawal induced a time-dependent repression of Dicer expression, which was specifically rescued by vascular endothelial cell growth factor or sphingosine-1-phosphate. When Dicer expression was silenced by short-hairpin RNA against Dicer, the cells were more prone to apoptosis under serum withdrawal, whereas the rate of apoptosis was comparable with control cells in the serum-containing condition. Real-time PCR-based gene expression profiling identified several genes, the expression of which was modulated by Dicer silencing, including adhesion and matrix-related molecules, caspase-3, and nitric oxide synthase 3 (NOS3). Dicer silencing markedly impaired migratory functions without affecting cell adhesion and repressed phosphorylation of focal adhesion kinase and proline-rich tyrosine kinase 2 in adherent HUVECs. Dicer knockdown upregulated caspase-3 and downregulated NOS3 expression, and serum withdrawal indeed increased caspase-3 and decreased NOS3 expression. Furthermore, the overexpression of Dicer in HUVECs resulted in a marked reduction in apoptosis upon serum withdrawal and a decreased caspase-3 and increased NOS3 expression. The inhibition of NOS activity by N{omega}-nitro-L-arginine methyl ester abrogated the effect of Dicer overexpression to rescue the cells from serum withdrawal-induced apoptosis. These results indicated that serum withdrawal decreases Dicer expression, leading to an increased susceptibility to apoptosis through the regulation of caspase-3 and NOS3 expression.

caspase 3; nitric oxide synthase 3

APOPTOSIS IS A PROCESS OF innate cellular death, controlled by complex and diverse molecular mechanisms with considerable cell-type specificity. Apoptosis plays important roles in various aspects of biology from the development to a wide range of diseases such as cancers and cardiovascular diseases. In the vasculature, the integrity of the endothelial lining is essential for vascular homeostasis and for normal organ function, and endothelial cell apoptosis has been implicated not only in normal physiological events such as blood vessel development, homeostasis, and remodeling but also in pathological conditions associated with endothelial dysfunction such as inflammatory and immune disorders, tumor growth, and atherosclerosis (31, 32, 46). Although apoptotic processes are tightly regulated by extracellular factors and intracellular signalings, the precise molecular mechanisms governing endothelial cell apoptosis have not been fully elucidated, and understanding the regulation of apoptosis is of great importance for the advancement of endothelial biology and for developing novel therapeutic strategies.

Dicer is a cytoplasmic RNase III enzyme, which cleaves microRNA (miRNA) and small-interfering RNA (siRNA) precursors into about 22 nucleotide species (17, 45). The function of Dicer in the biogenesis of small RNAs is central to miRNA and RNA interference pathways, and Dicer presumably mediates the processing of all miRNAs and endogenous siRNAs. In their short mature forms, miRNA and siRNA function to regulate gene expression through the posttranscriptional regulation of protein-coding gene expression (2, 9). In mammals, most miRNAs mediate translational repression by forming an imperfect base pairing to 3' untranslated regions of target mRNAs, whereas siRNAs induce target mRNA degradation through establishing a perfect pairing, which can occur throughout the message. The human genome encodes hundreds of miRNAs, which are estimated to regulate the expression of as many as 30% of protein-coding genes (2). Dicer transcript is expressed from the embryonic through adult stages of development and is also present in a wide variety of adult organs, whereas the expression levels vary between organs (50).

In addition to being important in miRNA and RNA interference pathways, Dicer is shown to be crucial in controlling cell cycle checkpoints, especially in response to mutagenic stress (5, 41), proper structuring of centromeric heterochromatin (13), and organization of the germ line (36). Dicer null mutation in mice shows embryonic lethal phenotype at E 7.5 (4), and Dicer-deficient embryonic stem cells are defective in differentiation both in vivo and in vitro (35). Although these results indicate the important role of Dicer in development and stem cell maintenance, Dicer could have functions specific for differentiated cell types. For example, a specific deletion of Dicer in T-cell lineage results in aberrant T-cell differentiation and cytokine production, whereas the transcriptional gene silencing during CD4/8 differentiation is not perturbed (33). The inactivation of Dicer activity in skin progenitors results in an abnormal epithelium morphogenesis (1), and Dicer inactivation in lung epithelium leads to dramatic branching defects in lung (19). Recent reports identified Dicer as an important component to control endothelial functions related to angiogenesis such as proliferation, migration, and morphological differentiation into capillary-like structure (26, 47, 50). However, little is known about the regulation of Dicer expression by environmental stimuli and its roles in the regulation of cellular functions in endothelial cells.

Here, to uncover functions of Dicer in endothelial biology, we first explored the condition that modulated the expression of Dicer in human umbilical vein endothelial cells (HUVECs) and found that serum withdrawal induced the reduction in Dicer expression. Silencing Dicer expression by short-hairpin (sh)RNA led to an increased susceptibility of endothelial cells to apoptosis, and an overexpression of Dicer protected cells from apoptosis induced by serum deprivation. Furthermore, caspase-3 and nitric oxide synthase 3 (NOS3) expression was modulated by Dicer expression. These results indicated that a regulation of Dicer expression involves an apoptotic response of endothelial cells to serum withdrawal.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Cell culture. HUVECs (Clonetics) were cultured in RPMI-1640 medium supplemented with 20% fetal bovine serum (FBS), 40 µg/ml endothelial cell growth supplement (BD Biosciences), heparin, and penicillin-streptomycin on 0.5% gelatin-coated dishes and used between passages 2 and 5 for all experiments as described previously (42). Human foreskin fibroblasts (Riken Cell Bank) were cultured in DMEM supplemented with 10% FBS. To induce apoptosis, confluent HUVECs were cultured in the medium without serum and endothelial cell growth supplement for the indicated period of time.

Kinetic real-time RT-PCR. cDNA was synthesized and analyzed by kinetic real-time PCR with the ABI Prism 7700 Sequence Detector system (Applied Biosystems) and Platinum SYBR Green qPCR SuperMix (Invitrogen) as described previously (24, 37). Human β-tubulin was used for normalization, and the comparative threshold method was used to assess the relative abundance of the targets. The primers used were Dicer-f, TGGGTCCTTTCTTTGGACTG; Dicer-r, CTGGTTTGCAGAGTTGACCA; caspase-3-f, TGGAATTGATGCGTGATGTT; caspase-3-r, GGCAGGCCTGAATAATGAAA; NOS3-f, ACCCTCACCGCTACAACATC; NOS3-r, GCTCATTCTCCAGGTGCTTC; β-tubulin-f, CTCTGAAGCTGACCACACCA; and β-tubulin-r, GCCAGGCATAAAGAAATGGA.

Immunoblot analysis. Cell lysates containing equal amounts of protein were electrophoresed on SDS-polyacrylamide gels and transferred to polyvinylidene difluoride membranes (Millipore). Blots were immunoblotted with the primary antibody against Dicer (Abcam), phospho-proline-rich tyrosine kinase 2 (PYK2) (Biosource), PYK2 (BD Biosciences), phospho-focal adhesion kinase (FAK), FAK, phospho-Src, Src, phospho-ERK, ERK, phospho-p38-MAPK, p38-MAPK, phospho-JNK, JNK, caspase-3 (Cell Signaling), NOS3 (Santa Cruz), or GAPDH (Chemicon), and horseradish peroxidase-conjugated anti-mouse or -rabbit IgG as a secondary antibody, followed by enhanced chemiluminescence (GE Healthcare) (24, 37).

Short-hairpin RNA interference. Short-interfering RNA constructs (shRNA) was made with RNAi-Ready pSIREN-RetroQ vector (Clontech). To knockdown endogenous Dicer expression, we used the published sequences of siRNA, which is shown to specifically silence Dicer expression in various types of cells including HUVECs (7, 16, 47). Sense (ACATCAAGGTGCTAATAGA) and antisense oligonucleotides corresponding to nucleotides 3581–3599 of the human Dicer cDNA was cloned into pSIREN-RetroQ vector with the hairpin loop sequence of TTCAAGAGA, according to the manufacturer's instruction. pSIREN-RetroQ control Si vector (Clontech) was used as a control.

Retrovirus production and infection. GP2-293 cells (Clontech) were cotransfected with envelop vector pVSV-G and each pSIREN-RetroQ vector using FuGENE6 (Roche) (37). After 24 h, the medium was exchanged, and the medium containing the emerging retrovirus was harvested 48 h after transfection, filtered, and then incubated with HUVECs in the presence of 6 µg/ml polybrene for 6 h. Twenty-four hours later, the retroviral supernatant was harvested for a second time, and HUVECs were infected again (30). HUVECs were then selected with 0.5 µg/ml puromycin for 3 days. The transfection efficiency for HUVECs was almost 100%, when assessed with enhanced green fluorescent protein-expressing retrovirus.

Northern blot analysis. Total RNA samples were electrophoresed on denaturing 15% polyacrylamide gels and electroblotted onto GeneScreen Plus membranes (Perkin-Elmer) as described previously (37). The membranes were UV-cross-linked, baked, and hybridized with 32P end-labeled oligonucleotide DNA probes in ULTRAhyb-Oligo (Ambion). After a washing, hybridization signals were detected using the Bio-imaging analyzer system BAS5000 (Fuji Film). Human U6 was used as an internal control.

Quantitative RT-PCR for miRNA. Quantitative real-time PCR for miRNA was carried out using TaqMan MicroRNA assays (Applied Biosystems) with ABI Prism 7700 Sequence Detector system (Applied Biosystems) according to the manufacturer's instruction. These assays only detect mature miRNAs but not primary or precursor forms of miRNAs. For normalization, 18s rRNA was used, and the comparative threshold method was used to assess the relative abundance of the targets.

Transferase-mediated biotinylated UTP nick-end labeling assay. Apoptotic cells were detected by in situ terminal deoxynucleotidyl transferase-mediated biotinylated UTP nick-end labeling (TUNEL) assay using ApopTag Red In Situ Apoptosis Detection Kit (Chemicon) (48). In brief, HUVECs cultured on collagen type 1-coated two-well culture slide (BD Biosciences) were fixed, and fragmented DNA was labeled with digoxigenin-labeled deoxyNTP in the presence of terminal deoxynucleotidyl transferase enzyme, followed by staining with rhodamine-conjugate anti-digoxigenin antibody. Cells were nuclear stained with 4',6'-diamidino-2-phenylindole (DAPI, Dojindo) and mounted using PermaFluor Mountant Medium (Thermo Scientific). The TUNEL-positive and total nuclei were counted under a fluorescent microscope (IX71, Olympus) in five view fields per well.

Gene expression analysis by PCR array. RT2 Profiler PCR Array (SuperArray Bioscience) was used to examine the expression pattern of genes involved in endothelial cell biology. The array consists of 84 genes involved in endothelial cell biology as well as five housekeeping genes, and an analysis was carried out according to the manufacturer's instruction.

Adhesion assay. Four-hundred microliters of cell suspension containing 4 x 104 cells in serum-free medium was placed in each well of 24-well plates coated with 0.5% gelatin or 1 µg/ml human fibronectin (BD Biosciences). After the cells were allowed to adhere for 30 min, loosely adherent or unbound cells were removed by washing the wells with PBS, and the adherent cells were fixed and stained with DAPI. The nuclei of adherent cells were counted under the fluorescent microscope in five view fields per well.

Migration assay. Transwell migration was analyzed in a modified Boyden chamber assay using BioCoat 24-multiwell insert system (BD Biosciences) with a 3-µm pore-size PET membrane coated with human fibronectin. HUVECs (1.0 x 105), suspended in RPMI 1640 medium containing 1% FBS, were added to the upper compartment of the membrane. Culture medium containing 10 ng/ml vascular endothelial cell growth factor (VEGF) was used as a chemoattractant and placed in the lower compartment. After incubation for 4 h, the membranes were fixed and stained with DAPI (Dojindo), and the cells attached to the bottom side of the membrane were counted under the microscope (IX71, Olympus).

Lateral migration was assessed by a wound healing assay (42). Confluent monolayers of HUVECs were wounded with a pipette tip. Twenty hours later, wound closure was quantified by the percent change in the wound area and averaged for three locations per well from a triplicate set of samples for each experimental condition.

Transfection. For an overexpression of Dicer, HUVECs were grown to 60% to 70% confluence and transfected with pDH105 Dicer expression vector (a kind gift from Jason Myers, Stanford University) using Lipofectamine LTX Reagent and PLUS Reagent (Invitrogen). HUVECs were incubated with DNA-lipofectamine LTX complexes at 37°C for 2 h in the absence of serum, followed by a recovery in the presence of 20% FBS. pMSCV-puro GFP vector was used as a control, and maximal levels of protein expression were observed between 48 and 72 h.

Statistical analysis. All experiments were performed at least three times. Data were expressed as means ± SE and analyzed by unpaired Student's t-test for comparisons between two groups or one-way ANOVA with post hoc analysis for multiple comparisons. A value of P < 0.05 was considered statistically significant.


   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
Serum withdrawal leads to the reduction in Dicer expression in endothelial cells. Although Dicer is shown to be involved in several important functions of endothelial cells, little is known about the regulation of Dicer expression in endothelial cells. Therefore, we first explored the condition that modulated the expression of Dicer in HUVECs and found that serum withdrawal induced a significant reduction in Dicer mRNA and protein expression (Fig. 1A). Dicer was expressed in HUVECs, and upon serum withdrawal, Dicer expression was reduced in a time-dependent manner (Fig. 1A). The reduction in Dicer expression was readily detectable 12 h after serum withdrawal, and Dicer expression was gradually decreased up to 48 h after serum withdrawal, whereas the expression of GAPDH remained unchanged. To characterize the serum components responsible for maintaining Dicer expression in HUVECs, the cells were cultured with VEGF, basic fibroblast growth factor (bFGF), sphingosine-1-phosphate (S1P), or lysophosphatidic acid (LPA) in serum-free medium for 48 h, and the Dicer expression was analyzed. As shown in Fig. 1B, VEGF and S1P, but not bFGF and LPA, rescued serum withdrawal-induced downregulation of Dicer expression. We also tested whether serum withdrawal affected Dicer expression in human fibroblasts. In fibroblasts, serum withdrawal also reduced Dicer expression (Fig. 1C). These results indicated that upon serum withdrawal, Dicer expression is downregulated in HUVECs, and VEGF and S1P could play a role to maintain Dicer expression.


Figure 1
View larger version (22K):
[in this window]
[in a new window]

  		Fig. 1. Serum withdrawal decreases Dicer expression in endothelial cells. Naïve human umbilical vein endothelial cells (HUVECs) or human fibroblasts were grown to be confluent in complete medium and then replaced with serum-free (SF) medium for the indicated periods of time. A: mRNA expression of Dicer in HUVECs was analyzed by kinetic real-time PCR. The results from at least 3 independent trials were expressed relative to the level of β-tubulin and plotted as percentages of the control. *P < 0.05 vs. control. Protein expression of Dicer was examined by immunoblot analysis. The membranes were reprobed with anti-GAPDH antibody. B: confluent HUVECs were cultured with or without 20% FBS, 10 ng/ml VEGF, 10 ng/ml basic fibroblast growth factor (bFGF), 10 µM sphingosine-1-phosphate (S1P), or 10 µM lysophosphatidic acid (LPA) for 48 h, and mRNA and protein expression of Dicer was analyzed. *P < 0.05 vs. FBS. C: human fibroblasts were cultured in serum-free medium for the indicated periods of time, and mRNA and protein expression of Dicer was analyzed. *P < 0.05 vs. control. Blots shown represent 1 of at least 3 independent trials that gave nearly identical results.

 
Silencing Dicer expression impairs miRNAs processing. In mice and humans, Dicer is encoded by a single locus, the protein product of which could account for all Dicer activity. To investigate the functional significance of Dicer expression in endothelial cells, we generated a retrovirus vector expressing shRNA against Dicer. Upon infection with this Dicer shRNA-expressing retrovirus, Dicer expression in HUVECs was downregulated by ~70% in mRNA expression (Fig. 2A), and the protein expression of Dicer was barely undetectable in immunoblot analysis (Fig. 2B). The expression of Dicer mRNA and protein in cells infected with retrovirus expressing control shRNA was comparable with that in naïve noninfected cells (Fig. 2, A and B).


Figure 2
View larger version (30K):
[in this window]
[in a new window]

  		Fig. 2. Silencing Dicer expression impairs microRNA (miRNA) processing. Cells were infected or not infected with retrovirus expressing control or Dicer short-hairpin (sh)RNA. A: Dicer mRNA expression was examined by kinetic real-time PCR in naïve, control shRNA (Cont SH) or Dicer shRNA HUVECs. The results were expressed as relative expression to β-tubulin and plotted as ratios of the control shRNA HUVECs. *P < 0.05 vs. control shRNA cells. B: immunoblot analysis was performed to analyze Dicer protein expression. C: expression of let-7a and miR-221 was analyzed by Northern blot analysis, and U6 was used as a loading control. D: quantitative real-time PCR for miRNA was performed for let-7a and miR-221 expression, and the results were expressed as ratios of the control shRNA HUVECs. *P < 0.05 vs. control shRNA cells.

 
As Dicer is known to be critical for pre-miRNA processing, we examined the expression of let-7a and miR-221, two miRNAs abundantly expressed in HUVECs (26, 40). In noninfected naïve cells and control shRNA-expressing cells, Northern blot analysis revealed that these two miRNAs were detectable as strong and faster migrating bands for their mature forms and as faint and slower migrating bands for their precursors (Fig. 2C). Dicer knockdown led to a significant decrease in the accumulation of mature miRNAs and an increase in the precursors of these miRNAs (Fig. 2C). The reduction in the accumulation of mature miRNAs was also verified by real-time PCR for miRNA, which only detects mature forms of miRNAs (Fig. 2D). These results indicated that Dicer is indispensable for miRNA processing from the pre-miRNA to mature forms in endothelial cells, and Dicer knockdown compromises the maturation of miRNAs, resulting in a reduced expression of mature miRNAs.

Silencing Dicer expression results in susceptibility of endothelial cells to apoptosis in response to serum deprivation. As the withdrawal of survival factors has been demonstrated to cause apoptosis of endothelial cells and as serum withdrawal reduced the expression of Dicer (Fig. 1), the effect of silencing Dicer expression on apoptosis in response to serum withdrawal was examined. When Dicer expression was silenced by retrovirus-mediated expression of shRNA, the percentage of apoptotic cells was markedly increased compared with control shRNA cells in a serum-starved condition, whereas the proportion of apoptotic cells remained unchanged in a serum-containing condition (Fig. 3, A and B). These results suggested that a reduced expression of Dicer conferred the cells susceptibility to apoptosis under the stress of serum deprivation.


Figure 3
View larger version (27K):
[in this window]
[in a new window]

  		Fig. 3. Silencing Dicer expression sensitizes endothelial cells to apoptosis in response to serum withdrawal. Control shRNA and Dicer shRNA HUVECs were cultured in the presence or absence of serum for 12 h. A: transferase-mediated biotinylated UTP nick-end labeling (TUNEL) staining was carried out to examine apoptosis in control shRNA and Dicer shRNA HUVECs. DAPI, 4',6'-diamidino-2-phenylindole. B: TUNEL-positive and total nuclei in control shRNA and Dicer shRNA HUVECs were quantified, and the proportion of TUNEL-positive cells was plotted. *P < 0.05 vs. control shRNA cells.

 
Dicer silencing modulates expression of multiple genes including caspase 3 and NOS3. To explore the effect of reduced expression of Dicer on gene expression involved in endothelial biology, we used real-time PCR-based gene expression profiling to compare the gene expression profiles in control and Dicer shRNA-expressing cells and identified several genes, the expression of which was significantly modulated by Dicer silencing (Fig. 4A). Among them, a modulated expression of NOS3 and caspase-3 was further verified at the mRNA level by real-time kinetic PCR with other sets of primers than those used in a PCR array and at the protein level by immunoblotting (Fig. 4B). Dicer silencing induced a significant increase in caspase-3 expression and a decrease in NOS3 expression (Fig. 4B). These results indicated that a reduced expression of Dicer affects the expression of multiple genes involved in endothelial biology and suggested that an altered expression of caspase-3 and NOS3 was involved in the susceptibility to apoptosis of endothelial cells.


Figure 4
View larger version (19K):
[in this window]
[in a new window]

  		Fig. 4. Dicer silencing alters the expression profiles of genes related to endothelial biology. A: real-time PCR-based gene expression profiling was used to compare the gene expression in control and Dicer shRNA HUVECs. Data were expressed as fold change from control to Dicer-silenced cells. Genes with P < 0.05 vs. control were listed. MMP2, matrix metalloproteinase-2; ITGB1, integrin-β1; ITGAV, integrin-{alpha}v; FN1, fibronectin-1; EDNRA, endothelin receptor type A; EDN1, endothelin-1; COL18A1, collagen type XVIII-{alpha}1; CDH5, cadherin 5. B: expression of caspase-3 (Casp3) and nitric oxide synthase 3 (NOS3) was further verified at mRNA level by real-time kinetic PCR with other sets of primers than those used in PCR array and at protein level by immunoblotting with specific antibodies. *P < 0.05 vs. control shRNA cells.

 
Dicer silencing impairs migratory functions and adhesion-mediated phosphorylation of FAK and PYK2. As the modulated expression of adhesion and extracellular matrix-related molecules was observed in gene expression profiling (Fig. 4A), the adhesive and migratory functions of HUVECs were analyzed. An adhesion assay revealed that the adhesiveness of cells to gelatin- or fibronectin-coated dishes was not significantly altered by Dicer silencing (Fig. 5A). However, the migratory functions assessed by a Boyden chamber assay and wound healing assay were largely impaired in Dicer knockdown cells (Fig. 5, B and C). Furthermore, the phosphorylation of FAK and PYK2 was diminished by Dicer knockdown in adherent HUVECs, whereas the activation of Src, Akt, and MAPKs such as ERK, p38 MAPK, and JNK was not affected (Fig. 5D). Thus Dicer silencing impaired migratory functions and adhesion-mediated phosphorylation of FAK and PYK2.


Figure 5
View larger version (22K):
[in this window]
[in a new window]

  		Fig. 5. Dicer silencing impairs migratory functions and adhesion-mediated phosphorylation of focal adhesion kinase (FAK) and proline-rich tyrosine kinase 2 (PYK2). A: cell adhesion to gelatin- or fibronectin-coated dishes was analyzed in control and Dicer shRNA HUVECs. B: chemotactic activity to VEGF was assessed by modified Boyden chamber assay in control and Dicer shRNA HUVECs. *P < 0.05 vs. control shRNA cells. C: lateral migration was assessed by wound healing assay in control and Dicer shRNA HUVECs. *P < 0.05 vs. control shRNA cells. D: phosphorylation of FAK, PYK2, Src, Akt, ERK, p38 MAPK, and JNK was analyzed by immunoblot analysis with phosphospecific and total antibodies. Blots shown represent 1 of at least 3 independent trials that gave nearly identical results.

 
Serum withdrawal results in an increase in caspase-3 expression and a decrease in NOS3 expression. In the next sets of experiments, it was analyzed whether serum withdrawal, which decreased Dicer expression (Fig. 1), modulated caspase-3 and NOS3 expression in endothelial cells. As shown in Fig. 6, serum starvation indeed increased caspase-3 expression and decreased NOS3 expression in a time-dependent manner. These results suggested that a reduction in endogenous Dicer expression in response to serum deprivation was involved in the regulation of caspase-3 and NOS3 expression.


Figure 6
View larger version (12K):
[in this window]
[in a new window]

  		Fig. 6. Serum withdrawal increases caspase-3 and decreases NOS3 expression in endothelial cells. A: protein expression of caspase-3 (A) or NOS3 (B) was analyzed by immunoblot analysis with anti-caspase-3 or NOS3 antibody. GAPDH was served as a loading control.

 
Overexpression of Dicer protects endothelial cells from apoptosis induced by serum withdrawal. To analyze the functional significance of the reduced expression of Dicer in response to serum withdrawal, Dicer was overexpressed in endothelial cells, and the apoptotic response to serum withdrawal was assessed. Cells overexpressing Dicer were resistant to apoptosis in response to serum deprivation, and the rate of apoptosis in the serum-deprived condition was reduced to the level comparable with the serum-containing condition in Dicer-overexpressing cells (Fig. 7A). These results clearly indicated that the expression of Dicer regulates the susceptibility of endothelial cells to apoptosis in response to serum withdrawal. Furthermore, Dicer overexpression reduced caspase-3 expression and enhanced the expression of NOS3, suggesting the regulatory role of the Dicer expression level in caspase-3 and NOS3 expression in endothelial cells.


Figure 7
View larger version (21K):
[in this window]
[in a new window]

  		Fig. 7. Overexpression of Dicer protects endothelial cells from apoptosis induced by serum withdrawal and alters caspase-3 and NOS3 expression. A: HUVECs overexpressing enhanced green fluorescent protein (EGFP) or Dicer was cultured with or without serum for 24 h, and apoptotic rate was analyzed by TUNEL staining. *P < 0.05 vs. EGFP-expressing cells. B: protein expression of caspase-3 and NOS3 was examined in HUVECs overexpressing EGFP or Dicer. C: cells were transfected with the vector expressing EGFP or Dicer and, after 48 h, treated with or without 1 mM N{omega}-nitro-L-arginine methyl ester (L-NAME) for 24 h in the presence or absence of serum. Apoptotic rate was examined by TUNEL staining and plotted. *P < 0.05 vs. EGFP-expressing cells. #P < 0.05 vs. Dicer-overexpressing cells without L-NAME.

 
To examine the role of the enhanced expression of NOS3 in Dicer-overexpressing cells in protecting from apoptosis, the effect of N{omega}-nitro-L-arginine methyl ester (L-NAME), a NOS inhibitor, on the reduced apoptotic response by Dicer overexpression was analyzed. L-NAME treatment significantly blocked the effect of Dicer overexpression to rescue the cell from apoptosis induced by serum withdrawal (Fig. 7C), implying that the enhanced expression of NOS3 by Dicer overexpression plays an important role in the protective effect of Dicer expression.


   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
Although the roles of Dicer in several important cellular functions are reported, most of these results are based on the experiments in which Dicer expression is modulated with a genetic modification in mice or a gene silencing with siRNA in cells, and little is known whether Dicer expression is regulated in certain circumstances. An aberrant expression of Dicer has been most demonstrated in several neoplasms. An increased expression of Dicer is reported in Burkitt's lymphoma-derived cell line EB-3 (22) and prostate adenocarcinomas (8). In the latter case, Dicer expression is shown to correlate with aggressive clinical features. On the other hand, in non-small lung carcinomas, the reduced expression of Dicer is associated with shorter postoperative survival (21). Expression profiling of miRNA revealed a global repression of miRNA expression in cancer samples and cell lines (15, 29). A recent report has shown that Dicer knockdown results in an increased colony formation in culture and an increased tumor growth in vivo only in cells that are already transformed, whereas a reduction in Dicer leads to slow growth kinetics in primary cells (27). These results indicate that the effect of the modulated expression of Dicer is cell-type and context dependent and imply the importance of elucidating the conditions that alter the expression of Dicer and its consequences in specialized cells. In endothelial cells, it has been reported that Dicer is constitutively expressed (26, 47), and its expression is not altered by a stimulation with VEGF (47). In this study, we found that serum withdrawal, a stress of trophic factor deprivation, markedly repressed Dicer expression in HUVECs. We also demonstrated that VEGF and S1P, but not bFGF and LPA, rescued the downregulation of Dicer expression induced by serum withdrawal. VEGF and S1P are well-known polypeptide and lipid mediators that modulate many important endothelial functions including proliferation, chemotactic responses, angiogenic morphogenesis, and inhibition of apoptosis (12, 25, 39). While bFGF and LPA are also shown to have similar properties in endothelial cells (34, 39, 43), VEGF and S1P specifically maintained Dicer expression in HUVECs. The elucidation of the molecular mechanisms responsible for the maintenance of Dicer expression specifically by VEGF and S1P will be an important issue to fully clarify how Dicer expression is regulated.

Serum withdrawal is an established technique for apoptosis induction in nontransformed cells and has been widely used as an initiator of endothelial apoptosis because of its reproducible effects. Although the pathophysiological conditions correlating to serum withdrawal-induced endothelial apoptosis is uncertain, it is also unclear whether endothelial apoptosis in the settings of pathophysiological states is induced by proapoptotic factors or by the absence of protective, survival factors (32, 46). Therefore, in this study, we focused on the role of a repressed expression of Dicer by serum withdrawal in apoptosis in endothelial cells. However, a diminished expression of Dicer may not be a general feature induced by apoptosis-inducing stimuli in endothelial cells. We observed that oxidized LDL upregulated Dicer expression (S. Asada and T. Takahashi, unpublished observations), whereas oxidized LDL induces not only apoptotic cell death but also inflammatory responses in endothelial cells (10, 14). Thus the regulation of Dicer expression is stimulus specific, which could have a different functional significance in endothelial pathophysiology.

Our results indicated that silencing Dicer resulted in a greater apoptotic rate in response to serum withdrawal, whereas an overexpression of Dicer markedly reduced serum deprivation-induced apoptosis in endothelial cells. These results revealed that the expression level of Dicer plays an important role in determining the endothelial cell fate. However, neither silencing nor overexpression of Dicer influenced endothelial apoptosis in the serum-containing condition. This observation was in agreement with the previous report in which Dicer knockdown is shown not to impair the endothelial cell viability in the presence of serum (26). In several models such as Dicer inactivation in limb mesoderm, epidermis, and myoblasts in vivo, the inactivation of Dicer has been shown to result in an increased apoptosis (1, 18, 38). In vivo, the cells are continuously exposed to diverse stresses from their local microenvironment such as mechanical and chemical stresses and exposure to various extracellular factors, and programmed cell death occurring in a variety of cell types during embryogenesis is thought to be required for proper developmental processes and maintaining homeostasis (20). A very recent study demonstrated that a targeted deletion of Dicer in cardiac myocytes results in the development of heart failure in a short period of time after birth, whereas new born mice are indistinguishable from wild-type littermates (6). The increased apoptosis is also observed in the Dicer knockout hearts of P2 mice, although no increase in apoptosis is detected before P0 (6). These results and ours suggested that the reduced expression of Dicer sensitizes the cells to apoptosis under stresses rather than initiates or triggers the apoptotic response.

Our gene expression analysis revealed that Dicer silencing in endothelial cells modulated the expression of several genes involved in endothelial biology. These included NOS3, matrix metalloproteinase (MMP) 2, integrins-{alpha}v and -β1, fibronectin, endothelin receptor type A, endothelin 1, vascular endothelial-cadherin, and caspase-3. Both integrins-{alpha}v and -β1 are implicated in angiogenesis and endothelial survival (46), and MMP-2 participates in autocrine processes that determine the migration as well as the apoptotic death of endothelial cells induced by hypoxia (3). Vascular endothelial-cadherin is also shown to be involved in endothelial survival through intercellular interactions (11). Our results showed that the migratory activities of HUVECs were impaired by Dicer knockdown, whereas the adhesive properties to gelatin or fibronectin were preserved. Furthermore, cell adhesion-mediated signaling pathways such as tyrosine phosphorylation of FAK and PYK2 in adhesive cells were also diminished by Dicer silencing. Although these adhesion-mediated signaling pathways are shown to participate in cell survival through downstream kinases such as Akt (44, 51, 52), Dicer knockdown did not alter the phosphorylation and activation of Src, Akt, and MAPKs such as ERK, p38-MAPK, and JNK. Thus, although a disregulated expression of adhesion and matrix-related molecules might be involved in the reduced phosphorylation of FAK and PYK2, it remains to be determined whether the modulation of adhesion-mediated signaling pathways participates in an increased susceptibility to apoptosis induced by serum withdrawal.

In this study, we demonstrated that the expression of NOS3 and caspase-3, two proteins critically involved in endothelial biology and apoptosis, was modulated by serum withdrawal. Caspase-3 is a member of the cysteine-aspartic acid protease (caspase) family, which is considered to be central in the execution of apoptosis, whereas the requirement of caspase-3 for apoptosis is tissue and stimulus dependent (49). In endothelial cells, caspase-3 activation is an important mechanism in serum withdrawal-induced endothelial apoptosis (28). In Dicer-silenced cells, caspase-3 expression is upregulated, and Dicer overexpression suppressed the expression of caspase-3. Furthermore, serum withdrawal, which induced the repression of Dicer expression, indeed increased the expression of caspase-3. It has been reported that mice overexpressing caspase-3 are phenotypically normal under physiological conditions, while exhibiting increased apoptosis in response to ischemia-reperfusion injury, implying the role of an increased expression of caspase-3 in the increased susceptibility to degenerative insults (23). These results indicated the causative role of Dicer repression in caspase-3 upregulation in response to serum withdrawal and suggested that the upregulation of caspase-3 in the settings of Dicer downregulation involves an increased sensitivity to apoptosis.

Our results also demonstrated that the knockdown of Dicer reduced the expression of NOS3. This seems conflicting to the previous report by Suárez et al. (47) that Dicer silencing results in an increased expression of NOS3, although Dicer silencing showed a similar increase in collagen type XVIII-{alpha}1, integrin-{alpha}v, and MMP-2 expression in both our and their studies. While the precious mechanism producing the difference in NOS3 expression is unknown, the discrepancy might be due to the selecting of different methods to silence Dicer expression. In our study, we generated retrovirus expressing shRNA against Dicer, and the gene expression was analyzed after an antibiotic selection of cells stably expressing shRNA, whereas Suárez et al. used a transient transfection of synthetic siRNA against Dicer, and NOS3 expression was analyzed up to 72 h after transfection, which could produce different levels and kinetics of Dicer silencing. Since we did not see a transient upregulation of NOS3 expression after infecting retrovirus expressing shRNA against Dicer (data not shown), analyzing the gene expression at different time points between studies might not account for the difference in the results. Our results with the overexpression of Dicer showed the upregulation of NOS3 expression, and NOS3 expression was downregulated upon serum withdrawal in concomitance with the downregulation of Dicer expression, indicating that Dicer expression is critically involved in the regulation of NOS3 expression. Further studies are needed to clarify the molecular mechanisms responsible for the regulation of NOS3 expression by Dicer expression, which might help explain the difference in NOS3 expression in Dicer-silenced cells.

In this study, we demonstrated for the first time that serum withdrawal reduced the expression of Dicer, which was involved in the regulation of caspase-3 and NOS3 expression and apoptosis in human endothelial cells. As previous reports identified Dicer as an important component to regulate angiogenesis (26, 47, 50), Dicer regulates diverse aspects of endothelial cell biology from a life and death decision and a proliferation to the morphological differentiation to form capillary-like structure. An identification of the regulatory mechanisms of Dicer expression and activity and the downstream targets of Dicer will be important issues to fully clarify the roles of Dicer in endothelial functions.


   GRANTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
This work was supported by grants-in-aid from the Ministry of Education, Culture, Sports, Science and Technology of Japan and grants-in-aid from the Ministry of Health, Labor and Welfare of Japan.


   ACKNOWLEDGMENTS
 
We thank M. Kuramoto for expert technical assistance and Jason Myers for providing an expression vector of Dicer.


   FOOTNOTES
 

Address for reprint requests and other correspondence: T. Takahashi, Dept. of Cardiovascular Medicine, Kyoto Prefectural Univ. of Medicine, 465 Kajii-cho Kawaramachi-Hirokoji, Kamigyo-ku, Kyoto 602-8566, Japan (e-mail: ttaka{at}koto.kpu-m.ac.jp)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Andl T, Murchison EP, Liu F, Zhang Y, Yunta-Gonzalez M, Tobias JW, Andl CD, Seykora JT, Hannon GJ, Millar SE. The miRNA-processing enzyme dicer is essential for the morphogenesis and maintenance of hair follicles. Curr Biol 16: 1041–1049, 2006.[CrossRef][Web of Science][Medline]
  2. Bartel DP. MicroRNAs: genomics DP, biogenesis, mechanism, function. Cell 116: 281–297, 2004.[CrossRef][Web of Science][Medline]
  3. Ben-Yosef Y, Miller A, Shapiro S, Lahat N. Hypoxia of endothelial cells leads to MMP-2-dependent survival and death. Am J Physiol Cell Physiol 289: C1321–C1331, 2005.[Abstract/Free Full Text]
  4. Bernstein E, Kim SY, Carmell MA, Murchison EP, Alcorn H, Li MZ, Mills AA, Elledge SJ, Anderson KV, Hannon GJ. Dicer is essential for mouse development. Nat Genet 35: 215–217, 2003.[CrossRef][Web of Science][Medline]
  5. Carmichael JB, Provost P, Ekwall K, Hobman TC. ago1 and dcr1, two core components of the RNA interference pathway, functionally diverge from rdp1 in regulating cell cycle events in Schizosaccharomyces pombe. Mol Biol Cell 15: 1425–1435, 2004.[Abstract/Free Full Text]
  6. Chen JF, Murchison EP, Tang R, Callis TE, Tatsuguchi M, Deng Z, Rojas M, Hammond SM, Schneider MD, Selzman CH, Meissner G, Patterson C, Hannon GJ, Wang DZ. Targeted deletion of Dicer in the heart leads to dilated cardiomyopathy and heart failure. Proc Natl Acad Sci USA 105: 2111–2116, 2008.[Abstract/Free Full Text]
  7. Chendrimada TP, Gregory RI, Kumaraswamy E, Norman J, Cooch N, Nishikura K, Shiekhattar R. TRBP recruits the Dicer complex to Ago2 for microRNA processing and gene silencing. Nature 436: 740–744, 2005.[CrossRef][Web of Science][Medline]
  8. Chiosea S, Jelezcova E, Chandran U, Acquafondata M, McHale T, Sobol RW, Dhir R. Up-regulation of dicer, a component of the MicroRNA machinery, in prostate adenocarcinoma. Am J Pathol 169: 1812–1820, 2006.[Abstract/Free Full Text]
  9. Du T, Zamore PD. microPrimer: the biogenesis and function of microRNA. Development 132: 4645–4652, 2005.[Abstract/Free Full Text]
  10. Dunn S, Vohra RS, Murphy JE, Homer-Vanniasinkam S, Walker JH, Ponnambalam S. The lectin-like oxidized low-density-lipoprotein receptor: a pro-inflammatory factor in vascular disease. Biochem J 409: 349–355, 2008.[CrossRef][Medline]
  11. Erez N, Zamir E, Gour BJ, Blaschuk OW, Geiger B. Induction of apoptosis in cultured endothelial cells by a cadherin antagonist peptide: involvement of fibroblast growth factor receptor-mediated signalling. Exp Cell Res 294: 366–378, 2004.[CrossRef][Web of Science][Medline]
  12. Ferrara N, Gerber HP, LeCouter J. The biology of VEGF and its receptors. Nat Med 9: 669–676, 2003.[CrossRef][Web of Science][Medline]
  13. Fukagawa T, Nogami M, Yoshikawa M, Ikeno M, Okazaki T, Takami Y, Nakayama T, Oshimura M. Dicer is essential for formation of the heterochromatin structure in vertebrate cells. Nat Cell Biol 6: 784–791, 2004.[CrossRef][Web of Science][Medline]
  14. Galle J, Hansen-Hagge T, Wanner C, Seibold S. Impact of oxidized low density lipoprotein on vascular cells. Atherosclerosis 185: 219–226, 2006.[CrossRef][Web of Science][Medline]
  15. Gaur A, Jewell DA, Liang Y, Ridzon D, Moore JH, Chen C, Ambros VR, Israel MA. Characterization of microRNA expression levels and their biological correlates in human cancer cell lines. Cancer Res 67: 2456–2468, 2007.[Abstract/Free Full Text]
  16. Gupta A, Gartner JJ, Sethupathy P, Hatzigeorgiou AG, Fraser NW. Anti-apoptotic function of a microRNA encoded by the HSV-1 latency-associated transcript. Nature 442: 82–85, 2006.[Web of Science][Medline]
  17. Hammond SM. Dicing and slicing: the core machinery of the RNA interference pathway. FEBS Lett 579: 5822–5829, 2005.[CrossRef][Web of Science][Medline]
  18. Harfe BD, McManus MT, Mansfield JH, Hornstein E, Tabin CJ. The RNaseIII enzyme Dicer is required for morphogenesis but not patterning of the vertebrate limb. Proc Natl Acad Sci USA 102: 10898–10903, 2005.[Abstract/Free Full Text]
  19. Harris KS, Zhang Z, McManus MT, Harfe BD, Sun X. Dicer function is essential for lung epithelium morphogenesis. Proc Natl Acad Sci USA 103: 2208–2213, 2006.[Abstract/Free Full Text]
  20. Huppertz B, Herrler A. Regulation of proliferation and apoptosis during development of the preimplantation embryo and the placenta. Birth Defects Res C Embryo Today 75: 249–261, 2005.[CrossRef][Medline]
  21. Karube Y, Tanaka H, Osada H, Tomida S, Tatematsu Y, Yanagisawa K, Yatabe Y, Takamizawa J, Miyoshi S, Mitsudomi T, Takahashi T. Reduced expression of Dicer associated with poor prognosis in lung cancer patients. Cancer Sci 96: 111–115, 2005.[CrossRef][Medline]
  22. Kaul D, Sikand K. Defective RNA-mediated c-myc gene silencing pathway in Burkitt's lymphoma. Biochem Biophys Res Commun 313: 552–554, 2004.[CrossRef][Web of Science][Medline]
  23. Kerr LE, McGregor AL, Amet LE, Asada T, Spratt C, Allsopp TE, Harmar AJ, Shen S, Carlson G, Logan N, Kelly JS, Sharkey J. Mice overexpressing human caspase 3 appear phenotypically normal but exhibit increased apoptosis and larger lesion volumes in response to transient focal cerebral ischaemia. Cell Death Differ 11: 1102–1111, 2004.[CrossRef][Medline]
  24. Kitamura R, Takahashi T, Nakajima N, Isodono K, Asada S, Ueno H, Ueyama T, Yoshikawa T, Matsubara H, Oh H. Stage-specific role of endogenous Smad2 activation in cardiomyogenesis of embryonic stem cells. Circ Res 101: 78–87, 2007.[Abstract/Free Full Text]
  25. Kluk MJ, Hla T. Signaling of sphingosine-1-phosphate via the S1P/EDG-family of G-protein-coupled receptors. Biochim Biophys Acta 1582: 72–80, 2002.[Medline]
  26. Kuehbacher A, Urbich C, Zeiher AM, Dimmeler S. Role of Dicer and Drosha for endothelial microRNA expression and angiogenesis. Circ Res 101: 59–68, 2007.[Abstract/Free Full Text]
  27. Kumar MS, Lu J, Mercer KL, Golub TR, Jacks T. Impaired microRNA processing enhances cellular transformation and tumorigenesis. Nat Genet 39: 673–677, 2007.[CrossRef][Web of Science][Medline]
  28. Levkau B, Koyama H, Raines EW, Clurman BE, Herren B, Orth K, Roberts JM, Ross R. Cleavage of p21Cip1/Waf1 and p27Kip1 mediates apoptosis in endothelial cells through activation of Cdk2: role of a caspase cascade. Mol Cell 1: 553–563, 1998.[CrossRef][Web of Science][Medline]
  29. Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb J, Peck D, Sweet-Cordero A, Ebert BL, Mak RH, Ferrando AA, Downing JR, Jacks T, Horvitz HR, Golub TR. MicroRNA expression profiles classify human cancers. Nature 435: 834–838, 2005.[CrossRef][Web of Science][Medline]
  30. Mattiussi S, Matsumoto K, Illi B, Martelli F, Capogrossi MC, Gaetano C. Papilloma protein E6 abrogates shear stress-dependent survival in human endothelial cells: evidence for specialized functions of paxillin. Cardiovasc Res 70: 578–588, 2006.[Abstract/Free Full Text]
  31. Mercer J, Mahmoudi M, Bennett M. DNA damage, p53, apoptosis and vascular disease. Mutat Res 621: 75–86, 2007.[Web of Science][Medline]
  32. Michel JB. Anoikis in the cardiovascular system: known and unknown extracellular mediators. Arterioscler Thromb Vasc Biol 23: 2146–2154, 2003.[Abstract/Free Full Text]
  33. Muljo SA, Ansel KM, Kanellopoulou C, Livingston DM, Rao A, Rajewsky K. Aberrant T cell differentiation in the absence of Dicer. J Exp Med 202: 261–269, 2005.[Abstract/Free Full Text]
  34. Murakami M, Simons M. Fibroblast growth factor regulation of neovascularization. Curr Opin Hematol 15: 215–220, 2008.[CrossRef][Medline]
  35. Murchison EP, Partridge JF, Tam OH, Cheloufi S, Hannon GJ. Characterization of Dicer-deficient murine embryonic stem cells. Proc Natl Acad Sci USA 102: 12135–12140, 2005.[Abstract/Free Full Text]
  36. Murchison EP, Stein P, Xuan Z, Pan H, Zhang MQ, Schultz RM, Hannon GJ. Critical roles for Dicer in the female germline. Genes Dev 21: 682–693, 2007.[Abstract/Free Full Text]
  37. Nakajima N, Takahashi T, Kitamura R, Isodono K, Asada S, Ueyama T, Matsubara H, Oh H. MicroRNA-1 facilitates skeletal myogenic differentiation without affecting osteoblastic and adipogenic differentiation. Biochem Biophys Res Commun 350: 1006–1012, 2006.[CrossRef][Web of Science][Medline]
  38. O'Rourke JR, Georges SA, Seay HR, Tapscott SJ, McManus MT, Goldhamer DJ, Swanson MS, Harfe BD. Essential role for Dicer during skeletal muscle development. Dev Biol 311: 359–368, 2007.[CrossRef][Web of Science][Medline]
  39. Osborne N, Stainier DY. Lipid receptors in cardiovascular development. Annu Rev Physiol 65: 23–43, 2003.[CrossRef][Web of Science][Medline]
  40. Poliseno L, Tuccoli A, Mariani L, Evangelista M, Citti L, Woods K, Mercatanti A, Hammond S, Rainaldi G. MicroRNAs modulate the angiogenic properties of HUVECs. Blood 108: 3068–3071, 2006.[Abstract/Free Full Text]
  41. Provost P, Silverstein RA, Dishart D, Walfridsson J, Djupedal I, Kniola B, Wright A, Samuelsson B, Radmark O, Ekwall K. Dicer is required for chromosome segregation and gene silencing in fission yeast cells. Proc Natl Acad Sci USA 99: 16648–16653, 2002.[Abstract/Free Full Text]
  42. Rikitake Y, Hirata K, Kawashima S, Ozaki M, Takahashi T, Ogawa W, Inoue N, Yokoyama M. Involvement of endothelial nitric oxide in sphingosine-1-phosphate-induced angiogenesis. Arterioscler Thromb Vasc Biol 22: 108–114, 2002.[Abstract/Free Full Text]
  43. Rivera-Lopez CM, Tucker AL, Lynch KR. Lysophosphatidic acid (LPA) and angiogenesis. Angiogenesis 11: 301–310, 2008.[Medline]
  44. Schmidmaier R, Baumann P. ANTI-ADHESION evolves to a promising therapeutic concept in oncology. Curr Med Chem 15: 978–990, 2008.[CrossRef][Web of Science][Medline]
  45. Song L, Tuan RS. MicroRNAs and cell differentiation in mammalian development. Birth Defects Res C Embryo Today 78: 140–149, 2006.[CrossRef][Medline]
  46. Stupack DG, Cheresh DA. Apoptotic cues from the extracellular matrix: regulators of angiogenesis. Oncogene 22: 9022–9029, 2003.[CrossRef][Web of Science][Medline]
  47. Suárez Y, Fernandez-Hernando C, Pober JS, Sessa WC. Dicer dependent microRNAs regulate gene expression and functions in human endothelial cells. Circ Res 100: 1164–1173, 2007.[Abstract/Free Full Text]
  48. Tateishi K, Ashihara E, Takehara N, Nomura T, Honsho S, Nakagami T, Morikawa S, Takahashi T, Ueyama T, Matsubara H, Oh H. Clonally amplified cardiac stem cells are regulated by Sca-1 signaling for efficient cardiovascular regeneration. J Cell Sci 120: 1791–1800, 2007.[Abstract/Free Full Text]
  49. Woo M, Hakem R, Soengas MS, Duncan GS, Shahinian A, Kagi D, Hakem A, McCurrach M, Khoo W, Kaufman SA, Senaldi G, Howard T, Lowe SW, Mak TW. Essential contribution of caspase 3/CPP32 to apoptosis and its associated nuclear changes. Genes Dev 12: 806–819, 1998.[Abstract/Free Full Text]
  50. Yang WJ, Yang DD, Na S, Sandusky GE, Zhang Q, Zhao G. Dicer is required for embryonic angiogenesis during mouse development. J Biol Chem 280: 9330–9335, 2005.[Abstract/Free Full Text]
  51. Yee KL, Weaver VM, Hammer DA. Integrin-mediated signalling through the MAP-kinase pathway. IET Syst Biol 2: 8–15, 2008.
  52. Zamir E, Geiger B. Molecular complexity and dynamics of cell-matrix adhesions. J Cell Sci 114: 3583–3590, 2001.[Web of Science][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
295/6/H2512    most recent
00233.2008v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Asada, S.
Right arrow Articles by Oh, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Asada, S.
Right arrow Articles by Oh, H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2008 by the American Physiological Society.