Table 1.

Overview of primers used for RT-PCR and DNA methylation status quantification (5′→ 3′)

Primers used for quantitative RT-PCR
    36B4
        ForwardGTTGCCTCAGTGCCTCACTC
        ReverseGCAGCCGCAAATGCAGATGG
    Angiotensin 1 receptor
        ForwardCTGGTTCACTGGCTGTTGAC
        ReverseGGAAGATGGTGGCAACCAAG
Atrial natriuretic peptide
        ForwardATGGGCTCCTTCTCCATCAC
        ReverseTCTACCGGCATCTTCTCCTC
Pannexin-1
        ForwardAGACCAAGGGAGAGGACCA
        ReverseGCTGCTCAGGTFCCAAATCTT
Renin
        ForwardGTTGCTCTGGACCTCTTGTA
        ReverseCACTGATCCTGGTCATGTCT
Vitamin D receptor
        ForwardGAGATTGCCGCATCACCAAG
        ReverseACGCTGTACCTCCTCATCTG
Primers used for pyrosequencing
    Pannexin-1
        ForwardGGTTAGTAGGAGATAGGGTGGGGTTA
        Reverse, biotinylatedATCACACCCCCTACTCAACTCCC
        SequencingTTTTAGGTAAGTTGTTGTTT
Sequence (CpG-island) to analyze of Panx1TTGYGYGTTT AAGGYGGTYG
GAGTTTTGGT GTYGYGYGYG
TTGGGGATTY G